<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=108.162.238.221</id>
		<title>explain xkcd - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=108.162.238.221"/>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php/Special:Contributions/108.162.238.221"/>
		<updated>2026-04-17T09:27:53Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.30.0</generator>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=191348</id>
		<title>2299: Coronavirus Genome 2</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=191348"/>
				<updated>2020-04-28T22:17:55Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: show it can fit in a single tweet&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2299&lt;br /&gt;
| date      = April 27, 2020&lt;br /&gt;
| title     = Coronavirus Genome 2&lt;br /&gt;
| image     = coronavirus_genome_2.png&lt;br /&gt;
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].&lt;br /&gt;
&lt;br /&gt;
[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].)  If his post catches on and is widely shared, it might be described as &amp;quot;going viral&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He he realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but it able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).  It could also be [https://twitter.com/TruePrimal/status/1255258879623139328 tweeted as an image].&lt;br /&gt;
&lt;br /&gt;
This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically.  Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).&lt;br /&gt;
&lt;br /&gt;
The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to &amp;quot;like&amp;quot; your friend's posts, even if you think they're strange. Alternately, the &amp;quot;like&amp;quot; button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting).  When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might &amp;quot;like&amp;quot; the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself.  (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger).  In this case, Megan &amp;quot;like&amp;quot;ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]&lt;br /&gt;
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?&lt;br /&gt;
:Megan: Sure.&lt;br /&gt;
:Megan: ...Why?&lt;br /&gt;
&lt;br /&gt;
:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]&lt;br /&gt;
:Cueball (off-panel): Nothing.&lt;br /&gt;
:Megan: I ... see.&lt;br /&gt;
:Megan: Well, here you go.&lt;br /&gt;
:Laptop: Click&lt;br /&gt;
&lt;br /&gt;
:[In &amp;quot;two&amp;quot; frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square &amp;quot;speech bubble&amp;quot; with a &amp;quot;speech line&amp;quot; going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]&lt;br /&gt;
:Phone: &lt;br /&gt;
::GAAAGGTAAGATGGAGAGGCCTTGTC&lt;br /&gt;
:&amp;lt;div style=&amp;quot;background-color:red; padding:5px; width:fit-content; margin-left: 2em&amp;quot;&amp;gt;CCTGGTTCAACGAGAA&amp;lt;/div&amp;gt;&lt;br /&gt;
::&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;-29,602&amp;lt;/font&amp;gt; &amp;lt;font color=&amp;quot;cyan&amp;quot;&amp;gt;(+)&amp;lt;/font&amp;gt;&lt;br /&gt;
:&amp;lt;div style=&amp;quot;background-color:cyan; padding:5px; width:fit-content; margin-left: 2em&amp;quot;&amp;gt;&amp;lt;font color=&amp;quot;white&amp;quot;&amp;gt;Tweet&amp;lt;/font&amp;gt;&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]&lt;br /&gt;
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.&lt;br /&gt;
:Megan:  Unsettling that your first instinct is &amp;quot;share it online.&amp;quot;&lt;br /&gt;
:Cueball: It's cool, I sanitized my phone before posting.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Coronavirus Genome]]&lt;br /&gt;
[[Category:Comics sharing name|Coronavirus Genome]]&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Biology]]&lt;br /&gt;
[[Category:Social networking]]&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2288:_Collector%27s_Edition&amp;diff=189972</id>
		<title>Talk:2288: Collector's Edition</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2288:_Collector%27s_Edition&amp;diff=189972"/>
				<updated>2020-04-04T04:33:24Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: New hint&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
== The joke == &lt;br /&gt;
Very early on April 1st, Mojang\Microsoft released a version 20w14Infinite build of Minecraft which allows players to create millions of wildly different new worlds by writing text in a book &amp;amp; throwing it through a Nether portal. The world generated depends on what is written in the book, &amp;amp; some specific worlds contain many &amp;quot;starter chests&amp;quot; to help the player in their explorations. Players can share what they wrote in each book with others, allowing multiple players to each access the same new dimensions on their own. In this way, individual single-player Minecraft instances can essentially become a collaboratively evolving game featuring previously nonexistent block types. Given that Randall has done multiple comics referencing Minecraft &amp;amp; seems to be an avid player, &amp;amp; given the presence of &amp;quot;chests&amp;quot; &amp;amp; the &amp;quot;worldbuilding&amp;quot; &amp;amp; collaborative nature of this latest comic, I believe xkcd's April 3rd 2020 comic is a reference to this &amp;quot;final&amp;quot; Minecraft build. &lt;br /&gt;
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 14:10, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
Clicking on the URLs in the explanation return &amp;quot;File not found&amp;quot;. I will remove the hyperlink so people are less confused. [[User:Fwacer|Fwacer]] ([[User talk:Fwacer|talk]]) 02:18, 4 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
== How the comic works == &lt;br /&gt;
... is this going to be like [[1190: Time]]? [[Special:Contributions/162.158.74.63|162.158.74.63]] 04:08, 3 April 2020 (UTC)&lt;br /&gt;
: I hope so, otherwise I don't get the joke [[User:Forresthopkinsa|Forresthopkinsa]] ([[User talk:Forresthopkinsa|talk]]) 04:15, 3 April 2020 (UTC)&lt;br /&gt;
: The page just went down for me so maybe what we've seen isn't what it's supposed to be? [[User:Avi m|avis_magpie]] ([[User talk:Avi m|talk]]) 04:20, 3 April 2020 (UTC)&lt;br /&gt;
Looks like the whole comic was just taken down. [[User:Parzivail|Parzivail]] ([[User talk:Parzivail|talk]]) 04:27, 3 April 2020 (UTC)&lt;br /&gt;
: Can confirm - the most recent comic is Pathogen again [[Special:Contributions/162.158.187.207|162.158.187.207]] 04:26, 3 April 2020 (UTC)&lt;br /&gt;
It is still up on the mobile website, but only if you directly go to comic page https://m.xkcd.com/2288 [[Special:Contributions/172.69.22.146|172.69.22.146]] 05:10, 3 April 2020 (UTC)&lt;br /&gt;
: Perhaps this is a collector's edition because it was only up for a limited amount of time? {{unsigned ip|108.162.219.60|05:12, 3 April 2020}}&lt;br /&gt;
:: That was my immediate assumption. The title text says, &amp;quot;I'm sure you can find some suitable worldbuilding material if you scavenge through the archives.&amp;quot; And I was viewing the comic by using the Internet Archive's Wayback Machine — which, wouldn't you know it, captured the page exactly once before it went down. Between that and the title &amp;quot;Collector's Edition&amp;quot;, I can't help thinking that the comic was actually intended to be viewed this way. Though for what reason, and what intended meaning, I couldn't tell you. …And jeez, in the time it took me to type this, the comic is back, but changed! Oy vey. [[User:NoriMori|NoriMori]] ([[User talk:NoriMori|talk]]) 06:42, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Maybe it's called collectors edition, because it was only available quite limited and to an unusual time? But that logic doesn't fit with the title text. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 05:14, 3 April 2020 (UTC)&lt;br /&gt;
:I doubt that could be caused by &amp;quot;technical difficulties&amp;quot;. [[Special:Contributions/172.69.34.186|172.69.34.186]] 06:14, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
It looks like it went back up about 5 minutes age. I can't figure out if it's possible to do more than pan right now though. [[Special:Contributions/108.162.215.120|108.162.215.120]] 06:39, 3 April 2020 (UTC)&lt;br /&gt;
:Yeah I see the same thing, looks like they're just testing it live. What a shame :(--[[Special:Contributions/108.162.215.242|108.162.215.242]] 06:47, 3 April 2020 (UTC)&lt;br /&gt;
::what makes you assume that this is testing right now? however it doesn't seem to be very interactive apart from panning through it, and that it seems to chagne over time (the moon from [[1300]] wasn't there a few minutes ago, was it? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 06:49, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
:It's a giant pan similar to [https://xkcd.com/1110], although it's mostly empty, with some content at [https://xkcd.com/2288/#-361,-161]&lt;br /&gt;
. The title reads that you can find world building material, if you scavenge through the archives. I assume, more content will be unlocked as you read through past comics. [[User:Goatfryed|Goatfryed]] ([[User talk:Goatfryed|talk]]) 06:52, 3 April 2020 (UTC)&lt;br /&gt;
::That would mean it is individual? That everyone gets their own picture? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:03, 3 April 2020 (UTC) Edit: I can kinda rule that out. I get the same picture on my phone and my work laptop, the work laptop is in a different country via vpn, and doesn't share any logins/advertisement ID's apart from explain xkcd with my phone... --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:05, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Yeah, it definitely changes. The orange swimming pool just showed up now. Also, at the bottom of the page, it says something about &amp;quot;backpack&amp;quot;, and what appears to be a reference to some other xkcd comic. For example, &amp;quot;Hint: why waste time say few word when lot word do trick&amp;quot;, which I think refers to Up Goer Five. But I have no idea what to do with that info. [[Special:Contributions/172.68.141.190|172.68.141.190]] 06:55, 3 April 2020 (UTC)&lt;br /&gt;
:and the content seems to be related to previous comics and what-ifs... but still no clue what to do apart from exploring the page. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 06:57, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
So I just stumbled upon this and it seems to be exactly as other commentors have theorised: as you read previous comics more stuff gets added to the page. There seems to be some kind of backpack mechanic where you collect items from previous ones somehow, but, perhaps because I've already read all previous comics, that didn't seem to work for me. Instead I just had to click the link above the backpack, which opened the comic in a new tab, and it had a bunch of stuff there. We may need to co-ordinate to figure out if different people end up with different sets of items, and to ensure we have all of them, but I think other than that it should be just a cut and dry thing of making a table with every item in it. [[Special:Contributions/162.158.34.202|162.158.34.202]] 07:12, 3 April 2020 (UTC)&lt;br /&gt;
