explain xkcd - User contributions [en]

Talk:2298: Coronavirus Genome

2020-04-26T15:11:17Z

108.162.216.188: Spellcheck vs Finnegans Wake

Epigenetics is a pun, right? I think it's a pun but I don't know what and it's maddening. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 23:03, 24 April 2020 (UTC)
:...{{w|Epigenetics}} is a real thing—the study of how changes in things other than the genome itself can be passed down between generations. An example is conditioning a mouse to be scared of the smell of oranges/cherries/almonds by having them associate the scent of acetophenone with an electric shock, then testing whether its pups also have the same fear of that smell: they do, but this obviously can't be by the genome itself changing (no component of this has a lot of ionizing radiation{{Citation needed}}). Whatever causes this is the topic of actual epigenetics. --[[User:Volleo6144|Volleo6144]] ([[User talk:Volleo6144|talk]]) 00:12, 25 April 2020 (UTC)
::I know that, I added the link to the article. But afaik that has nothing to do with how the genome is formatted in Word, and I think it's a pun. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 00:31, 25 April 2020 (UTC)

since when does notepad have spellcheck? [[Special:Contributions/172.68.226.46|172.68.226.46]] 23:05, 24 April 2020 (UTC)
: Word does, so maybe she is using Word instead? Kind of contradictory. [[Special:Contributions/172.69.34.46|172.69.34.46]] 23:14, 24 April 2020 (UTC)

When Dr. Theall first scanned Finnegans Wake, he had to tell Microsoft the language was Old Icelandic.

The OCR kept trying to spellcheck Finnegans Wake.15:11, 26 April 2020 (UTC)~
True Story: In the 1980s, as part of the Work Experience initiative at my school, I was assigned to one of my local council's offices (I'd applied for their computer department, but someone else got that). I don't ''think'' the word-processor I used at home (Psion Exchange) had spellcheck, but the one the office used (Lotus? Can't actually recall, but it, like most things, was DOS-based) definitely had, and it was very easy to edit in new words. Inspired by the chemistry lessons I'd recently had, and some 'reports' I was asked to write (keeping the kid busy, more like!) that dealt with chemical degradation of concrete under the action of salt and suchlike, I of course added "NaCl" then absolutely any other chemical formulae I could think of. "H2SO4" was an early one (partial subscript formatting wasn't relevent to the spill-chucker) but I eventually got round to CH4, C2H6, C3H8, etc, and then as many of the derived alcohols, alkenes, alkynes, etc that I could be bothered to type in. Which were a lot. By the end I was 'confident' that nobody would ever type ''any'' correct chemical formula into that machine (no network-shared resources!) and have to worry about false-positive typo alerts. Yeah, well, I was still at school and thought I knew ''everything''. [[Special:Contributions/162.158.159.70|162.158.159.70]] 23:37, 24 April 2020 (UTC)

Can confirm: virus genomes are looked at in notepad. I worked at one of the national laboratories for a summer, experimenting with ways to check for the length of a gene and strength of genetic expression in various circumstances in E. coli. We used notepad because even old computers can open very large files without difficulty, and all our scripts were in Perl, which can easily output to .rtf or .txt file formats. These files are huge, by the way. If you hold down on the scroll bar so it's zooming to the bottom, you could be waiting 20 minutes to reach the end depending on the number of kilobase pairs in your microbe. And epigenetics is not a pun. It's a real word. [[Special:Contributions/172.68.143.192|172.68.143.192]] 00:15, 25 April 2020 (UTC)

Concurrent to the work in the medical community, work is underway in various open source software communities to fix bugs and other issues with software (eg genome analysis tools) that is useful to the scientists combatting COVID-19. These include the Debian "biohackathon" (https://lwn.net/Articles/816280/) as well as support from Mozilla (https://lwn.net/Articles/816386/). Parallel to these efforts, the FSF (Free Software Foundation) has focused on the shortage of medical equipment: https://lwn.net/Articles/816392/ [[Special:Contributions/108.162.242.5|108.162.242.5]] 00:34, 25 April 2020 (UTC)

I’m suddenly inspired to write a DNA-edit-mode for Emacs (if it doesn’t have it already) which would allow for the virus spell check as described in this comic. [[Special:Contributions/172.69.63.153|172.69.63.153]] 04:16, 25 April 2020 (UTC)

- the dna-mode for emacs does exist. Google for it. It is not very useful for real work, though. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)

Derek Lowe has some insights about actual coronavirus mutations [https://blogs.sciencemag.org/pipeline/archives/2020/04/21/watching-for-mutations-in-the-coronavirus here], if you are interested.

Given coronavirus has an RNA genome, shouldn't all the 'T's be replaced by 'U's?

- It is standard practice no to use U's in public sequence database. It simplifies things. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)

The sequence in the transcript does not actually appear on the [https://www.ebi.ac.uk/ena/data/view/MT344963&display=text site] mentioned in the explanation. In fact, when I google for 'TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA' I only get this particular site.
:
UNSIGNED COMMENT: PLEASE SIGN WITH "<nowiki>~~~~</nowiki>"
:To find this (or any) sequence go to [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome|Nucleotide Blast]] and paste the query into the box. You will receive a list of a number of best matches (10, 50 or 100 in standard search), this should look like [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastSearch&VIEW_SEARCH=on&UNIQ_SEARCH_NAME=A_SearchOptions_1jST3G_gRB_dgzLunnk2EC_23turP_1HUFpP|this]]
Interestingly, this is an US-specific strain of the virus (top result currently is "Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/NC_0025/2020").[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 23:21, 25 April 2020 (UTC)
:Well, ''obviously'' it's a new variant, yet unknown to other clinical studies. Of RNA that has switched to looking like DNA, so this is a hot discovery! [[Special:Contributions/162.158.159.142|162.158.159.142]] 12:05, 25 April 2020 (UTC)

: The site shows several views into the public database entry that are easier to understand by humans than the raw sequence. Click the link at 'View: TEXT'. and scroll down. The relevant lines look like this:

aatccagtaa tggaaccaat ttatgatgaa ccgacgacga ctactagcgt gcctttgtaa 26220

gcacaagctg attagtacga acttatgtac tcattcgttt cggaagagac aggtacgtta 26280

As you can see, these are not meant to be search for and compared in "a notepad". For the same reason, google does not index DNA sequence database entries. There are specialised tools for that.

The sequnces were published this month, so they are available only in the most recent sequence database updates. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)

I have had trouble opening .txt files of even a hundred KB in Notepad! Sometimes it even crashes... It's one of the reasons I started using Notepad++. Notepad++ also happens to have a very extensible spellcheck, & language-specific formatting options. Since I often need to use Windows machines, it's one of my most frequently installed apps, after 7Zip.
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 18:03, 25 April 2020 (UTC)

The Grammar Checker concept only has a {{w|Colorless_green_ideas_sleep_furiously|limited analytical sophistication}}, though I don't doubt it'd still be enough to get a Nobel given the complexity of the task of deriving trivially feasible sequences from total codswallop. I also added the "next step" (probably much more than a single step), when I revised things, but that might actually be overstepping the explanation of the comic and removable. [[Special:Contributions/162.158.155.122|162.158.155.122]] 20:32, 25 April 2020 (UTC)
:Thanks for mentioning this in the discussion area, as I wondered what that "next step" line meant when I read it a little while ago, let alone how it related to the comic. I'll go ahead and trim that last "next step" sentence off the end, as I think it is unnecessary. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 03:36, 26 April 2020 (UTC)

Talk:2283: Exa-Exabyte

2020-03-24T16:06:39Z

108.162.216.188: Added comment(s).