:Hang on, mine just changed: before there was only 1 pool on the left, now there are two. I only went back to pathogens and then forwards agin. This may be harder than I thought, I'm going to start keeping a screenshot log of actions vs. results. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:17, 3 April 2020 (UTC)&lt;br /&gt;
:You may need to try xkcd.com instead of www.xkcd.com - there seems to be an issue with the latter at the moment. [[Special:Contributions/162.158.255.216|162.158.255.216]] 07:18, 3 April 2020 (UTC)&lt;br /&gt;
::Hold up it changed again! This time without a reload! [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:28, 3 April 2020 (UTC)&lt;br /&gt;
:::It seems to change periodically, the url does change everytime. New stuff always seems to be added, not old stuff rremoved. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:28, 3 April 2020 (UTC)&lt;br /&gt;
::::The URL is related to the coordinates, it changes when you pan the image. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:34, 3 April 2020 (UTC)&lt;br /&gt;
::::Timings seem to be random, working on double checking that rn. Highest first number so far is 1127, once it switches agin I'm going to experiement with manually editing the url.&lt;br /&gt;
&lt;br /&gt;
I was briefly able to do things. Open the archieve, navigate it to one of the comics, that are hinted for (e.g. compiling or iata) and when viewing that comic I get a lootbox, with an image I can then place in the 2288. It worked twice, and now it doesn't again... neither with those that have worked before, nor with others I am fairly sure have been placed by other people. (such as galilean moons) --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:21, 3 April 2020 (UTC)&lt;br /&gt;
:I'm working on assembling an image log, wonder if we could compare? Also, the two number url could be useful, rn I'm on -1378, -152 [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:25, 3 April 2020 (UTC)&lt;br /&gt;
::What do you mean by compare? Also the URL is related to the coordinates, it changes when you pan the image. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:34, 3 April 2020 (UTC)&lt;br /&gt;
:::Yh just got that, is that the same for other panning comics (I'm a little new)? And I was wondering if the comic changed per person/system like certain previous comics. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:40, 3 April 2020 (UTC)&lt;br /&gt;
::::Just seen a previous comment from you saying it doesn't change cross-system. However, it definetely changes with time, so the question is whether that's per user or done on a sort of universal clock, so we all unlock the same new content at the same time.&lt;br /&gt;
:::::I didn't complete writing up the thing I was able to do above... after opening the lootbox I got one image related to the comic I opened in my backpack and was able to place that in the actual 2288, where it now is placed. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:50, 3 April 2020 (UTC)&lt;br /&gt;
::::::For me that didn't happen, it started with a loading screen type thing, and then objects just started appearing seemingly at random. I've also noticed some of them dissapear. I feel like the best course of action would be to start with a table of all the different objects, and then see if we can figure out when/why they appear later.&lt;br /&gt;
::::::: At least 2 objects appeared, because I placed them. It is a colaboration of many xkcd readers to do this world building here. I placed one of the sword fights around #439,-181 and the non-inverted kite at #-1679,-290 . --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:55, 3 April 2020 (UTC)&lt;br /&gt;
::::::::Do you agree that the best course of action would therefore be a table with all the items? [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 08:03, 3 April 2020 (UTC)&lt;br /&gt;
:::::::::Not a big fan of tables, unless there really is content of muliple categories to be entered for one line. A list would do fine I guess? Also I find lists easier to work with. Or what would be the columns you'd set up? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 08:08, 3 April 2020 (UTC)&lt;br /&gt;
::::::::::Something along the lines of the comic that it's a reference to, an image, and an explanation. Do we know if you find the same sticker at the same comic every time? If so, then that. A list would work well too. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 08:12, 3 April 2020 (UTC)&lt;br /&gt;
::::::::::From looking at what image URLs don't 404, it looks like there are 253 stickers, which is quite a lot for a table.[[User:Matthias1|Matthias1]] ([[User talk:Matthias1|talk]]) 10:03, 3 April 2020 (UTC)&lt;br /&gt;
:::::I think we can unlock new elements by reading older comics (seemingly at random, it doesn't work with every comic read) and that everyone can see the changes once they are put on the global picture. If someone could check, I have put berret guy and his goat around (5000,0)&lt;br /&gt;
::::::Yep, he's there. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 08:01, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
I almost feel like someone needs to show them this xkcd... https://xkcd.com/169/&lt;br /&gt;
&lt;br /&gt;
It seems to be an interactive canvas. You can find stickers in chests on specific comics and put them in your backpack, and then when you come back here you can choose where to put them on the canvas. The hints in the empty backpack are cryptic references to comics. {{unsigned ip|162.158.107.85}}&lt;br /&gt;
:Yep, I figured the same thing, but for me it only worked twice (fly from wtf to lol was a reference to the iata thing and compiling was a reference to the compiling one) - but it didn't work again. Also: Some of the placed images are clearly references to what-if. Like the squirrel on top of an AK47 or the yoda powering an IPOD. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:59, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
I've made a catalog of the stickers but it's only partial because stuff keeps appearing: https://photos.app.goo.gl/dPYeYVpGqu5tqGTt5 [[User:Lev|Lev]] ([[User talk:Lev|talk]]) 08:02, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
I got it. I wrote the steps on reddit and included some screenshots. Feel free to use it to edit this page https://old.reddit.com/r/xkcd/comments/fu1dt0/xkcd_2288_collectors_edition/fmaqp1w/ [[User:Ufolicker|Ufolicker]] ([[User talk:Ufolicker|talk]]) 09:27, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Am I too late to participate in this or am I doing something wrong? Where is this hint supposed to appear? I only see an empty backpack and the canvas on which references to different comics are placed. No comic I've visited, either inspired by references on the canvas, nor by random selection has any chest or other interactive components to it. [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 09:53, 3 April 2020 (UTC)&lt;br /&gt;
:No, you're doing it right. Hints show up in the backpack area. Obviously no one is sure of anything, but even users who have seen hints have reported not seeing hints on a different browser/device. I suspect something similar to [https://xkcd.com/1037/ Umwelt], where different hints are shown to different people. And I think once a chest is picked up, it stops appearing to everyone that could see it, but that's a guess.[[User:Matthias1|Matthias1]] ([[User talk:Matthias1|talk]]) 10:03, 3 April 2020 (UTC)&lt;br /&gt;
::Ok, I was unsure because on my windows 10 laptop I have yet to see a hint. I've tried chrome, firefox and internet explorer. [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 11:09, 3 April 2020 (UTC)&lt;br /&gt;
:::Finally got it to work in Safari in iOS [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 11:13, 3 April 2020 (UTC)&lt;br /&gt;
::::I took part in the scavenger hunt and about 2 hours ago it stopped showing hints. So I assume it shut down and there is nothing to do anymore.¯\_(ツ)_/¯ [[User:Curse|Curse]] ([[User talk:Curse|talk]]) 15:15, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
When I view the comic, I don't see the closed box - the screen is absolutely full of stickers.  I've not done any scavenger hunting (I'd upload an image, but I don't have permissions to do so) [[User:Kvetch|Kvetch]] ([[User talk:Kvetch|talk]]) 11:10, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Hints I've seen so far: &amp;quot;The first one was funnier&amp;quot; (chest appeared in comic 1, contained I'm a turtle);&lt;br /&gt;
&amp;quot;418 I'm a teapot&amp;quot;&lt;br /&gt;
&amp;quot;26th September, 1983&amp;quot; (comic 2052, Stanislav Petrov Day, white dove); [[Special:Contributions/172.69.134.135|172.69.134.135]] 11:20, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Perhaps a table for found chests with no attached hints? I've stumbled across a few but don't know if they're hinted at or not :). [[User:Deranged|Deranged]] ([[User talk:Deranged|talk]]) 11:54, 3 April 2020 (UTC)&lt;br /&gt;
:Maybe add a line to the table with a blank first box, the link in the second box, empty third box?  Someone will match it up. [[Special:Contributions/162.158.166.37|162.158.166.37]] 12:21, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Churchill's gonna have to rehydrate&amp;quot; is Nothing to Offer. Can't remember what number, I think 1148?&lt;br /&gt;
&lt;br /&gt;
In other news, the bad ads are back ([[Talk:2220: Imagine Going Back in Time/Ads|previous discussion]]) - who's in charge of dealing with them anyway? [[User:Arcorann|Arcorann]] ([[User talk:Arcorann|talk]]) 12:25, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Could someone post an image showing what it looks like to find a chest on a comic? I've browsed to some of the comics referenced as having chests but couldn't see one so far. Thanks![[Special:Contributions/141.101.69.13|141.101.69.13]] 12:54, 3 April 2020 (UTC)&lt;br /&gt;
:I've uploaded a few images on https://imgur.com/gallery/4q1QIW5. Can't upload them here yet, new account [[User:Madsmtm|madsmtm]] ([[User talk:Madsmtm|talk]]) 13:24, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
&amp;quot;The other side of the wardrobe&amp;quot;, someone's put in the solution [[2218: Wardrobe]]; but I also found the chest on [[665: Prudence]]. Can there be multiple solutions to the same hint? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 13:00, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is anyone else having issues with things just not working? I clicked around a bit, it gave me the award in being very smart, and now won't give me any hints or chests. [[User:Crazymachinefan|Crazymachinefan]] ([[User talk:Crazymachinefan|talk]]) 13:57, 3 April 2020 (UTC)&lt;br /&gt;