Is this the first non-coronavirus related comic after eight in a row? -- brad
:My personal suspicion is that this one came out so late in the day because Randall was trying to think up another coronavirus-related comic so as not to break his streak :) [[Special:Contributions/108.162.242.5|108.162.242.5]] 20:05, 20 March 2020 (UTC)
::We sure this is not covid-19 related? A comic revolving around how hard biology is doesn't seem to me like a definite chain breaker for a biology related topic. Though I'll admit its a bit of a stretch [[Special:Contributions/172.69.198.58|172.69.198.58]] 21:14, 20 March 2020 (UTC)
:::I'm pretty sure the comic is SARS-CoV-2 related. The virus genome can be found all over the internet lately, it is even used for spamming. [[User:Condor70|Condor70]] ([[User talk:Condor70|talk]]) 21:32, 20 March 2020 (UTC)
::::Did someone already modified SARS-CoV-2 to be able to infect computers as well? -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:35, 20 March 2020 (UTC)
:::::Hm, not that I can find... This looks like a job for xkcd readers! Somebody get right on this, please. [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 06:12, 21 March 2020 (UTC)
::::::I also immediately thought of COVID19 when he started on biology. Of course is can be dabated if this comic has nothing to do with the vira, but it is still about how much life there is and big numbers. And he amount of vira in the world is a big number... Hard to imagine, just like exponential growth is hard for humans to understand. I'd say that if the next comic on Monday is again clearly on COVID19 then the strak did not end here, just took a detour around some aspect of biology related to the problems at hand. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 16:54, 21 March 2020 (UTC)
:::::::(...a job for xkcd readers...) I have a different idea: Rewrite the {{w|EICAR test file}} as an equivalently functional (R|D)NA package. Nothing can go wrong! [[Special:Contributions/162.158.92.98|162.158.92.98]] 19:35, 21 March 2020 (UTC)
::::::::The funny thing about the exa-exabyte calculation is that it vastly underestimates the actual information entropy of DNA. For example, it doesn't take into account [https://en.wikipedia.org/wiki/Epigenetics epigenetic modifications] (e.g. histone acetylation and DNA methylation) in [https://en.wikipedia.org/wiki/Eukaryote eukaryotes]. Interestingly, one reason why biologists can't get cloning to work is because simply copying the genome leaves behind epigenetic modifications (the "epigenome") that are critical to proper development and normally passed down through inheritance. In addition, most of the human genome doesn't even code for proteins (which is what people usually think of in terms of the information DNA encodes). Some of the genome encodes RNAs like [https://en.wikipedia.org/wiki/Piwi-interacting_RNA piwi-interacting RNA], which function in RNA silencing and epigenetic effects and probably other things biologists don't even know about yet. Even weirder are [https://en.wikipedia.org/wiki/Transposable_element transposons], which are mobile DNA sequences that jump around in the genome and can cause mutations and such. Biology is full of feedback loops, so stuff like epigenetic modification will affect the 3D structure of DNA, which can affect gene expression, which can affect epigenetic modification, and it's turtles all the way down. This is the messy [https://en.wikipedia.org/wiki/Schistocyte schistocyte] you get when evolution programs an organism's code. Simply counting DNA bases only hints at the true complexity of biology. BTW, HCoV-19 (human coronavirus 2019, another name for SARS-CoV-2 that I prefer because it avoids confusion with the 2003 SARS pandemic) happens to use RNA instead of DNA for its genome, for some reason. ¯\_(ツ)_/¯ --[[User:In vivo veritas|In vivo veritas]] ([[User talk:In vivo veritas|talk]]) 05:15, 22 March 2020 (UTC)

So, is she counting all of humanity as one string of DNA data, or does each human count separately, or each cell in a human's body, or what?
[[Special:Contributions/162.158.74.215|162.158.74.215]] 21:48, 20 March 2020 (UTC)
: According to the NYT article, it was calculating "number of cells contained in each organism and multiplied that by the amount of DNA contained in each cell". [[Special:Contributions/172.69.33.161|172.69.33.161]] 22:46, 20 March 2020 (UTC)
:: So, very small part of it would be each human cell counted separately. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:35, 20 March 2020 (UTC)
:::Good lord, that's got to be 92% or more redundant data; somebody teach these folk about the wonders of compression & differential versioning databases. ;S [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 06:15, 21 March 2020 (UTC)

'This is a comic about the difficulty of picturing or understanding large numbers. As mentioned in the comic, an exabyte is 10^18 bytes, while an "exa-exabyte" -- not a real word but one that makes sense if you apply the principles of metric prefixes' One of the principles of metric prefixes (which can be found in the linked page) is 'Prefixes may not be used in combination.' So "exa-exa" does not make sense in the metric world. It only makes "sense" in the messed up world were you lbf/lbm has the value 1 instead of g.[[Special:Contributions/172.68.65.138|172.68.65.138]] 01:54, 21 March 2020 (UTC)
:I've heard the term "gigakilogram(me)" used before. Probably due to the kilo being the base SI unit, rather than the prefixless gram/gramme. Just makes that Fermiation of derived compound units easier to work with, like the Newtons arising from a 'Gkg'x'Mm'/'das'² calculation being (?check?... 9+6-(2*1)=13, IIRC) of the final order of ~10TN. That said, I'd rather have liked to have seen the units instead being double-prefixed as "Terayotta-", because it sounds like a funny version of "terracotta". Or, as yotta- is essentially teratera-, go one stage further and use terateratera-... (Or picoyottayotta-?) [[Special:Contributions/162.158.92.98|162.158.92.98]] 19:58, 21 March 2020 (UTC)

Most the data is redundant though. Compressed, and it definitely should be, it would take only about 2% as much space to store. [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 05:32, 21 March 2020 (UTC)
:Glad somebody else already noted that.
:'''I think this should be noted in the explanation.'''
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 06:18, 21 March 2020 (UTC)
:Good point -- 10000000000000000000000000000000000000 bytes is obviously much more than 200000000000000000000000000000000000 bytes. [[Special:Contributions/162.158.91.101|162.158.91.101]] 11:39, 23 March 2020 (UTC)

It is worth mentioning that Randall is also mocking the education system for its lack of ability of explaining complex stuff to pupils. The teacher here is supposed to be able to provide different analogies from real life so that there is a chance of getting a feeling of the magnitude of the underlying number. Instead, she just repeats the explanation in the same mathematical terms as the original concept. That clearly doesn't help. Even worse, it prompts another student to attempt to explain it in even simpler terms but miss the point completely. The irony here is that incorrect but easy to understand explanation is accepted and not the correct one. Here it's also possible to mention similarities regarding climate change information not getting through to the general public but that would be a stretch. Also, what's the whole point of understanding these numbers if they are just a funny statistical fact? -- [[User:SomethingLike|SomethingLike]] ([[User talk:SomethingLike|talk]]) 06:15, 21 March 2020 (UTC)

"if(`Can you picture 36?`){return `Picture a number with 36 digits.`;}
[[Special:Contributions/172.68.154.70|172.68.154.70]] 09:25, 21 March 2020 (UTC)
[[Special:Contributions/172.68.154.70|172.68.154.70]] 09:30, 21 March 2020 (UTC)

Suppose there are 4e37 base pairs. There are four possible bases, although the pair has to match, so each pair still only encodes two bits, for a total of 8e37 bits, or 1e37 bytes. --[[Special:Contributions/162.158.38.66|162.158.38.66]] 11:07, 21 March 2020 (UTC)

If every human that has ever lived had a life span equal to the age of the universe, and every second of every day of their lives they created a one gigabyte storage device, there would still not be enough storage space to store 10 exa-exabytes. [[User:HisHighestMinion|HisHighestMinion]] ([[User talk:HisHighestMinion|talk]]) 22:07, 21 March 2020 (UTC)

By my calculations, if each of those 10 exa-exabytes is represented by 1 molecule of water... Then we are talking about a body of water the size of the {{w|Wachusett Reservoir}}. --[[User:Divad27182|Divad27182]] ([[User talk:Divad27182|talk]]) 00:29, 22 March 2020 (UTC)

Or almost exactly the amount of molecules of ammonia in the atmosphere.

It might be interesting to try and picture this number in terms of video bandwidth. HDMI requires about 128 Gbit/s for 8K video at 120 fps with 10-bit HDR <ref>[[wikipedia:HDMI#Refresh frequency limits for HDR10 video]]</ref>. That translates to 16 GB/s. 1036 bytes would therefore translate to 6.25x1026 seconds or 2x1019 years or 20,000,000 trillion years (or about 4.4 billion times the age of the earth<ref>[[wikipedia:Age of the Earth]]</ref>) of 8K 120 Hz HDR video. Or enough so that the entire population of the Earth (7.7 billion people<ref>[[wikipedia:World population]]</ref>) could all watch separate streams at this resolution for 2.5 billion years. Still mind-bogglingly huge, but maybe something approaching comprehensibility? [[User:Shamino|Shamino]] ([[User talk:Shamino|talk]]) 03:28, 22 March 2020 (UTC)
:But that 128 gigabit per second figure is for ''uncompressed'' video, which doesn't occur in home usage. Whether by streaming, BluRay, or even imported straight from a camera head, all the video handled after export from "RAW" format is compressed, even if losslessly. The transport formats most commonly used with HDMI are compressed too, though not much. Streaming services in particular use a ''lot'' of compression (not even lossless); it could be ''much'' better compression for the same visual quality, if hardware x265 codec support were more common. A .ts stream is compressed... The list goes on. Figures given for video data rates are massively overstated in an ongoing campaign to misrepresent symptoms of error correction losses & multiple-access delays as stemming from fictitiously large payload size instead. Most users never come near the "max speeds" of any of their various connections for more than a few minutes a day, yet ISPs & hardware makers would rather upsell "faster top speed" connections than offer sane top speeds & warranty a minimum data rate. Massively overstating throughput by substituting theoretical lab peak calculations is a long standing practice spanning almost all digital industries & those absurd data rates purported from one end of the video industry to another are no exception.
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 20:24, 22 March 2020 (UTC)

I'm going to call shenanigans on this "apples can't be exponents" in the explanation, that's inaccurate. [[Special:Contributions/108.162.216.188|108.162.216.188]] 16:06, 24 March 2020 (UTC)

1500: Upside-Down Map

2015-03-20T17:21:00Z

108.162.216.188: /* Explanation */

{{comic
| number = 1500
| date = March 18, 2015
| title = Upside-Down Map
| image = upside_down_map.png
| titletext = Due to their proximity across the channel, there's long been tension between North Korea and the United Kingdom of Great Britain and Southern Ireland.
}}

==Explanation==
It has been said that maps with the {{w|South-up map orientation|south pole at the top}} will "change your perspective of the world". Such a map can easily be achieved by simply rotating a normal map 180 degrees, though the text labels would also be upside-down and perhaps harder to read. A [https://www.google.com/search?site=&tbm=isch&q=upside-down%2Bmap%2Bof%2Bthe%2Bworld Google Images] search reveals many examples of upside-down maps with the text oriented correctly for reading. [[977: Map Projections]] is also relevant.

This map is a comedic play on that where instead of the whole map being upside-down, each land mass is in the same position it would be in a traditional north-top map but rotated 180 degrees (presumably around some central point of the landmass) to the orientation it would have in a south-top map. Note that individual islands are rotated about their own centers, not following the rotation of the neighboring continent; however, some are displaced as necessary to keep them from being overlapped by the rotated continents. For instance, {{w|Madagascar}} would be overlapped by the {{w|Sahara}} if it remained in position, but is instead displaced eastward to keep it in the Indian Ocean. On the other hand all the islands of the {{w|Mediterranean Sea}} have disappeared under {{w|Asia}}.

Asia is so broad that almost the entire {{w|Indochinese Peninsula}} (with for instance {{w|Vietnam}} and {{w|Thailand}}) has been rotated out of the top of the map. Similarly, the map omits {{w|Antarctica}} in the south.

To keep their familiar shapes on a rectangular map, the continents would also have to be heavily distorted compared to their actual shapes, becoming much narrower (along the lines of latitude) near the poles and wider towards the equator. See also [[977: Map Projections]].

The basic climates for several areas would be distinctly different. For example, the formerly-Central America area would be in the arctic zone while Siberia would be subtropical.

This arrangement of the world's land masses would have great advantages for trade, because there are (presumably navigable) straits between the {{w|Americas}} and between Africa and Asia, removing the need for the {{w|Panama Canal}} and the {{w|Suez Canal}}.

The title text references the fact that in this new map, the {{w|United Kingdom of Great Britain and Northern Ireland}} (UK) is now next to Asia, specifically the {{w|Korean Peninsula}}. {{w|North Korea}}, is mentioned in the text, having a history of hostile relations with nearby countries. However, on this map North Korea would be the part of {{w|Korea}} we today know as {{w|South Korea}}, Further, {{w|Northern Ireland}} is now at the south of the {{w|island of Ireland}}, so the UK's full name would need to change to The United Kingdom of Great Britain and '''Southern''' Ireland. There have been several wars concerning the {{w|English Channel}}, mainly, but not only, between {{w|England}} and {{w|France}}. Likewise there has been a history of animosity between Korea and {{w|Japan}}, separated by a similar body of water. Since a channel now, on this world map, exists between the UK and North Korea (the real world's South Korea) there could obviously have been many wars for the dominance over said channel.

Along the same line of thinking, interesting speculations could be made from the following "new" facts:
*{{w|Cuba}} is now off the east coast (formerly west coast) of {{w|Canada}} (and {{w|USA}}).
*{{w|Japan}} is next to the coast of {{w|Portugal}} and {{w|Spain}}.
*Madagascar lies next to {{w|Morocco}} and {{w|Mauritania}} on the east coast (formerly west coast) of Sahara.
*{{w|Taiwan}} is now next to France. It is though doubtful whether they get along any better with the French than with the mainland {{w|China|Chinese}}.
*{{w|Greenland}} lies next to {{w|Mexico}}.
*{{w|Sri Lanka}} is located next to the {{w|Yamalsky District}} of {{w|Russia}}.
*The island {{w|Isla Grande de Tierra del Fuego|Tierra del Fuego}}, an island just south of the southern tip of South America, which is divided between {{w|Argentina}} and {{w|Chile}} is now located in a similar manner next to {{w|Colombia}} and {{w|Venezuela}}. So it would probably have been divided between these two countries.
*The {{w|Falkland Islands}} (not named in the map, they are probably represented by the single island above the T in Tierra) where Argentina and UK have an ongoing {{w|Falkland Islands sovereignty dispute|sovereignty dispute}} now could be claimed by {{w|Ecuador}} or {{w|Peru}}.
*The Mediterranean islands seem to have vanished entirely, as they are now in approximately the same place as {{w|Mongolia}}.

==Transcript==
:[Map of the world with all the landmasses rotated upside-down.]
:[Four oceans and all the visible continents have been named in large letters in a bold font. The Pacific has been named both to the left and right. Several islands (large and small) have been designated with name but in grey and in a much smaller normal font. For all continents the names are written on them. For the island the name is written in the ocean except for Greenland.]