::I am also not getting any hints anymore after getting one chest.[[User:Eesley|Eesley]] ([[User talk:Eesley|talk]]) 14:01, 3 April 2020 (UTC)&lt;br /&gt;
:::Nope, nothing to get anymore. [[User:Curse|Curse]] ([[User talk:Curse|talk]]) 15:15, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
The &amp;quot;Was it a rat I saw&amp;quot; hint is probably [[1632: Palindrome]]. I haven't gotten the hint yet, so I can't confirm. [[User:Nvaiko24|Nvaiko24]] ([[User talk:Nvaiko24|talk]]) 14:12, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Interestingly, the [[1110: Click and Drag]] disables the backpack overlay. Also, anyone have any news on how to get the Go Big to Go Small hint? &lt;br /&gt;
&lt;br /&gt;
I got the &amp;quot;First annual award for excellence in being very smart&amp;quot; on page 7, rather than 179 as stated above. Can't remember what the hint was. [[Special:Contributions/162.158.34.222|162.158.34.222]] 14:26, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Found that award on comic 7, too. And &amp;quot;Researchers are reporting record number of sharks (loot 159) on comic 1368, but I'll be damned if I know the hint. Those give me nothing [[Special:Contributions/162.158.91.43|162.158.91.43]] 14:44, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Found another one! It's a bug on a box, loot_007. From comic #442, no idea what hint goes with it. [[Special:Contributions/162.158.74.7|162.158.74.7]] 15:18, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
For the ooOOOooo hint, I've now gone through every comic, and none of them give a chest. [[User:Lawruble13|Lawruble13]] ([[User talk:Lawruble13|talk]]) 19:41, 3 April 2020 (UTC)&lt;br /&gt;
: Well that's just ducky! I'm stuck on that hint. Any way to get the hint to change without losing my collectibles? Anonymous 02:19, 4 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
If you scroll almost directly upward, the Y-coordinate keeps resetting to 5000 (same with downward and -5000.  However, if you scroll up and to the side with a slope of less than 1, you eventually get to this URL:  https://xkcd.com/#-Infinity,-Infinity which just has the word &amp;quot;[LOADING_]&amp;quot; hand-drawn. -- brad&lt;br /&gt;
: I think that's just Javascript floatingpoint math for ya. The loading image just appears while it is trying to load in new tiles --[[User:Jhollowe|Jhollowe]] ([[User talk:Jhollowe|talk]]) 19:11, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
I wrote a script that gives a list of all the loot images that are on the page if we want to make a complete list of loot images, and a list of images that haven't been found yet. --[[User:Jhollowe|Jhollowe]] ([[User talk:Jhollowe|talk]]) 19:11, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Has anyone else gotten a &amp;quot;miniloot&amp;quot;? I just got &amp;quot;/2288/collectors/static/loot/miniloot-words-laser.png&amp;quot; from [[293: RTFM]] with the hint listed in the above table. [[User:Lawruble13|Lawruble13]] ([[User talk:Lawruble13|talk]]) 19:41, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
In a private window on Firefox, I had previously seen the hint, but it's now disappeared. I got loot_109.png (which is the sheeple eye from [[1013: Wake Up Sheeple]]), and I can place it, but it stays in the inventory. Possible bug? [[User:Lawruble13|Lawruble13]] ([[User talk:Lawruble13|talk]]) 19:43, 3 April 2020 (UTC)&lt;br /&gt;
:Viewable at https://xkcd.com/2288/#453,1003, both eyes posted using the same item. [[User:Lawruble13|Lawruble13]] ([[User talk:Lawruble13|talk]]) 19:50, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
The &amp;quot;tea time&amp;quot; hint seems a bit weird; I found it at [[579: The Race: Part 3]], and others have apparently found it at 581, 578, 479 and maybe elsewhere. Not sure what connection any of those comics have to tea, except that 579 and 479 both have 79 in them and the image is from what-if 79. [[User:Pelosujamo|Pelosujamo]] ([[User talk:Pelosujamo|talk]]) 01:17, 4 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
I don't know if there's an element of &amp;quot;the clue you get depends on the clues you answered&amp;quot;..? Yesterday, when I first visited, it seemed to be giving different hints as I scrolled through/jumped around the comics looking for the answers to earlier hints. Now (after finding three, confirmed as listed in the table) it's just flipping between two of the early once, the &amp;quot;chnace&amp;quot; and &amp;quot;fetish&amp;quot; ones, still undetailed in the table so I can't even cheat) leading me to believe I'm left with those two in my (personal?) 'pool' of hints, and I won't get any more until I answer one or other. Either that or I need to ''place'' my current meagre three discoveries, but I was actually wanting more first so I could be creative in combination... [[Special:Contributions/162.158.93.141|162.158.93.141]] 04:04, 4 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Are &amp;quot;oOOOoooo&amp;quot; and &amp;quot;oooooooo&amp;quot; different clues? I don't see the second one listed.&lt;br /&gt;
&lt;br /&gt;
== Browser agent related issues: Post what browser (Chrome, Firefox; mobile, desktop) you are using here &amp;amp; what issues (if any) you experience when interacting with this comic. ==&lt;br /&gt;
&lt;br /&gt;
On Chrome version 80.0.3987.162 in mobile view, only &amp;quot;Collector's Edition&amp;quot; appears for me. The comic is not scrollable or interactive, &amp;amp; the backpack does not appear. In desktop view, the collectively added content appears, as does the backpack. (I have not tested whether I can add things, yet.) &lt;br /&gt;
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 13:52, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
On Chrome version 80.0.3987.163 on desktop, the hint doesn't seem to appear. [[User:Lawruble13|Lawruble13]] ([[User talk:Lawruble13|talk]]) 19:41, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Firefox 74.0 on desktop - looks like I don't get any hints. Everything else seems to be fine. [[Special:Contributions/162.158.92.98|162.158.92.98]] 19:59, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Apologies if this has been covered, but if you right-click--&amp;gt;inspect the backpack area, can you see the hint in the Java script?  I can't find it with Chrome running in Windows 10, but it is entirely possible I don't know how/where to look.[[User:Godzilla|Godzilla]] ([[User talk:Godzilla|talk]]) 21:38, 3 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
On Opera, hint doesn't appear.&lt;br /&gt;
&lt;br /&gt;
In Firefox I have an item in my loot box, I can scroll around the world and the text is &amp;quot;find an empty area&amp;quot;.  I find an empty area (Damn long way out :P ) and the text changes to &amp;quot;place it&amp;quot; or &amp;quot;Cancel&amp;quot;  I can cancel OK, but place it doesn't work at all.  Is this a bug or have I hit the limit of my abilities? [[Special:Contributions/172.68.86.34|172.68.86.34]] 01:05, 4 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
:oh...wait...there is a 5 second or more delay from clicking to it appearing.  May be caused by the size of the world and number of elements. [[Special:Contributions/172.68.86.34|172.68.86.34]] 01:08, 4 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Firefox 52.9  Windows XP  Doesn't get past &amp;quot;loading&amp;quot; and cannot drag around.  However, the backpack does appear and can be closed and opened. [[Special:Contributions/172.68.174.76|172.68.174.76]] 04:20, 4 April 2020 (UTC)&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=explain_xkcd:Community_portal/Proposals&amp;diff=182136</id>
		<title>explain xkcd:Community portal/Proposals</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=explain_xkcd:Community_portal/Proposals&amp;diff=182136"/>
				<updated>2019-11-01T19:10:51Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: /* Dark theme/night mode */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;noinclude&amp;gt;{{Community portal}}&amp;lt;/noinclude&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Add unexplained strips ==&lt;br /&gt;
&lt;br /&gt;
At the moment, browsing through the explanations using the previous and next buttons is interrupted whenever there's an explanation missing.&lt;br /&gt;
&lt;br /&gt;
I think adding a page with the strip fr all of those with a short message like &amp;quot;no one has explained this yet, want to give it a shot?&amp;quot; would make the wiki easier to browse through and will get more strips explained faster.&lt;br /&gt;
&lt;br /&gt;
:I don't think that would happen. If suddenly it was much easier for people to skip over pages that had no explanation, I think they would do exactly that, skip right over it. On the same side of that coin, If suddenly there are no longer any red links on the [[List of all comics]] then everyone perusing that page assumes that all the comics have been explained and don't need to contribute any more. It's astonishing how quickly an [[589: Designated Drivers|embedded]] red link gets an explanation page created simply to get rid of the red link.&lt;br /&gt;
&lt;br /&gt;
:Secondarily, ''many'' of the pages created recently aren't being created with their numerical and titular redirects. Without the numerical redirect, the comic template can't find that there is a previous/next comic to link to. Every once in a while somebody will go through and try to notice all the pages that don't have their redirects created but it's an unscientific process that only happens occasionally. If we could get every joe blow that comes in and vomits up a poorly done explanation to create the redirects I wouldn't be quite as annoyed at their lack of show-don't-tell-manship. But, since they can't be bothered to put the date in the comic template, I doubt we'll ever get people to create the redirects.&lt;br /&gt;
&lt;br /&gt;
:'''TL;DR:''' No more red links, no more work gets done on the back catalog.&lt;br /&gt;
&lt;br /&gt;
:--[[User:Lcarsos|lcarsos]]&amp;lt;span title=&amp;quot;I'm an admin. I can help.&amp;quot;&amp;gt;_a&amp;lt;/span&amp;gt; ([[User talk:Lcarsos|talk]])  14:28, 21 December 2012 (UTC)&lt;br /&gt;
&lt;br /&gt;
== xplainkcd.com ==&lt;br /&gt;
&lt;br /&gt;
When I first saw this site I thought it should definitely be at xplainkcd.com or at least redirect from that url {{unsigned|115.166.22.158|12:45, 3 January 2013 (UTC)}}&lt;br /&gt;
&lt;br /&gt;
: I like that idea! --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 13:28, 3 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Yeah! If it's possible, it would be cool! At least as a redirect. -- [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 15:46, 3 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Not technically the same thing, but I just took [http://expxkcd.com http://expxkcd.com]. More explanation &amp;lt;del&amp;gt;is&amp;lt;/del&amp;gt; was given on the website itself. {{User:Grep/signature|05:10, 29 March 2014}}&lt;br /&gt;