:[Below the names on the map are given in the order they appear reading from left to right, first for the northern and then the southern hemisphere:]

:[Northern hemisphere:]
:'''North America'''
:Cuba
:Greenland
:'''Atlantic Ocean
:Iceland
:UK
:'''Asia'''
:Sri Lanka
:'''Europe'''
:'''Arctic Ocean'''
:Taiwan
:Japan
:'''Pacific Ocean'''

:[Southern hemisphere:]
:'''Pacific Ocean'''
:'''South America'''
:Tierra del Fuego
:'''Africa'''
:'''Indian Ocean'''
:Madagascar
:Indonesia
:'''Australia'''
:New Zealand

:[Below the main frame:]
:'''This upside-down map will change your perspective on the world!'''

{{comic discussion}}
[[Category:Geography]]
[[Category:Maps]]

60: Super Bowl

2015-03-05T04:22:14Z

108.162.216.188: /* Explanation */

{{comic
| number = 60
| date = February 6, 2006
| title = Super Bowl
| image = super bowl.jpg
| titletext = The Super Bowl is actually an elaborate ruse, concocted by a shadowy group in the mid sixties for this purpose. The "watch it for the ads" addition was a master stroke.
}}

==Explanation==
The third in the "[[My Hobby]]" series. The {{w|Super Bowl}} is the championship (American) football game of the {{w|National Football League}} which is usually played each February. As it is one of the most watched television broadcasts in North America, advertising during the game became increasingly expensive (among the most expensive advertising rates of any broadcast) to the point where corporations would produce their best, most expensive advertisements to air during the game to ensure they would get value out of the expensive spots. The Super Bowl has thus become notorious for the "best" commercials, with some viewers purportedly tuning in strictly to see the commercials rather than the actual football game. News reports the next day often highlight the best and worst Super Bowl commercials, as do websites devoted to Super Bowl commercials.

Realizing that the Super Bowl is viewed by a large percentage of the population, [[Randall Munroe|Randall]] somewhat tongue-in-cheek states that those people would be quite distracted during that time, and therefore it would be possible to steal cars without fear of being caught. The title text takes this even further, suggesting that the entire Super Bowl was invented strictly for the purpose of being a distraction for car thieves. Naturally, the addition of the ads would make this even more effective, as it would attract even more viewers and simultaneously ensure that they stayed in front of the TV during commercial breaks as well as the game.

Randall may have chosen to use a car as a reference to the obscene amount of car commercials that play during the super bowl.

==Transcript==
:[A green car with text next to it.]
:My hobby:
:While everyone is watching the Super Bowl, feeling smugly superior because they're "Only watching for the ads," I steal cars.

{{comic discussion}}
[[Category:Comics with color]]
[[Category:My Hobby]]

417: The Man Who Fell Sideways

2015-03-03T16:00:46Z

108.162.216.188: /* Transcript */

{{comic
| number = 417
| date = April 30, 2008
| title = The Man Who Fell Sideways
| image = the man who fell sideways.png
| titletext = Strip originally conceived in conversation with Jeph Jacques. Soon to be a major motion picture.
}}

==Explanation==
[[File:A Matter of Some Gravity.png|right]]

This comic is humorously built-up like a short drama story, about a man with an unusual condition.

It might have been inspired by the {{w|Uncle Scrooge}} adventure comic "{{w|A Matter of Some Gravity}}" ([http://coa.inducks.org/story.php?c=D+96001 Inducks]) by {{w|Don Rosa}}, in which {{w|Magica de Spell}} makes gravity pull sideways at {{w|Scrooge McDuck}} and {{w|Donald Duck}}.

"Soon to be a major motion picture" in the title text might refer to {{w|The Curious Case of Benjamin Button (film)|The Curious Case of Benjamin Button}}, a film released later in 2008 (and based on a short story), in which the protagonist Benjamin suffers of the impossible condition of aging backwards.

"Over land... and sea", might be from the song "Nature Boy" by eden ahbez. Nat King Cole sung (the most famous version) about "A very strange, enchanted boy. They say he wandered very far, very far over land and sea".

The title text mentions {{w|Jeph Jacques}}, who is running the webcomic {{w|Questionable Content}}.

When Cueball hits Megan, he knocks her down and knocks her up. The baby shares his tendency to be pulled sideways by gravity, but this apparently does not start until it is born, because Megan and the doctor do not seem to have been expecting it. If gravity had affected the unborn fetus in the same way, Megan would have been able to feel it, would have noticed that her uterus was hanging differently, and would have had difficulty balancing due to the sideways forces.

The first part of the comic has some resemblance to this much later comic: [[1376: Jump]]

==Transcript==
:[Cueball standing, with a dotted line perpendicular to him and a 30 degree angle going downwards.]
:From a young age, gravity pulled him wrong.
:[Cueball bouncing around his house.]
:Sometimes east, sometimes west. When he was restrained, it grew erratic.
:''WHAM WHAM''
:[Cueball bouncing/rolling on the ground.]
:So he fell.
:Cueball: AAAA
:''THUMPA THUMPA''
:[Cueball bouncing/rolling on the ground in a desert.]
:Constantly
:Cueball: AAAAAAAAA
:[Cueball bouncing/rolling off a rock on the ground in a desert.]
:Over land...
:Cueball: AAAAA-''THUD''-A
:[Cueball bouncing/rolling on the ground in the desert.]
:Cueball: AAAAAAAAA
:[Cueball bouncing/rolling on the ground in the desert.]
:Cueball: A-''THUD''-AAAAAA
:[Cueball bouncing/rolling on the ground in the desert.]
:Cueball: AA-''THUD''-AAAAA
:[Cueball skating the surface of the sea.]
:And sea.
:Cueball: AAAAAAAAAAAA
:[Cueball skating the surface of the sea.]
:Cueball: AAAAAAAA
:[Cueball skating the surface of the sea.]
:Cueball: AAAAAA
:[Cueball skating the surface of the sea.]
:Cueball: AAAAAAAA
:[Tree in the savanna, with Cueball off the panel.]
:He found, where he could, food-
:Cueball: AAAAAAAAAAAA
:[Tree in the savanna, with Cueball still off the panel, but zoomed out so that part of Cueball's bounce/roll path is visible.]
:Cueball: AAAAAAAAA
:[Cueball upside-down, still bouncing/rolling in the savannah, with a gazelle galloping away from him.]
:''GALLOP GALLOP''
:Cueball: AAAAAAAAA
:[Savanna with a tree in it.]
:Cueball: AAAAAAAAAAA
:[Megan standing, with Cueball off screen.]
:And love.
:Cueball: AAAA-''THUD''-AAAA
:[Megan standing, with Cueball off screen.]
:Cueball: ''THUD'' ACK ''CRASH''
:[Cueball crashing into Megan]
:Cueball: Hiwhat'syourname-
:''WHAM''
:[Megan on the ground, with Cueball off screen.]
:Cueball: AAAAAAA-''THUD''-AAA
:[Megan speaking to Hairy.]
:Megan: I met this guy. He knocked me over and tumbled into the distance.
:[Megan speaking to the same man from the previous panel, with Hairy's hand to his mouth.]
:Megan: We only shared a few seconds, but in his panicked scream I heard something beautiful.
:[Megan speaking to the same man from the previous panel.]
:Megan: I think... I think I'm...
:[Megan speaking to the same man from the previous panel.]
:Hairy: Falling for him?
:Megan: I wasn't going to say it.
:[Megan at hospital with doctor, giving birth.]
:She never saw him again. But nine months later...
:Doctor: Okay, push!
:[Megan at hospital with doctor and new baby, who is bouncing/rolling away.]
:Doctor: It's a gir-
:Megan: !!
:Doctor: Whoops!
:Baby: Ga! Ga!
:[Baby bouncing/rolling out of hospital.]
:Baby: WHEEEEEEEEEEEEE
:[Baby bouncing/rolling in front of a sunset.]
:Baby: EEEEEEEEEEEEEEEEEEE
:The End

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Hairy]]
[[Category:Comics with color]]
[[Category:Romance]]

1178: Pickup Artists

2015-01-04T02:45:37Z

108.162.216.188: /* Explanation */

{{comic
| number = 1178
| date = February 25, 2013
| title = Pickup Artists
| image = pickup artists.png
| titletext = It sounds like a great way to make friends! Is it near that Friend Zone you keep talking about? I wanna go!
}}

==Explanation==
A {{w|pickup artist}} is a person who considers himself skilled at picking up (finding, attracting and seducing) women, through various psychological tactics and tricks. [[Randall]] clearly does not see this as a healthy attitude towards women, something he elaborated on in [[1027: Pickup Artist]] (also featuring [[Hairy]]). [[800: Beautiful Dream]] is another previous frown upon pickup culture.

The term "pickup" in "pickup basketball" means informal and spontaneous. In pickup basketball the players are not part of an organized league or team but rather are just people who are available to play at that time and location. It's the way a basketball game can start on a local playground or at school. "Pickup" games generally have less formal rule structure compared to more formal forms of the games. See for example {{w|streetball}} for basketball or {{w|shinny}} for hockey.

As for the actual comic, Beret Guy thinks (or wants to think) that what pickup artists really do is gather spontaneously to practice {{w|art|artistry}}, like the {{w|visual arts}}. This makes the world seem a happier place, especially considering his own disposition for (eccentric) art.

The title text also shows Beret Guy's (pretended?) belief that the "{{w|friend zone}}" is a physical place. The "friend zone" refers to the state of a relationship in which one part has (hidden) romantic interests, but the other person only wants to be friends. Once the friend zone is established, it is said to be difficult to try to move beyond that point into a romantic relationship. Randall previously expressed criticism towards trying to just slip into a romantic relationship from the friend zone in [[513: Friends]].

==Transcript==
:Beret Guy: What've you been up to lately?
:Hairy: I've been hanging out with some pickup artists. I'm learning a lot!
:Beret Guy: Oh, that sounds like fun!

:The world seems like a happier place if you think "pickup artist" is like "pickup basketball player".

{{comic discussion}}
[[Category:Comics featuring Beret Guy]]
[[Category:Comics featuring Hairy]]

1140: Calendar of Meaningful Dates

2014-12-22T03:54:25Z

108.162.216.188: /* Explanation */

{{comic
| number = 1140
| date = November 28, 2012
| title = Calendar of Meaningful Dates
| image = calendar of meaningful dates.png
| titletext = In months other than September, the 11th is mentioned substantially less often than any other date. It's been that way since long before 9/11 and I have no idea why.
}}

==Explanation==
The calendar used in the comic is the standard {{w|Gregorian calendar}} used by most of western civilization. The comic looks at the frequencies of which dates appear in English writings indexed in the {{w|Google Books Library Project}}, by using the {{w|Google Ngram Viewer}} ([http://books.google.com/ngrams link]).

Some dates are more (or less) frequently mentioned because they have a special significance. For example:
*January 1 is {{w|New Year's Day|New Year's Day}}.
*February 14 is {{w|Valentine's Day}}.
*February 29 only exists during {{w|Leap year|leap years}}.
*March 15 is the {{w|Ides of March}}.
*March 21 is considered the first day of {{w|Spring (season)|spring}}, by a common convention in the northern hemisphere.
*April 1 is {{w|April Fools' Day}}.
*April 15 is {{w|Tax Day|US Individual Income Tax return filing day}}.
*May 1 is {{w|International Workers' Day|International Workers' Day}}, or {{w|May Day|May Day}}.
*June 4 is the {{w|June Fourth Incident}}, or the Tiananmen Square protests of 1989.
*June 30 is the end of the {{w|Fiscal Year| fiscal year}} for most American states and local governments.
*July 4 is {{w|Independence Day (United States)|US Independence Day}}.
*September 11 is the date of the {{w|September 11 attacks|2001 terrorist attacks}} in New York City and Washington DC. It's the largest number by a big margin, most likely because unlike the other dates it has no special name, it's referred to as "September 11" almost exclusively.
*December 7 is the date of the {{w|Attack on Pearl Harbor|1941 attack on Pearl Harbor}}.
*December 25 is {{w|Christmas|Christmas}}.
*December 31 is {{w|New Year's Eve|New Year's Eve}}.

In addition, the first of each month is generally more mentioned than others, perhaps because such dates are markers of a new month and may be used as landmark dates or deadlines. Similarly, the final day of each month is commonly a deadline day. Other dates have correlations for which there doesn't appear to be any obvious reasons; an example is noted in the title text.

The date mentioned in the sub-heading (October 17th) is Randall's birthday.

==Transcript==
:'''Calendar of Meaningful Dates'''
:Each date's size represents how often it is referred to by name (e.g. "October 17th") in English-language books since 2000
:(Source: Google ngrams corpus)
:[A regular Gregorian calendar laid out in a grid, Sunday first, on a leap year, with some numbers larger than others.]

{{comic discussion}}
[[Category:Charts]]

Talk:1460: SMFW

2014-12-15T19:39:32Z

108.162.216.188:

Reading this is like listening to the video of that lady who imitates the sound patterns of different languages, but without actually saying any real words! --[[User:Elipongo|Elipongo]] ([[User talk:Elipongo|talk]]) 05:34, 15 December 2014 (UTC)
:link? -- [[User:Brettpeirce|Brettpeirce]] ([[User talk:Brettpeirce|talk]]) 15:41, 15 December 2014 (UTC)
It would sound more natural if it were "''SMFW '''as''' an acronym almost makes sense''". Is the fact that "as" was omitted from that sentence supposed to give us a hint as to what "SMFW" might mean? [[User:Nicksh|Nicksh]] ([[User talk:Nicksh|talk]]) 07:16, 15 December 2014 (UTC)

: As "the Internet is for porn", in many contexts SFW, lit. Safe for Work, can be taken to mean sex-free content, while NSFW, Not Safe for Work, would mean sex-positive content, then SMFW might be interpreted to me SM For Work, where SM would be humorously interpreted as some graphically explicit sex-positive content, perhaps SadoMachoism, which outside of paperwork is generally classified NSFW. [[Special:Contributions/199.27.133.29|199.27.133.29]] 10:31, 15 December 2014 (UTC)

:: And "wtfw it's like smho tbfh, imdb." might be a defensive reaction to those what would not find humour of SM For Work. "what the fooking wut? It's like stick my humble opinion, to be fooking honest, in my dead body. (or database)." [[Special:Contributions/199.27.133.29|199.27.133.29]] 10:38, 15 December 2014 (UTC)

:: Additional evidence of SM For Work, would be the posture in the task chair with respect to the desk and laptop (hunched over, feet not resting on ground, etc) seems the opposite of ergonomic advice which might lead to muscle strain, pain and fatigue -- the type of unsexy, self-inflicted torments that workers do to themselves "for work" {{unsigned ip|199.27.133.29}}

I thought it was simply 'Save Me From Work' - being unhappy at work is common, and using the internet as a distraction from work is common as well. - So sending a quick message to a friend "SMFW" is a request for them to send you a link or other internet distraction, or otherwise help you come up with an excuse to not be productive.

I thought of So Much For Work as a possible meaning. {{unsigned ip|173.245.50.178}}

I think "SMFW" is a mixture of SMF and MFW: "So Much Fun When". It fits the sentence. The only thing is that Cueball doesn't look like he's having fun.