::We do that with explainxkcd.com as well, but yay shorter URLs! Mind if I use that for our social media links? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 06:45, 29 March 2014 (UTC)&lt;br /&gt;
:::I had no idea that you did that, but sure, go ahead! If you want, I can change any DNS records if you wish to have it go directly to you guys. {{User:Grep/signature|07:16, 29 March 2014}}&lt;br /&gt;
:::In case you were wondering, I just did the following: &amp;lt;code&amp;gt;^/([0-9]+)(/large)?/?$&amp;lt;/code&amp;gt; {{User:Grep/signature|07:25, 29 March 2014}}&lt;br /&gt;
::::Hrm. We're just matching with &amp;lt;code&amp;gt;^(\d+)/?$&amp;lt;/code&amp;gt;. You can keep ownership of the URL if you want, unless you have traffic concerns or whatever and you want us to handle it, which we're very capable of doing. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 08:47, 29 March 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
I have made http://www.xkcd.ga and http://www.xkcd.tk both forward to http://www.explainxkcd.com/wiki/index.php/Main_Page. Is this ok? [[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 08:49, 26 December 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Section style and usage ==&lt;br /&gt;
&lt;br /&gt;
I am new here and I'm trying to get up to speed with the culture. I have a few questions about how and where to use sections (== this ==). I am more willing to go with (and enforce) whatever norms there are here, but I have not seen them actually discussed. &lt;br /&gt;
&lt;br /&gt;
# '''Is it OK to create sections in Discussion pages?''' I have been told no, but there are many examples extant of this usage in this Wiki and indeed in Wikipedia.&lt;br /&gt;
# '''Section title case''' [http://en.wikipedia.org/wiki/Wikipedia:Manual_of_Style/Capital_letters#Acronyms Wikipedia's style guide] recommends sentence case, not title case. There are many title cased section headers here. &lt;br /&gt;
# '''Links''' I do not have a reference for this but it seems to me putting links in section code (== [[&amp;lt;span style=&amp;quot;color:blue&amp;quot;&amp;gt;&amp;lt;nowiki&amp;gt;this&amp;lt;/nowiki&amp;gt;&amp;lt;/span&amp;gt;]] == ) is bad form. &lt;br /&gt;
&lt;br /&gt;
Last note -- it's understood if these bylaws have not yet been written. I can see that a few of you have made a huge personal investment to make this Wiki what it is today, and that is a credit to you all -- this is awesome! As a long-time aficionado of xkcd I applaud your work and look forward to further collaboration.&lt;br /&gt;
--[[User:Smartin|Smartin]] ([[User talk:Smartin|talk]]) 04:15, 4 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:As a general rule, we stick to the standard format that existing pages follow, with an optional trivia section below the transcript. Some zealous editors like to add other sections though, which tend to be for the most part unneeded or redundant. If something you want to add doesn't help to explain the comic in some way, but the inclusion of which would somehow still add to the page, *and* it doesn't fall under the trivia category, a new section is warranted. This isn't the case most of the time though, so editors usually fold the content of extraneous sections into &amp;quot;Explanation&amp;quot; or &amp;quot;Trivia.&amp;quot; We have no policy on links in titles, and they're allowed so long as they are appropriate; the link is useful and can't be folded into the section itself. And we use title case for titles cuz it just makes sense. '''[[User:Davidy22|&amp;lt;span title=&amp;quot;I want you.&amp;quot;&amp;gt;&amp;lt;u&amp;gt;&amp;lt;font color=&amp;quot;purple&amp;quot; size=&amp;quot;2px&amp;quot;&amp;gt;David&amp;lt;/font&amp;gt;&amp;lt;font color=&amp;quot;green&amp;quot; size=&amp;quot;3px&amp;quot;&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;sup&amp;gt;&amp;lt;font color=&amp;quot;indigo&amp;quot; size=&amp;quot;1px&amp;quot;&amp;gt;22&amp;lt;/font&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 05:08, 4 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:We generally do not (or at least, discourage) use sections on the talk/discussion pages for explanation pages. This is purely for looks. The comic discussion section of the explanation page looks/feels wrong if there are level 2 section breaks in the transclusion. Also, if the [http://www.mediawiki.org/wiki/Manual:Table_of_contents Table of Contents] starts showing up on a page, such as on [[Click and Drag]] the sections created on the talk page also show up in the TOC. This gets confusing, and this is why we prefer not to use them on explanation talk pages. Everywhere else we follow standard wiki format and do use sections on the discussion pages.&lt;br /&gt;
&lt;br /&gt;
:Personally, I think that links in section titles looks wrong, but I choose not to be the dictator of style in this matter. :p&lt;br /&gt;
&lt;br /&gt;
:Please feel free to make edits. The worst that happens is someone reverts your edit. If it's a big enough issue and/or you don't seem to be learning from what people are fixing about your edits someone will leave a comment on your talk page. That's it. We might leave a nasty-gram in the edit summary, but oh well. We only ban for malicious intent. Honestly working to better the wiki is good, even if sometimes we grumble about it.&lt;br /&gt;
&lt;br /&gt;
:--[[User:Lcarsos|lcarsos]]&amp;lt;span title=&amp;quot;I'm an admin. I can help.&amp;quot;&amp;gt;_a&amp;lt;/span&amp;gt; ([[User talk:Lcarsos|talk]])  07:00, 4 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
::Oh, I just looked at your talk page. I completely forgot that that happened. Don't worry about it. Learning the ropes is part of the experience. Do make edits, and if they're wrong, we'll nudge you in the right direction. [[User:Lcarsos|lcarsos]]&amp;lt;span title=&amp;quot;I'm an admin. I can help.&amp;quot;&amp;gt;_a&amp;lt;/span&amp;gt; ([[User talk:Lcarsos|talk]])  07:18, 4 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
I have been moving some trivia sections to directly below the explanation, in order to make it more consistent, and easier to survey and maintain. Often the dividing line between trivia and explanation is not entirely clear, and in articles without a trivia section the end of the explanation very often contains trivia-like information. (e.g. [[1155: Kolmogorov Directions]]) -- [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 10:13, 4 January 2013 (UTC)&lt;br /&gt;
===Title case doesn't make any sense===&lt;br /&gt;
At first sight title case in titles just makes sense. However title case '''never''' makes sense. It's worse than all caps. Besides, only Americans and children like title case. [[Special:Contributions/190.96.48.48|190.96.48.48]] 20:04, 10 August 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==New character==&lt;br /&gt;
As per [[Talk:1178: Pickup Artists]], the character with hair has appeared in quite a few comics now, and he's starting to become a recurring character. Shall we go ahead with inaugurating him into our list of regular characters, and what name shall we assign him? Current candidate names include Hairy and Harry. Anyone? '''[[User:Davidy22|&amp;lt;u&amp;gt;&amp;lt;font color=&amp;quot;purple&amp;quot; title=&amp;quot;I want you&amp;quot;&amp;gt;David&amp;lt;/font&amp;gt;&amp;lt;font color=&amp;quot;green&amp;quot; size=&amp;quot;3px&amp;quot;&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=&amp;quot;indigo&amp;quot; size=&amp;quot;4px&amp;quot;&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 00:07, 26 February 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
: I like Harry :) --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 01:04, 26 February 2013 (UTC)&lt;br /&gt;
::Cos made a point in the discussion on [[Talk:1178: Pickup Artists]] that Hairy is directly descriptive, whereas Harry is not obvious to visitors. On the other hand, not all names are descriptive ([[Danish]]) and I think this wiki is entitled to create some xkcd-in-culture, and not just describe. And Harry is quite funny.&lt;br /&gt;
::I wonder: has [[Randall]] ever called him anything at all in the transcript? –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 21:52, 26 February 2013 (UTC)&lt;br /&gt;
:::Well, he's not named in a any official transcripts, but he's already called Harry in quite a few comic explanations. Then again, I do like having a more descriptive name for him. Shall we hold this up to a vote? '''[[User:Davidy22|&amp;lt;u&amp;gt;&amp;lt;font color=&amp;quot;purple&amp;quot; title=&amp;quot;I want you&amp;quot;&amp;gt;David&amp;lt;/font&amp;gt;&amp;lt;font color=&amp;quot;green&amp;quot; size=&amp;quot;3px&amp;quot;&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=&amp;quot;indigo&amp;quot; size=&amp;quot;4px&amp;quot;&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 23:29, 26 February 2013 (UTC)&lt;br /&gt;
::::I think we should wait a little for a few more viewpoints to crop up. Also, can someone link to some more comics he's been featured in? I've got [[1028: Communication]], [[1027: Pickup Artist]] and [[1178: Pickup Artists]]. –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 23:41, 27 February 2013 (UTC)&lt;br /&gt;
:::::I actually like what that anon said: ''Curly''.  Second choice: Hairy (being descriptive, a la Black Hat, Beret, Cueball, etc.)  While there's talk about in-culture, we've done that with the names Cueball, Beret, etc.  It's my opinion that the only names that should be &amp;quot;real&amp;quot; proper names are those that are named in the comic.  Megan, Miss Lenhart, etc.  Danish (as is discussed below) isn't truly a proper name, but you could argue it's a meta-description (one attributed by Black hat.)  So that's my vote: yes for '''Curly''' or '''Hairy''', no for Harry.  [[User:IronyChef|IronyChef]] ([[User talk:IronyChef|talk]]) 05:21, 2 March 2013 (UTC)&lt;br /&gt;
:::That's right, [[Danish]] is not descriptive, but 1/ that name was suggested because the character [[515: No One Must Know|was called that way in the comic]], which is a tiny bit like a name given by the author (at least more than Harry which we have completely made up), and 2/ in that case it's hard to find a descriptive term: use something that revolves around her black hair (her only descriptive feature), and you easily mix up with [[Megan]]; the only graphical difference is that her hair is ''long'', but what kind of name can you make out of that?&lt;br /&gt;
:::For this new character, I suggest Hairy because it comes as the easy solution with every advantage: descriptive, easy to understand, and it's not ugly... I actually see no reason to resort to a made-up name like Harry.&lt;br /&gt;
:::[[User:Cos|Cos]] ([[User talk:Cos|talk]]) 22:29, 27 February 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