Smoke more fucking weed could be a replacement for something like "Bloody hell" or "Shit the bed".
[[Special:Contributions/141.101.98.252|141.101.98.252]] 09:05, 15 December 2014 (UTC)

So why doesn't "xkcd" appear on the acronyms list? --[[User:Koveras|Koveras]] ([[User talk:Koveras|talk]]) 09:47, 15 December 2014 (UTC)
: Because xkcd isnt an acronym. [[Special:Contributions/108.162.216.61|108.162.216.61]] 09:56, 15 December 2014 (UTC)

I would like to add STFW ("Search the fucking web", [http://en.wiktionary.org/wiki/STFW]) as an acronym that SMFW is close to (same except for the second letter)...but there might be enough examples? [[User:Aquaplanet|Aquaplanet]] ([[User talk:Aquaplanet|talk]]) 11:07, 15 December 2014 (UTC)

SMFW makes perfect sense. Shaking my face when (SMH+MFW) an acronym almost makes sense. {{unsigned|Sederts}}

See My Face When an acronym almost makes sense... makes perfect sense. [[Special:Contributions/141.101.99.4|141.101.99.4]] 13:26, 15 December 2014 (UTC)

"So Much Frustration When an acronym ''almost'' makes sense."
: +1 -- [[User:Brettpeirce|Brettpeirce]] ([[User talk:Brettpeirce|talk]]) 15:44, 15 December 2014 (UTC)
: I'd also like to add in my +1 on this -- [[Special:Contributions/108.162.216.188|108.162.216.188]] 19:39, 15 December 2014 (UTC)

"What to feel when it's like some message has only to be f...ing hashtags, is mostly deep bafflement." [[User:Ackegard|Ackegard]] ([[User talk:Ackegard|talk]]) 14:35, 15 December 2014 (UTC)

None of these are acronyms. [[Special:Contributions/199.27.128.115|199.27.128.115]] 14:55, 15 December 2014 (UTC)

So Much F*cking Want. So, uh. Yeah. [[Special:Contributions/108.162.237.124|108.162.237.124]] 15:10, 15 December 2014 (UTC)

Small Men Fear Women [[Special:Contributions/108.162.216.39|108.162.216.39]] 15:27, 15 December 2014 (UTC)

So Many Fucking Ways? {{unsigned ip|108.162.230.209}}

Staring, Mildly Frustrated When...? [[User:Kirdneh|Kirdneh]] ([[User talk:Kirdneh|talk]]) 17:50, 15 December 2014 (UTC)

"SMHO" could also be related to "LMHO," or "Laughing My Head Off." So, "Shaking My Head Off"? Something that makes you shake your head so hard it might fall off? [[User:Shanek|Shanek]] ([[User talk:Shanek|talk]]) 16:12, 15 December 2014 (UTC)

SMFW is an initialism. [[Special:Contributions/108.162.230.131|108.162.230.131]] 16:45, 15 December 2014 (UTC)

<pedantic>Initialisms are only acronyms when they can be pronounced </pendantic> [[User:Sideshowtanley|Sideshowtanley]] ([[User talk:Sideshowtanley|talk]]) 17:16, 15 December 2014 (UTC)

I was thinking "So M*therf*cking what?" as the meaning for the acronym, but Randall is more arcane than that :) [[Special:Contributions/173.245.49.148|173.245.49.148]] 17:49, 15 December 2014 (UTC)

"Social Media Forum Warrior" is what came to my mind. I may have been on the internets for too long. [[Special:Contributions/141.101.104.137|141.101.104.137]] 19:22, 15 December 2014 (UTC)

Could be an example of a stacked acronym with an acronym recursively nested in an acronym. Or it could be a portmanteau of two acronyms. Is there a term for a portmanteau of two acronyms? Portmonym? Acmanteau? --[[User:Gbleck|Gbleck]] ([[User talk:Gbleck|talk]]) 19:31, 15 December 2014 (UTC)gbleck

904: Sports

2014-12-14T00:17:16Z

108.162.216.188:

{{comic
| number = 904
| date = May 27, 2011
| title = Sports
| image = sports.png
| titletext = Also, all financial analysis. And, more directly, D&D.
}}

==Explanation==
A random number generator is any object or program that arbitrarily selects and produces a number from within a pre-defined range of numbers. For example, a single six-sided die will produce any integer between 1 and 6, inclusive. In an unweighted random number generator, every number that it can possibly produce has the same odds of coming up. When rolling a single {{w|Dice#Manufacturing|precision die}}, for instance, there is an equal chance of rolling a 1, 2, 3, 4, 5, or 6. Conversely, in a weighted random number generator, some numbers are more likely to come up than others. A {{w|Dice#Loaded_dice|loaded die}}, such as those used by swindlers to cheat at gambling, is an example of a weighted random generator.

All sports generate numbers that are inherently random. Home runs, goals, sacks, passes, shots, hits, misses, errors, and many more such statistics are generated in every match of every sports game. The rules of the particular sport, as well as the skill of the participants, introduces bias toward certain values; hence, sports matches are weighted random number generators.

If the generator is weighted to favor a specific team in a specific game, that is discussed. Then the results of the game (more random numbers) are discussed. It's the discussion that is the narrative part. If a player breaks a record, that becomes part of the narrative. The number is random, but weighted because of player skill or the rules of the sport.

This strip is one of several in which Randall attempts to trivialize sports.

The title text applies this to financial/stock results/forecasts as well. And, most appropriately to {{w|Dungeons & Dragons}} (D&D), which is a game where most aspects of the game are determined by rolling dice of various numbers of sides and the numerical results are woven into a narrative by the {{w|Dungeon Master}}.

==Transcript==
:[Two commentators sit behind a desk.]
:Commentator 1: A weighted random number generator just produced a new batch of numbers.
:Commentator 2: Let's use them to build narratives!
:ALL SPORTS COMMENTARY

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Math]]

904: Sports

2014-12-14T00:15:41Z

108.162.216.188: /* Explanation */

{{comic
| number = 904
| date = May 27, 2011
| title = Sports
| image = sports.png
| titletext = Also, all financial analysis. And, more directly, D&D.
}}

==Explanation==
A random number generator is any object or program that arbitrarily selects and produces a number from within a pre-defined range of numbers. For example, a single six-sided die will produce any integer between 1 and 6, inclusive. In an unweighted random number generator, every number that it can possibly produce has the same odds of coming up. When rolling a single {{w|Dice#Manufacturing|precision die}}, for instance, there is an equal chance of rolling a 1, 2, 3, 4, 5, or 6. Conversely, in a weighted random number generator, some numbers are more likely to come up than others. A weighted die, such as those used by swindlers to cheat at gambling, is an example of a weighted random generator.

All sports generate numbers that are inherently random. Home runs, goals, sacks, passes, shots, hits, misses, errors, and many more such statistics are generated in every match of every sports game. The rules of the particular sport, as well as the skill of the participants, introduces bias toward certain values; hence, sports matches are weighted random number generators.

If the generator is weighted to favor a specific team in a specific game, that is discussed. Then the results of the game (more random numbers) are discussed. It's the discussion that is the narrative part. If a player breaks a record, that becomes part of the narrative. The number is random, but weighted because of player skill or the rules of the sport.

This strip is one of several in which Randall attempts to trivialize sports.

The title text applies this to financial/stock results/forecasts as well. And, most appropriately to {{w|Dungeons & Dragons}} (D&D), which is a game where most aspects of the game are determined by rolling dice of various numbers of sides and the numerical results are woven into a narrative by the {{w|Dungeon Master}}.

==Transcript==
:[Two commentators sit behind a desk.]
:Commentator 1: A weighted random number generator just produced a new batch of numbers.
:Commentator 2: Let's use them to build narratives!
:ALL SPORTS COMMENTARY

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Math]]

565: Security Question

2014-12-11T02:47:33Z

108.162.216.188: /* Explanation */

{{comic
| number = 565
| date = April 3, 2009
| title = Security Question
| image = security_question.png
| titletext = Let's invite him to a party and play 'I never'. Okay, I never hid any bodies SOUTH of Main Street. ...he's taking a drink!
}}

==Explanation==
Security questions are sensitive questions that allow a user to retrieve or reset his password if the password is lost or stolen. Because of this powerful function, security questions should be treated just as seriously as passwords. Typical security questions include "What's your mother's maiden name?" or "What's your secondary school?" and are intended to be easy for the user to answer but hard for anyone else to answer.

In this comic, however, the security question is deployed in a strange way, as the question "Where are the bodies buried?" assumes that one had buried bodies, hence had killed someone. The question turns out to be a ploy by the police, who were trying to bait Cueball into confessing his crime, as well as revealing the location of the incriminating evidence.

[http://www.wikihow.com/Play-the-%22I%27ve-Never%22-Game "I never"] is a drinking game that somebody says "I never did something" to the others. If you never did it, you don't need to drink, otherwise, drink. Since he takes a drink for "I never hid any bodies SOUTH of Main Street", the police have narrowed down the search area. The next statement in the game could be "I never hid any bodies WEST of Central Avenue" (or whatever road dividing the area), further localizing the bodies to a quarter of the original search area, in a {{w|Twenty Questions}} manner. Of course, by taking the drink Cueball also admits having buried bodies ''at all''.

==Transcript==
:[Cueball sits at a computer.]
:Computer Screen: -Email Account Setup- To verify your identity, we need to ask you a question nobody else could answer.

:Computer Screen: Q: Where are the bodies buried? A:
:[A text field is shown with "Behind the" typed.]

:[Three stick figures, two wearing police hats and one wearing headphones, watch another computer.]
:[The same text field is shown with "Behind the ... nice try." typed.]
:Figure in Headphones: Damn.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Internet]]

586: Mission to Culture

2014-12-11T02:32:52Z

108.162.216.188: /* Explanation */

{{comic
| number = 586
| date = May 20, 2009
| title = Mission to Culture
| image = mission to culture.png
| titletext = It can't be very MUCH money... they apparently can't even afford a sampler. I mean, with a little remixing, some of this could be kinda good!
}}

==Explanation==
[[Cueball]] wants to take [[Megan]] out for his idea of a cultural experience. The inference is that Megan's culturally impoverished because 'all she ever listens to is techno'. After much griping on various levels, she starts to get into the experience — sort of. The big 'cultural lesson' she [mis-]gleans from the experience is similar to what a sporting aficionado would gain from watching a sports event.

Her observation regards the seating configuration of a typical modern orchestra, in which the violinists all sit audience-left, while the violists, cellists and bassists are on the right.

The title text basically just ices the cake. A {{w|sampler (musical instrument)|sampler}} is an instrument frequently used in techno music that samples other sounds and plays them back, usually electronically altered. {{w|Remix|Remixing}} is a process, also often used in techno, of editing recorded music to get a different sound.

==Transcript==
:[Cueball is pulling Megan by the legs. She is holding onto the ground.]
:Cueball: We're getting some culture in you if it ''kills'' you.
:Megan: Don't wanna.

:[Cueball is pushing Megan through a door.]
:Cueball: All you listen to is techno.
:Megan: But... the ''symphony?''

:[The couple stand in line between other people.]
:Megan: I think we're the only people here under 60.
:Cueball: Shhh.

:[The couple sit in the audience just before the concert.]
:Megan: The right side is definitely better.
:Cueball: Better?
:Megan: They've all got bigger instruments. I bet they make more money.
:Cueball: *Sigh*

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Music]]

1458: Small Moon

2014-12-10T14:01:40Z

108.162.216.188:

{{comic
| number = 1458
| date = December 10, 2014
| title = Small Moon
| image = small_moon.png
| titletext = GENERAL JAN DODONNA: An analysis of the plans provided by Princess Leia has reinvigorated the arguments of the 'artificial moonlet' and 'rogue planet-station' camps. I fear this question is fracturing the Rebellion.
}}

The comic depicts a classic scene from {{w|Star Wars Episode IV}}, in which the heroes trail a spacecraft to the never-before-seen Death Star: a super-weapon the size of a small moon capable of effortlessly demolishing entire planets. In the original scene and the comic, Luke misidentifies a body as a natural satellite, and Obi-Wan ominously corrects him. The comic's version diverges at this point, as the dialogue devolves into a rather bitter argument over the semantics of size classifications, alluding to scientific discussions on whether Pluto should be classified as a planet or as a dwarf planet.

The argument goes on for hours. This has two interpretations:
* The Death Star apparently never caught them, and Princess Leia was never rescued (but Ben survived).
* The argument was picked up after escaping the Death Star, and now Leia is joining in.

In our star system, however, the argument would be invalid. The Death Star is much larger (70 km radius) than dozens of {{w|List of natural satellites|full-fledged moons}} in our solar system.

The title text makes reference to a later scene in the film when Rebel pilots are being briefed on the planned attack on the the Death Star. Those who analysed the plans for the Death Star run into the same discussion picture, and end up arguing about the classification of the the Death Star, dividing those involved into the 'artificial moonlet' camp and the 'rogue planet-station' camp, thus deunifying the rebellion. If events are otherwise the same from the movie, this is also happening at threat of their destruction, and thus a crippling of the Rebellion.

==Transcript==
{{incomplete transcript|The last panel is vague on who is saying what.}}
:[Millennium Falcon follows a Tie Fighter towards an unidentified orb in the distance]
:Luke Skywalker: He's heading for that small moon.
:Ben Kenobi: That's no moon - it's a space station.
:Luke Skywalker: It's too big to be a space station.
:Ben Kenobi: But it's too '''''small''''' to be a moon.
:Three hours pass
:Unknown (Luke Skywalker?): Fine! What if we agree it's not a moon, but we make a new category called "Dwarf Moon"?
:Unknown (Ben Kenobi?): And what's the cutoff, asshole?! Is this '''''ship''''' a dwarf moon now?
:Unknown (Luke Skywalker?): Screw you.
{{comic discussion}}
[[Category:Space]]
[[Category:Star Wars]]

Talk:1458: Small Moon

2014-12-10T13:54:48Z

108.162.216.188:

I marked the transcript as incomplete; we can't be sure as to who is saying which lines in the final panel without Randall telling us himself. Notably, the second-to-last-line does not sound like something Ben Kenobi would say; more likely it's Han Solo. [[Special:Contributions/108.162.216.188|108.162.216.188]] 13:54, 10 December 2014 (UTC)

Probably another dig at the Pluto "dwarf planet" controversy?[[Special:Contributions/199.27.133.109|199.27.133.109]] 06:38, 10 December 2014 (UTC)

This is too good. I laughed for about 2 straight minutes.. :D [[Special:Contributions/199.27.128.89|199.27.128.89]] 06:50, 10 December 2014 (UTC)

Added a short placeholder explanation for the comic itself, using [[Special:Contributions/199.27.133.109|199.27.133.109]]'s suggestion. Needs refining and explaining of the alt text. Cheers. [[Special:Contributions/173.245.54.207|173.245.54.207]] 07:04, 10 December 2014 (UTC)

In the movie, they didn't have 3 hours to argue over the thing. Not sure if that's relevant... [[User:Haelbarde|Haelbarde]] ([[User talk:Haelbarde|talk]]) 07:11, 10 December 2014 (UTC)

The reason it couldn't be a space station would be that something so large would wind up collapsing in on its own gravity. [[Special:Contributions/173.245.54.204|173.245.54.204]] 08:38, 10 December 2014 (UTC)
:It's not solid, it's a comapritively low density on the whole (on the order of ten thousand million''th''s that of Earth's sea-level atmospheric pressure, if I've not thrown a rogue zero or two in to the calculation by accident, so is doubtless mostly vacuum outside of the functional/habitable/structural areas), there are obviously various gravitational compensators for the inhabited sections (hence "looking sideways out of the equator ring" and along the beam-channel, yet "up from the surface" from the trench system defence turrets and other internal shafts are also vertiginously 'up-down' in nature) and doubtless its structural stength is composed of various Unotanium (i.e. "durasteel") alloys and the like, way beyond what we could currently build with Earthly technology. [[Special:Contributions/141.101.98.245|141.101.98.245]] 10:37, 10 December 2014 (UTC)