: '''Alright. So the discussion's been had, and the most oft recommended name appears to be Hairy. All in favor, say aye. If more than 1/3 of editors agree and we have more than 6 votes, Hairy it is.''' '''[[User:Davidy22|&amp;lt;u&amp;gt;&amp;lt;font color=&amp;quot;purple&amp;quot; title=&amp;quot;I want you&amp;quot;&amp;gt;David&amp;lt;/font&amp;gt;&amp;lt;font color=&amp;quot;green&amp;quot; size=&amp;quot;3px&amp;quot;&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=&amp;quot;indigo&amp;quot; size=&amp;quot;4px&amp;quot;&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 05:58, 2 March 2013 (UTC)&lt;br /&gt;
:# '''Aye''' '''[[User:Davidy22|&amp;lt;u&amp;gt;&amp;lt;font color=&amp;quot;purple&amp;quot; title=&amp;quot;I want you&amp;quot;&amp;gt;David&amp;lt;/font&amp;gt;&amp;lt;font color=&amp;quot;green&amp;quot; size=&amp;quot;3px&amp;quot;&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=&amp;quot;indigo&amp;quot; size=&amp;quot;4px&amp;quot;&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 05:58, 2 March 2013 (UTC)&lt;br /&gt;
:# '''Aye''' [[User:Guru-45|Guru-45]] ([[User talk:Guru-45|talk]]) 06:14, 2 March 2013 (UTC)&lt;br /&gt;
:# '''Aye''' to Hairy. [[User:IronyChef|IronyChef]] ([[User talk:IronyChef|talk]]) 15:43, 2 March 2013 (UTC)&lt;br /&gt;
:# '''Aye'''. Harry would be a nice nod to the fact that he's actually hairy, but indeed it's better to avoid inside jokes. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 17:05, 2 March 2013 (UTC)&lt;br /&gt;
:# '''Aye'''. I'm convinced! –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 17:52, 3 March 2013 (UTC)&lt;br /&gt;
:# '''Aye'''. Hairy. [[User:Lcarsos|lcarsos]]&amp;lt;span title=&amp;quot;I'm an admin. I can help.&amp;quot;&amp;gt;_a&amp;lt;/span&amp;gt; ([[User talk:Lcarsos|talk]]) 20:52, 3 March 2013 (UTC)&lt;br /&gt;
::Hooray! We now have a [[:Category:Comics featuring Hairy]], with four pages already! Does anyone feel compelled to create &amp;quot;[[Hairy]]&amp;quot;, with a brief description and a nice profile pic like the other characters? –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 22:58, 3 March 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Ambiguous characters ==&lt;br /&gt;
&lt;br /&gt;
I've been thinking about the problem of the ambiguity of characters. &amp;quot;Is this really Cueball even though he has an eye and half a nose?&amp;quot;, &amp;quot;This is very likely ''not'' x.&amp;quot; &amp;quot;Darnit, these arn't Cueballs, these are Randall and his friends!&amp;quot;, and so on. The character ambiguity is standard for xkcd (not less so in the early ones), and comes from the very loose or &amp;quot;free&amp;quot; way Randall uses his characters to be whatever he needs at the moment.  It's simply often impossible for us to know whether he had e.g. &amp;quot;Cueball&amp;quot; or himself in mind, when drawing a particular comic (and I'd say: probably often both).&lt;br /&gt;
&lt;br /&gt;
I want to suggest that we in general have a likewise rather loose policy towards including characters in the categories for the comics. So that reasonably ambiguous cases should be included in e.g. (does she have a ponytail?) This is not because I believe this or that to really be this or that; I just don't believe in objective truth (here!). I feel that when doing research :) on a character, the borderline cases are often the most interesting ones, and you want to be able to find them through the &amp;quot;Comics featuring miss x&amp;quot;!&lt;br /&gt;
&lt;br /&gt;
I came to think this through now, when I wanted to (and did) list two comics with [[Miss Lenhart]] (?) where she was drawn but not named. Any thoughts on this in general? Other case studies? –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 21:17, 5 March 2013 (UTC)&lt;br /&gt;
:My take has always been that [[Cueball]], for example, has not been a specific character.  There is not ''a'' cueball, per se, distinct from any other cueball... indeed, there are several comics with several cueballs in-frame, and that is the point.  I see the cueball character as a wildcard character (pun intended) ready to stand in for anybody (and ''not'' necessarily just Randall; I think those readers who suggest &amp;quot;this ''is'' Randall&amp;quot; are missing the point; he's way more META than that...)  [[Megan]], while slightly less generic, still remains the female wild-card significant-other, while Curls seems to be a not-significant-other female used to illustrate a relationship that is transient.  Other characters come and go, and when it's important to visually distinguish them from others in the frame, they're given additional characteristics, to wit [[Hairy]], [[Ponytail]], etc.&lt;br /&gt;
:Unfortunately, that viewpoint is not commonly held, so I daresay I'm in the minority here.&lt;br /&gt;
:-- [[User:IronyChef|IronyChef]] ([[User talk:IronyChef|talk]]) 14:18, 6 March 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Note at the top, about the server error ==&lt;br /&gt;
&lt;br /&gt;
:''This thread was moved to [[MediaWiki talk:Sitenotice]]''&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== I've removed &amp;quot;add a comment!&amp;quot; from Discussion heading ==&lt;br /&gt;
&lt;br /&gt;
This does move it to above the line, and the rule stops early. Undo my change if that's more bothering than when the TOC is displayed as &amp;quot;add a comment!Discussion&amp;quot;... &lt;br /&gt;
&lt;br /&gt;
I don't know how to automatically treat level 2 headers as level 3. That may be why Discussion was a level 1 heading earlier.&lt;br /&gt;
[[User:Markhurd|Mark Hurd]] ([[User talk:Markhurd|talk]]) 11:16, 14 April 2013 (UTC)&lt;br /&gt;
:Actually I now noticed there was a short edit war at {{tl|comic discussion}} over whether it should be a level 1 heading, just for this reason. [[User:Waldir]] seems to have conceeded... [[User:Markhurd|Mark Hurd]] ([[User talk:Markhurd|talk]]) 11:25, 14 April 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:: No edit war, hence no (intentional) concession. I reverted a change once, and didn't notice the change being re-implemented by another user. In any case, it is irrelevant now since we actively discourage using headers in talk pages precisely so that they don't display in the TOC for the main comic page, where the discussion page is transcluded to (see the discussion [[#Section style and usage|above]]). This might not scale well for comics that generate lots of discussion. It might be worth discussing our customs (and perhaps write them down somewhere) before performing such changes. What do others think? --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 11:49, 14 April 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Time: The Table ==&lt;br /&gt;
&lt;br /&gt;
Right now on the page [[1190: Time]], we have a whole bunch of tables in the form image-time-hash. The tables take up heaps of vertical space and all have to be collapsed to even be remotely traversible. I propose that we aggregate all the images into one table after Time ends, like so:&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable plainlinks table-padding&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!Image&lt;br /&gt;
!Time&lt;br /&gt;
!Image&lt;br /&gt;
!Time&lt;br /&gt;
!Image&lt;br /&gt;
!Time&lt;br /&gt;
!Image&lt;br /&gt;
!Time&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time.png|00:00]]||01/00:00||[[Media:time.png|10:00]]||01/10:00||[[Media:time.png|20:00]]||01/20:00||[[Media:time.png|30:00]]||AND MOAR SAMPLE DATAS&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time.png|00:30]]||01/00:30||[[Media:time.png|10:30]]||01/10:30||[[Media:time.png|20:30]]||01/20:30||[[Media:time.png|30:30]]||AND MOAR SAMPLE DATAS&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
The hash values aren't really a part of the comic, they're gibberish for the most part and they take up space that could be used to compact the table, as shown above. Even if we are conservative and make the table only five columns wide to account for smaller screens, we've divided scrolling time by five and eliminated much of the need for annoying collapsed tables and section headers for each day. Constructing the table shouldn't be particularly hard either, as all our current data is in nice regular tables with clear patterns that are easy enough to parse through. &lt;br /&gt;
&lt;br /&gt;
I'm putting this here because the organization of the frame entries would be unintuitive and difficult to change from the edit window, which would make it a poor choice when we're still expanding it and don't even know how long the comic will continue for. It's merely a space-saving trick for after we're sure that the comic is over. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 09:26, 16 April 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Oh and it'd be really nice if other people could also upload images if you're awake and a new one rolls by. There's gaps in the image record every time I wake up, and I dun likey. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 11:34, 20 April 2013 (UTC)&lt;br /&gt;
:Good work so far; go ahead make it better! :) –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 08:34, 24 April 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
==Featured Explanation, and Archival?==&lt;br /&gt;
&lt;br /&gt;
* Wikipedia has featured content. Now that we are close to reaching the goal of all comics explained, I think it makes more sense to have a &amp;quot;featured explanation&amp;quot; which would serve as a sort of a marker for a complete and good explanation. Many comics, and almost all charts are not fully explained/not a good quality explanation.&lt;br /&gt;
&lt;br /&gt;
* We should set up archival of discussion of the most discussed pages, like this one. Its not very pleasing to see comments from July 2012 still lying around here. It becomes hectic at some point.&lt;br /&gt;
&lt;br /&gt;
Just my 2 cents, feel free to discuss. Cheers,&lt;br /&gt;
[[Special:Contributions/117.194.88.180|117.194.88.180]] 13:36, 24 April 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:We dedicate this wiki to explaining xkcd, and we do actually have a featured comic feature; it changes every week on Monday, Wednesday and Friday, and we usually manage to fill out the explanation for it within an hour or so of it going up. The most recent comic tends to be the one that most people visiting the wiki care about, so we give it prime space on the front page so they can find it easily. xkcd updates frequently enough that there isn't really that big of a time window for us to feature an article on our front page. Also, we're a volunteer project with quite a bit less manpower than Wikipedia.&lt;br /&gt;
:We do need to archive talk pages though. Some of these are getting ridiculously long. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 14:04, 24 April 2013 (UTC)&lt;br /&gt;
::I agree with Davidy22. Archiving topics can be done by anyone, by moving resolved threads to the portal section's corresponding [[explain xkcd talk:Community portal/Proposals|talk page]]. We could start with the threads marked &amp;quot;✓ Closed&amp;quot;. [[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 17:42, 1 May 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:: The reason I asked for a &amp;quot;featured explanation&amp;quot; was because many of the comic explanations we currently have are sub-par, and we're almost at our initial goal of explaining all comics. A &amp;quot;featured explanation&amp;quot; would drive our editors towards the goal of having complete and good explanation towards all comics, and would allow us to know which explanations need elaboration.&lt;br /&gt;
:: P.S. My definition of complete explanation would be - To have a good explanation, To have all categories relevant, To link to any comics related and To explain any technical portions of the comic.&lt;br /&gt;
:: [[Special:Contributions/117.194.82.49|117.194.82.49]] 07:45, 8 May 2013 (UTC)&lt;br /&gt;
:::That message on the front page is going to link to all the pages marked by the incomplete template. If you find an unsatisfactory explanation, please mark it with &amp;lt;nowiki&amp;gt;{{incomplete}}&amp;lt;/nowiki&amp;gt; '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 07:54, 8 May 2013 (UTC)&lt;br /&gt;
:::: By my definition, I think all comics will be incomplete. An incomplete template will be focused more towards improving the worst explanations, while a featured one will be to improve the best ones. Since we already have the former, we should focus on the latter. Just my 2 cents. [[Special:Contributions/117.194.85.82|117.194.85.82]] 06:55, 9 May 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Split the list of all comics ==&lt;br /&gt;
&lt;br /&gt;
[[List of all comics]] is getting larger and larger, which makes it hard to read and hard to edit. How about splitting into parts, say [[List of all comics/1-1000]], [[List of all comics/1001-2000]], etc., or something to that effect? --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 17:39, 1 May 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
: Done. [[Special:Contributions/117.194.88.176|117.194.88.176]] 10:03, 9 May 2013 (UTC)&lt;br /&gt;
::Great job, thanks! [[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 11:09, 9 May 2013 (UTC)&lt;br /&gt;
:::And I've added back [[List of all comics (full)]], which allows, for example, listing all comics by alphabetical order.[[User:Markhurd|Mark Hurd]] ([[User talk:Markhurd|talk]]) 17:29, 10 May 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Sidebar ads ==&lt;br /&gt;
&lt;br /&gt;
''Moved from [[Talk:Main Page]] –– [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 08:06, 4 May 2013 (UTC)''&lt;br /&gt;
&lt;br /&gt;
Are they generating significant money? The ones I see are pretty sleazy looking and/or scammy - &amp;quot;Power Companies Hate this Device! - click here to break the laws of thermodynamics!&amp;quot; and &amp;quot;Debt relief program click here to lose more money&amp;quot;. How much  money are they generating? Can you set any selections to remove the sleazy ads?  [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 18:30, 3 April 2013 (UTC)&lt;br /&gt;
:Do we have sleazy sidebar ads? Since when? Thanks Google Chrome and AdBlock, I had no idea! –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 07:47, 14 April 2013 (UTC)&lt;br /&gt;
::People give 20$ a pop to get a bunch of clicks on explainxkcd, and Jeff uses that money to buy a faster server with a hard drive that doesn't have less space than a public toilet with an elephant in it. It'd be really nice if you didn't turn on adblock, the money is appreciated. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 08:47, 14 April 2013 (UTC)&lt;br /&gt;
:::It's a question of me not turning it off specifically every time I visit this site. More importantly, I do think people would be more likely to click the &amp;quot;donate&amp;quot; if it weren't irrelevant ads around it. –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 19:29, 14 April 2013 (UTC)&lt;br /&gt;
:::Generating money is a great thing. Getting &amp;quot;20$ a pop to get a bunch of clicks&amp;quot; is a bit unclear. Do the ads only generate revenue when clicked on? So EXKCD only gets money when someone actually falls for the sleazy ads? I know lots of people do not like Google - but at least their adsense stuff is relevant to the content of the website, which might generate some legitimate traffic for a legitimate advertiser....  [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 11:48, 19 April 2013 (UTC)&lt;br /&gt;
::::Welllll, I didn't pick the ad supplier. You could bring it up with [[User talk:Jeff|Jeff]] if you want, I think he picked the ad provider on basis of which one had a mediawiki plugin or something. If you can link Jeff to a quick and easy way to put adsense on mediawiki, he should change it quickly enough. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 14:21, 19 April 2013 (UTC)&lt;br /&gt;
:::::And I also gather then that they are only a temporary thing? -- [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 08:27, 24 April 2013 (UTC)&lt;br /&gt;
::::::Until we can buy a server that doesn't poop itself every time a new comic is released, the ads are staying. If you want them to go away sooner, throw more money at Jeff. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 09:25, 24 April 2013 (UTC)&lt;br /&gt;
::::::: The ads are crap.  For sure.  Wish I didn't have to run them, but I don't trust donations alone to hold up continually some better hosting.  The ads really don't bring in that much $$$.  I had google adsense before, but Google shutdown my adsense account for unnamed reason after 1 week.  This new ad service is way sketchier.  If you all think they don't have a place here, I'll ax 'em. --[[User:Jeff|&amp;lt;b&amp;gt;&amp;lt;font color=&amp;quot;orange&amp;quot;&amp;gt;Jeff&amp;lt;/font&amp;gt;&amp;lt;/b&amp;gt;]] ([[User talk:Jeff|talk]]) 16:02, 24 April 2013 (UTC)&lt;br /&gt;
::::::: Thanks for the info Jeff. How much ad money are we talking about? Is it calculated on how many ads are displayed or how many are clicked-through? How close to the goal is the server fund? How about a Kickstarter campaign for the server? $10 gets your name on a thankyou webpage or something like that. [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 17:32, 24 April 2013 (UTC)&lt;br /&gt;
:::::::: It ain't much, last I looked it was $2 or $3 in 2 weeks.  I believe it is based on clicks, it is not nearly as clear as Google adsense.  I'm not really interested in doing a Kickstarter.  I think the donations will cover the initial start up, I just want to be able to cover the monthly costs as well. A few things are still up in the air. --[[User:Jeff|&amp;lt;b&amp;gt;&amp;lt;font color=&amp;quot;orange&amp;quot;&amp;gt;Jeff&amp;lt;/font&amp;gt;&amp;lt;/b&amp;gt;]] ([[User talk:Jeff|talk]]) 16:24, 25 April 2013 (UTC)&lt;br /&gt;
:::::::::Can you find a way to show the donations and ad income on the site, to make it transparent? ––[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 15:30, 30 April 2013 (UTC)&lt;br /&gt;
::::::::: How about a donation amount that you'll take to turn it (the annoying unethical scummy ads) off for a year? Give me a dollar value and I might step up for the good of us all!  [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 16:28, 3 May 2013 (UTC)&lt;br /&gt;
Since Project wonderful shut down, I block ads even on explainxkcd. The adds are simple and not colourful, which I like, but being part of Google Adsense I block them for keeping my my privacy. I am sad to do this but until there is another, better way to serve them, I have to.&lt;br /&gt;
&lt;br /&gt;
== Economic transparency ==&lt;br /&gt;
&lt;br /&gt;
I think this is very important: How can we make the donations and ad-income transparent, so that we all can see when and how much money is coming in, and how far we are from reaching our goal? – [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 00:35, 24 May 2013 (UTC)&lt;br /&gt;
: Sounds fine to me, I think I can put something together. --[[User:Jeff|&amp;lt;b&amp;gt;&amp;lt;font color=&amp;quot;orange&amp;quot;&amp;gt;Jeff&amp;lt;/font&amp;gt;&amp;lt;/b&amp;gt;]] ([[User talk:Jeff|talk]]) 15:52, 28 May 2013 (UTC)&lt;br /&gt;
::Hi, may I bump this issue? Or maybe you have done something, and I missed it? Anyway, I would still appreciate it! –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 17:43, 22 February 2014 (UTC)&lt;br /&gt;
:::Numberssss. I'll get on with it, just need less homework and a few more numbers. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 07:54, 23 February 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
I would like to respectfully file a complain. I find the banner advertisement of background checks distasteful. [[User:Benjaminikuta|Benjaminikuta]] ([[User talk:Benjaminikuta|talk]]) 05:10, 15 July 2014 (UTC)&lt;br /&gt;
: Hey [[User:Benjaminikuta|Benjaminikuta]] - I am the one who approved those ads.  But, since you have filed a complaint about them, I have gone ahead and removed them.  Thanks. --[[User:Jeff|&amp;lt;b&amp;gt;&amp;lt;font color=&amp;quot;orange&amp;quot;&amp;gt;Jeff&amp;lt;/font&amp;gt;&amp;lt;/b&amp;gt;]] ([[User talk:Jeff|talk]]) 12:52, 15 July 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
I thank you. [[User:Benjaminikuta|Benjaminikuta]] ([[User talk:Benjaminikuta|talk]]) 03:36, 17 July 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Using &amp;lt;nowiki&amp;gt;&amp;lt;nowiki&amp;gt;&amp;lt;/nowiki&amp;gt;&amp;lt;/nowiki&amp;gt; in transcripts to improve accuracy ==&lt;br /&gt;
&lt;br /&gt;
In the transcripts, &amp;lt;nowiki&amp;gt;[[lines]]&amp;lt;/nowiki&amp;gt; are being changed to [lines] in order to avoid auto-linking. Why not just surround these with &amp;lt;nowiki&amp;gt;&amp;lt;nowiki&amp;gt;&amp;lt;/nowiki&amp;gt;&amp;lt;/nowiki&amp;gt; tags and avoid the problem entirely? --[[User:Epauley|Epauley]] ([[User talk:Epauley|talk]]) 04:18, 16 June 2013 (UTC)&lt;br /&gt;
:Because it takes less time to type and single brackets are just as readable as double brackets to visitors. It's also a bit more readable in the editor. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 09:55, 16 June 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Strip Title ==&lt;br /&gt;
&lt;br /&gt;
For someone who commonly browses explainxkcd in place of xkcd, and hence often see the strips for the first time here rather than the parent site, I find it somewhat odd that the 'Title Text' is so poorly displayed given how critical it can be to the strip.&lt;br /&gt;
&lt;br /&gt;
I propose that, while retaining the given name (perhaps moving it top left), the title text be enlarged and relocated to being over the strip as originally intended. {{unsigned ip|175.41.133.18}}&lt;br /&gt;