I would note that a Death '''Star''' can not be a moon. [[User:Briff|Briff]] ([[User talk:Briff|talk]]) 10:10, 10 December 2014 (UTC)
:Note that it is canon that the "Star Destroyer"s are neither (if taken literally) capable of destroying stars nor (in the sense of "star ship" in general) are they technically destroyer-class ships. You've got to put it down to The Empire just having no sense of relevence when it comes to naming its vessels. Probably too much influence from clone-thinking... [[Special:Contributions/141.101.98.245|141.101.98.245]] 10:37, 10 December 2014 (UTC)
:I will argue that by my understanding of the term, it actually is a moon whenever it is orbiting a planet but it would probably be better to come up with new terminology given the interstellar capabilities. --[[Special:Contributions/108.162.237.183|108.162.237.183]] 12:44, 10 December 2014 (UTC)Band of Traveling Accountants

1458: Small Moon

2014-12-10T13:11:15Z

108.162.216.188:

{{comic
| number = 1458
| date = December 10, 2014
| title = Small Moon
| image = small_moon.png
| titletext = GENERAL JAN DODONNA: An analysis of the plans provided by Princess Leia has reinvigorated the arguments of the 'artificial moonlet' and 'rogue planet-station' camps. I fear this question is fracturing the Rebellion.
}}

The comic depicts a classic scene from {{w|Star Wars Episode IV}}, in which the heroes trail a spacecraft to the never-before-seen Death Star: a super-weapon the size of a small moon capable of effortlessly demolishing entire planets. In the original scene and the comic, Luke misidentifies a body as a natural satellite, and Obi-Wan ominously corrects him. The comic's version diverges at this point, as the dialogue devolves into a rather bitter argument over the semantics of size classifications, alluding to scientific discussions on whether Pluto should be classified as a planet or as a dwarf planet.

The argument goes on for hours, indicating that the Death Star apparently never caught them. Presumably, Princess Leia was never rescued.

In our star system, however, the argument would be invalid. The Death Star is much larger (70km radius) than dozens of {{w|List of natural satellites|full-fledged moons}} in our solar system.

The title text makes reference to a later scene in the film when Rebel pilots are being briefed on the planned attack on the the Death Star. Those who analysed the plans for the Death Star run into the same discussion picture, and end up arguing about the classification of the the Death Star, dividing those involved into the 'artificial moonlet' camp and the 'rogue planet-station' camp, thus deunifying the rebellion. If events are otherwise the same from the movie, this is also happening at threat of their destruction, and thus a crippling of the Rebellion.

==Transcript==
:[Millennium Falcon follows a Tie Fighter towards an unidentified orb in the distance]
:Luke Skywalker: He's heading for that small moon.
:Ben Kenobi: That's no moon - it's a space station.
:Luke Skywalker: It's too big to be a space station.
:Ben Kenobi: But it's too '''''small''''' to be a moon.
:Three hours pass
:Luke Skywalker: Fine! What if we agree it's not a moon, but we make a new category called "Dwarf Moon"?
:Ben Kenobi: And what's the cutoff, asshole?! Is this '''''ship''''' a dwarf moon now?
:Luke Skywalker: Screw you.
{{comic discussion}}
[[Category:Space]]
[[Category:Star Wars]]

1458: Small Moon

2014-12-10T12:57:47Z

108.162.216.188:

{{comic
| number = 1458
| date = December 10, 2014
| title = Small Moon
| image = small_moon.png
| titletext = GENERAL JAN DODONNA: An analysis of the plans provided by Princess Leia has reinvigorated the arguments of the 'artificial moonlet' and 'rogue planet-station' camps. I fear this question is fracturing the Rebellion.
}}

The comic depicts a dialog from the film Star Wars episode IV, where the heroes follow a spacecraft to the never-before-seen Death Star, a huge battleship in the size of an arguably small moon, capable of destroying an entire planet. This dialog ignites an argument similar to the one discussing whether or not Pluto should be classified as a planet or as a dwarf planet.

In this galaxy, however, the argument would be invalid. The Death Star is much larger (70km radius) than dozens of {{w|List of natural satellites|full-fledged moons}} in our solar system.

The title text makes reference to a later scene in the film when Rebel pilots are being briefed on the planned attack on the the Death Star. Those who analysed the plans for the Death Star run into the same discussion picture, and end up arguing about the classification of the the Death Star, dividing those involved into the 'artificial moonlet' camp and the 'rogue planet-station' camp, thus deunifying the rebellion. If events are otherwise the same from the movie, this is also happening at threat of their destruction, and thus a crippling of the Rebellion.

==Transcript==
:[Millennium Falcon follows a Tie Fighter towards an unidentified orb in the distance]
:Luke Skywalker: He's heading for that small moon.
:Ben Kenobi: That's no moon - it's a space station.
:Luke Skywalker: It's too big to be a space station.
:Ben Kenobi: But it's too '''''small''''' to be a moon.
:Three hours pass
:Luke Skywalker: Fine! What if we agree it's not a moon, but we make a new category called "Dwarf Moon"?
:Ben Kenobi: And what's the cutoff, asshole?! Is this '''''ship''''' a dwarf moon now?
:Luke Skywalker: Screw you.
{{comic discussion}}
[[Category:Space]]
[[Category:Star Wars]]

1456: On the Moon

2014-12-05T11:11:59Z

108.162.216.188: Polished up a bit.

{{comic
| number = 1456
| date = December 5, 2014
| title = On the Moon
| image = on_the_moon.png
| titletext = "I believe that this nation should commit itself to achieving the goal, before this decade is out, of landing a man on Venus and returning him safely to--" [an aide frantically whispers in the president's ear for a moment] "... of landing a man on Venus."
}}

==Explanation==
{{incomplete|WIP}}
The phrase "If we can land a man on the moon, why can't we <blank>" is commonly used to question a perceived shortcoming of some company, government or humanity in general. The premise is that "we" (where we is usually a generalized blanket identification of humanity, or the United States) have been able to achieve the extraordinary feat of landing men on the moon and bringing them back to earth safely; thus our inability to achieve some lesser goal is questionable.

The {{w|Moon Landing|moon landings}} are rightly seen as one of the pinnacles of humanity's achievements, and as such have become a measure against which all other great feats are measured against. That technology available in 1969 was so minimal in comparison to modern technology serves only to increase the status of the moon landings.

Here, Megan is cutting Cueball's argument's short by reminding him that humanity has not put another man on the Moon since the end of the Apollo program in December 1972, and that new manned programs to return to the Moon, such as the US Constellation Program, have been repeatedly cancelled.

The title text is a retelling of the famous inspirational Kennedy address to the US Congress in May 1961 which set up into motion the Apollo program, except that this time, the speaker is talking about putting a man on planet Venus. The aide explains to the president that because the atmosphere of Venus is extremely hostile (high pressure, high temperature, strong winds, sulfuric acid rains and lakes), it is unlikely that anybody could land on Venus longer than a few seconds and come back alive. Unmanned hardened pre-cooled robotic probes either got crushed or fried before landing, or survived only a couple of hours at most.

==Transcript==
{{incomplete transcript}}
:Cueball: If we could land a man on the moon, why can't we -
:Megan: -land a man on the moon?
:Cueball: ...ok, fair. But we're working on it, OK?

{{comic discussion}}

[[Category: Comics featuring Cueball]]
[[Category: Comics featuring Megan]]