:The title text is placed very well at bottom of the image.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 07:20, 6 September 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:I would have to agree with Dgbrt, it's placed nicely at the bottom, and there is no need for it to be moved. My reasoning is that you never actually read the title text first, you read it last. Making it &amp;lt;code&amp;gt;text-align: left;&amp;lt;/code&amp;gt; does not make sense, because the image is centered (just like on xkcd.com). I also believe that there is no need for it to be re-sized, mainly due to the fact that it is slightly larger than the title text (for me, at least). {{User:Grep/signature|05:18, 08 September 2013}}&lt;br /&gt;
&lt;br /&gt;
:Plus, if you hover over the image, it's the same as on xkcd.com {{User:Grep/signature|06:13, 08 September 2013}}&lt;br /&gt;
&lt;br /&gt;
:I also agree with Dgbrt and Grep. The title text is kind of a bonus and should not be emphasized more than on the original page. On the original site you only see it before the image, if you have very slow internet access (or very fast eyes) --[[User:Chtz|Chtz]] ([[User talk:Chtz|talk]]) 08:06, 2 October 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Sections in talk pages ==&lt;br /&gt;
&lt;br /&gt;
Is there a reason why there are no sections in talk pages? It is not a very big deal, but especially for longer talk pages it would make editing be much handier, especially when using the preview function (not having to find the section every time). Also it automatically adds a description to the history (thus makes it more easy to look for certain edits, or decide by just looking at the [[Special:RecentChanges]], if a comment should concern you. --[[User:Chtz|Chtz]] ([[User talk:Chtz|talk]]) 08:01, 2 October 2013 (UTC)&lt;br /&gt;
:When discussion pages are transcluded by the comic discussion template, section headers carry over from talk pages and bad things happen. Using ; to denote headers instead of equals signs works well, and doesn't share transclusion pain. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 08:04, 2 October 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== references ==&lt;br /&gt;
&lt;br /&gt;
Any chance we can add [https://www.mediawiki.org/wiki/Extension:Cite/Cite.php cite.php] to this wiki? Most pages don't need it, but some comics take on a life of their own and being able to add reference tags would be really helpful for those. [[User:LadyMondegreen|LadyMondegreen]] ([[User talk:LadyMondegreen|talk]]) 01:33, 9 October 2013 (UTC)&lt;br /&gt;
: Cite has been added to the wiki.  Thanks for the suggestion! --[[User:Jeff|&amp;lt;b&amp;gt;&amp;lt;font color=&amp;quot;orange&amp;quot;&amp;gt;Jeff&amp;lt;/font&amp;gt;&amp;lt;/b&amp;gt;]] ([[User talk:Jeff|talk]]) 01:35, 17 October 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Stylized writing ==&lt;br /&gt;
&lt;br /&gt;
I understand that this wiki isn't as formal as wikipedia or sites like that but it seems that there are a few questionable practices:&lt;br /&gt;
&lt;br /&gt;
1. The use of questions - when a non-rhetorical or unnecessary question is entered into the explanation.&lt;br /&gt;
&lt;br /&gt;
2. Extremely painted/biased view points - when there is obvious bias in the tone of the explanation of the contributor, in other &lt;br /&gt;
words; a lack of neutrality.&lt;br /&gt;
&lt;br /&gt;
3. Extreme repetition/rehashing - the explanation restates things and makes for a long and tedious read when a more straight-forward explanation is possible and clearer.&lt;br /&gt;
&lt;br /&gt;
4. The general informality - &amp;quot;This one's an easy one&amp;quot; &amp;quot;This is simple&amp;quot; &amp;quot;this one's straightforward&amp;quot; &amp;quot;You're an idiot for not understanding this one&amp;quot; etc.&lt;br /&gt;
&lt;br /&gt;
5. Many other practices that make the explanation hard to read, difficult to understand, or plain ugly.&lt;br /&gt;
&lt;br /&gt;
I know that there are disparaging view points on how a comic should be explained, but please let's clean up the site a bit, acknowledge each view point and report on all of them and then tighten up the sloppy writing. Carry out arguments in the talk section, not the explanation. Perhaps we could first try to say the majority view point on the interpretation and then write the alternate explanations, of course this would bring up the debate on which is the majority explanation. Either way, more complete, logical explanations should be given more credence. --[[User:Lackadaisical|Lackadaisical]] ([[User talk:Lackadaisical|talk]]) 00:25, 23 October 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:I agree with 2-5. 1, on the other hand, is sometimes useful and can contribute the to explanation, although 1 is still a very good point. I would say that you should edit it to have &amp;quot;arguments in the talk&amp;quot; be a 6th point as well. Unfortunately, though, we are not all logical, comic-understanding machines here, so minor deviations of these rules are still to be expected. But I think that overall, these are good rules, even if 2/3 are sort of part of 5.&lt;br /&gt;
:[[User:Lackadaisical|Lackadaisical]], please sign your post with &amp;lt;nowiki&amp;gt;~~~~&amp;lt;/nowiki&amp;gt;&amp;lt;span style=&amp;quot;float: right;&amp;quot;&amp;gt;{{User:Grep/signature|23:55, 22 October 2013}}&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:I understand the use of questions in certain parts. And it was probably better to put the others as sub-categories to five but I wanted to show some common things that can be easily fixed. I know that some explanations require a lot of text and extensive research because of the abstract subjects Randall deals with and that it's difficult to be completely standardized but I think it would be good for us to try to come up with some general things to try to avoid to help the explanations &amp;quot;flow&amp;quot; --[[User:Lackadaisical|Lackadaisical]] ([[User talk:Lackadaisical|talk]]) 00:25, 23 October 2013 (UTC)&lt;br /&gt;
::Most of that isn't intentional, it's just an awful lot of labor to copy check all the explanations. I've been going through all the current articles and fixing consistency issues, the worst being wrong transcript/title text/dates and the most benign being wikilinks, spelling and trailing spaces. I'm at 682 so far, but my next pass will be on actual language and content, and it'll probably take longer. It takes a while though, and you can totally work on improving language in articles if you want to. Some explanations were pulled from the old blog, some were written and just got lost in the changelog. Copy editing everything we have so far is a very labor-intensive job, and the only way to really deal with it is to knuckle down and do it, or form a wikiproject and hope to heaven that visitors feel charitable enough to join in on it. I'd *probably* push to finish up all our incomplete articles first though, just because that's more directly related to the purpose of the site; tone and style probably comes second to having correct explanations. That doesn't mean you can't do it yourself, it's just that I'll probably only dedicate the subheader on the main page to one project at a time and our current biggest bugbear hasn't been solved yet. I could put up a sitenotice to see if that speeds the process up any. I'll do that when I get back home. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 03:31, 23 October 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Easy redirect to comic? ==&lt;br /&gt;
&lt;br /&gt;
I've been thinking, and there is one thing that would make navigating to the explained comics easier. My method of browsing is I'll see the comic on xkcd.com first, and if there is something curious about it that I don't quite understand, I'll come here. Sometimes it can be a bit troublesome, going to the homepage and then navigatiing to the right comic. Not too bad, but I'd like an easy way to go direct. So I was thinking, what if you had a redirect such that if you typed in, for example, www.explainxkcd.com/505, you would get redirected to http://www.explainxkcd.com/wiki/index.php?title=505:_A_Bunch_of_Rocks. That would mean that you could get to the comic just from adding an &amp;quot;explain&amp;quot; to the start of the xkcd.com URL. I don't know if that is at all possible, but it would be pretty handy if it happened. Thoughts?&lt;br /&gt;
[[User:Alcatraz ii|Alcatraz ii]] ([[User talk:Alcatraz ii|talk]]) 03:01, 25 October 2013 (UTC)&lt;br /&gt;
:[http://www.explainxkcd.com/wiki/index.php?title=explain_xkcd:Community_portal/Technical#Redirect_from_explainxkcd.com.2F1234 That's actually already on the to-do list.] I'm testing it right now and we should have it up soon. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 04:02, 25 October 2013 (UTC)&lt;br /&gt;
:: Awesome :) [[User:Alcatraz ii|Alcatraz ii]] ([[User talk:Alcatraz ii|talk]]) 03:26, 1 November 2013 (UTC)&lt;br /&gt;
:::Whoop, forgot to mark this as complete. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 04:37, 1 November 2013 (UTC) &lt;br /&gt;
:::: Done! Copy this and drag it to your bookmarks bar: |javascript: var url = document.URL; document.location = url.replace('xkcd.com','explainxkcd.com');| {{unsigned ip|173.245.52.29}}&lt;br /&gt;
:::::The feature requested here has also long since been implemented. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 22:20, 4 April 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Increase support via prominent display of copyright and license for text submitted to explainxkcd ==&lt;br /&gt;
&lt;br /&gt;
XKCD itself is rather liberally licensed, and gets lots of good will from that.  As it says on the bottom of every page &amp;quot;This work is licensed under a Creative Commons Attribution-NonCommercial 2.5 License.&amp;quot;  For details see [http://xkcd.com/license.html xkcd - A Webcomic - License].&lt;br /&gt;
&lt;br /&gt;
But I found nothing on most pages of explainxkcd about copyright or licensing, and it discouraged me from contributing or donating.  Finally, as I was writing this proposal up, I found a link on the editing page here: [http://www.explainxkcd.com/wiki/index.php?title=explain_xkcd:Copyrights explain xkcd:Copyrights - explain xkcd] saying that &amp;quot;''The Explain XKCD wiki is generally licensed under the Creative Commons Attribution-ShareAlike 3.0 license (CC-BY-SA-3.0)''&amp;quot;.  That notice should be more prominent on the site, with at least a link on each page.  [[User:Nealmcb|Nealmcb]] ([[User talk:Nealmcb|talk]]) 15:27, 5 November 2013 (UTC)&lt;br /&gt;
:This should be mentioned at the main page, including a reference to the xkcd origin.&lt;br /&gt;
:BTW: NO DOUBLE SPACES after a sentence. Are you US guys still using a typewriter? It's not rendered at a web page and stupid like Gallons, Miles, Foots, and much more unique US behaviours. But that's just a joke beside.&lt;br /&gt;
:The licence hint is much more important, you are just correct.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:12, 5 November 2013 (UTC)&lt;br /&gt;
::Added a creative commons icon to the footer of the page, next to the powered by mediawiki button. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 22:16, 5 November 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== New Comics Bot ==&lt;br /&gt;
&lt;br /&gt;
Would there be need for such a thing?&lt;br /&gt;
[[Special:Contributions/108.162.231.52|108.162.231.52]] Synthetica&lt;br /&gt;
:Nice idea, I never thought about that before. I will do some tests on existing comics to check if this could reduce the current number of error posts for a new article. When that is ready and working I will talk to some admins. My bot account [[User:DgbrtBOT|DgbrtBOT]] was originally intended for [[1190: Time]] picture uploads, but I never have used it because Time was over. Creating the new pages should be easy in general, avoiding errors will cost some more work. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:31, 6 November 2013 (UTC)&lt;br /&gt;
::If you can get dgbrtBOT to do that, that'd help us an awful lot. It'd allow us to get rid of the ifexist cases in template:LATESTCOMIC as well, since the bot could change automatically that whenever a new comic goes up. It'll also help us get new comics down almost the moment they pop up, since the bot could sample several times a minute until a comic is posted. So long as it gets the general pattern right so that we have a correct page set up, we're good. An admin can come in sometime later to clean up categories and image urls and other piddly easy-to-fix details. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 20:54, 6 November 2013 (UTC)&lt;br /&gt;
:::I will work on this next weekend, just local scripts and no updates here. I also will talk about my results before any automatic updates will be activated. My first focus is on creating the new pages in the general pattern, LATESTCOMIC and also the page &amp;quot;All comics&amp;quot; are maybe a bonus later. And of course all my scripts will be open source.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:44, 6 November 2013 (UTC)&lt;br /&gt;
::::The first version is ready and I will test it at my local wiki. If everything goes well I could activate it for Wednesday (2013-11-13). LATESTCOMIC and &amp;quot;All comics&amp;quot; are on my roadmap, but first I want produce correct new pages here. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:00, 10 November 2013 (UTC)&lt;br /&gt;
:::::Righty ho. Here goes. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 20:36, 10 November 2013 (UTC)&lt;br /&gt;
Even when my automatic local wiki test did fail today, just a damn wrong password, I will activate the bot here for Wednesday. It will only run from 4:00 PM until 8:00 PM UTC. You will not see my possible updates at [[Special:RecentChanges]] unless you click ''Show bots'' at the top of that page. LATESTCOMIC and &amp;quot;All comics&amp;quot; are not covered, but this is at my TODO list until this test will be successful. Give me a '''GO''' or '''NO-GO''' for this test.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:49, 11 November 2013 (UTC)&lt;br /&gt;
:Easily a GO, I'll be ready to clean up if anything goes wrong. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 22:08, 11 November 2013 (UTC)&lt;br /&gt;
::So be ready on Wednesday for the clean up. My worst case is ''it simply does not work'', second worse scenario is still that I could delete some contend already posted here, but I'm trying to avoid this. ''Huston'', the countdown clock is counting. I'm joking about this because I really want to be confident about this ''BOT'' or ROBOT or uncontrolled action here.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 00:28, 12 November 2013 (UTC)&lt;br /&gt;
:::The bot can't do anything that I can't reverse. I can even restore a backup from an hour before the bot's edits if it manages to break the database. How quickly does it poll xkcd, by the way? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 07:53, 12 November 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
First live test here (comic 1289). Please delete this page: [[Simple_Answers:_1289]]. Since my local wiki did not provide this templates I could not see this error before. In general the bot will update pages differ to any existing pages, but when it is not changed no update will happen. I'm fixing this errors at my script and do a second test here soon. I want to see it's producing correct pages until the bot will do it's work when I'm sleeping.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:31, 12 November 2013 (UTC)&lt;br /&gt;
:Ok, test are done here, BOT is scheduled for the next update. Polling is every five minutes on Mon, Wed, and Fri from 04:00 until 08:00 UTC. Let's see how it will work.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 23:08, 12 November 2013 (UTC)&lt;br /&gt;
::Couldja ramp that up to once/twice a minute, push the start time back by an hour, and the end time by a few hours? Also, is it possible to terminate it once it finds a comic for a certain day? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 01:45, 13 November 2013 (UTC)&lt;br /&gt;
:::It worked! Though it posted the comic 5 minutes past post time. We has technology now, we can afford to poll faster and closer, yeah? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 05:32, 13 November 2013 (UTC)&lt;br /&gt;
Uhh, it worked... I will increase the polls when I'm more confident about the release times. Today it was approx. 05:00 UTC (GMT) or 01:00 EST (Randall's time zone). Looks like he is still at daylight saving time, would have been 00:00 EDT. The polls will be increased to one minute when I'm sure about the Standard Release Time (SRT). Next steps for the next update on Friday are:&lt;br /&gt;
:The &amp;quot;All comics&amp;quot; page.&lt;br /&gt;
:The LATESTCOMIC template.&lt;br /&gt;
--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 19:54, 13 November 2013 (UTC)&lt;br /&gt;
:The LATESTCOMIC template is included for the next run, it just simply has to return a number. But it's still the most critical part because if it does not work the Main Page is broken. I will change this to a better solution using that IFEXIST syntax soon. The list of all comics is still at my ToDo list. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:06, 14 November 2013 (UTC)&lt;br /&gt;
::The desired content of the LATESTCOMIC template should be just the comic number. If we can get out of having to poll multiple IFEXIST statements to find the latest comic, that would be a fantastic boon to our server performance. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 04:43, 15 November 2013 (UTC)&lt;br /&gt;
:::OK, it did work today so I will not change this. Next step is the list for all comics.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 11:10, 15 November 2013 (UTC)&lt;br /&gt;
Next run will include an update on the &amp;quot;All comics&amp;quot; page. I'm crossing my fingers. When this update is also successful I will document my Bot at the Bot user page [[User:DgbrtBOT]]. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:15, 17 November 2013 (UTC)&lt;br /&gt;
:Oh, I forgot this detail: The bot is starting at 00:00 EST (RLT - Randall local time), which is 04:00 UTC and 05:00 MET for me. It polls every 5 minutes until 23:55 MET (22:55 UTC, 18:55 RLT) the main page until a new comic is found. I do not poll the comic number because I want to avoid 404 message logs at the servers.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:30, 17 November 2013 (UTC)&lt;br /&gt;
:Something went wrong there. That's gonna need fixing. I am enjoying the looks of the apparently faster polling though. Maybe you could also set the start time to 00:00:05 EST to catch the on-time xkcd releases within ten seconds? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 05:33, 18 November 2013 (UTC)&lt;br /&gt;
::Uh, what a mess. I will do some more tests at my local wiki. At the next time I will do a check against the number from the LATESTCOMIC template, only the next number will be processed. The test against my local history did fail because of some cleanups after testings.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 08:18, 18 November 2013 (UTC)&lt;br /&gt;
:::I don't like mess. So the BOT got many more checks before posting here but the bot was starting at 05:00 local time for me. I'm really asleep at that time. The mess here was covered, but I do need another GO for the next attempt. Otherwise I will just do a test to my local wiki.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:35, 18 November 2013 (UTC)&lt;br /&gt;
No GO so far, my next test will run only at my local wiki.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:16, 19 November 2013 (UTC)&lt;br /&gt;
:My script is here: [https://github.com/dgbrt/explainXKCD_update explainXKCD_update]. At my current test &amp;quot;explainxkcd.com&amp;quot; is commented out and &amp;quot;localhost&amp;quot; is active. Since I don't like mess and the bot does act while I am sleeping the next update must be done manually here. I'm hoping the bot will be ready for the next update on Friday.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:15, 19 November 2013 (UTC)&lt;br /&gt;
::Bot is ready for Friday, everything went smooth at my last local test today. The bot did find the latest comic at 04:05 UTC and all essential pages were properly created. So I will activate it for this site again. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:57, 20 November 2013 (UTC)&lt;br /&gt;
Bot did work as expected. So I name it release 1.1337, the next planed release will be 2.1337 (beta) because of this two issues:&lt;br /&gt;
*&amp;quot;Include any categories below this line.&amp;quot; will be removed because it doesn't make any sense any more.&lt;br /&gt;
*BETA: I want to use the full template features at [[List of all comics]], just ensuring that the pictures are working properly. No need for this at the most comics, but the BOT doesn't cover all possibilities on corrupt file names like we have had in &amp;quot;Pi vs. Tau&amp;quot;. The picture was without that dot. My bot just shows the real link it did upload here.&lt;br /&gt;
I'm pretty sure we will have some issues on this bot, but for general pages it should work. So the bot will be active on Mon,Wed,Fri from 0:00 EST (or EDT) every five minutes until it did found a new comic, on success the bot does not poll any more.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:51, 22 November 2013 (UTC)&lt;br /&gt;
:Aww, it's a bot. It doesn't need to rest or take time off to do other stuff. It can totally poll once or more times per minute. Also, if you set the start time to a few seconds after midnight, Randall time, when he uploads a comic on-time, you'll get it within a few seconds as opposed to having to wait for the next polling. As for the image names, maybe you could convert spaces in the comic name to underscores, compare the two comic names you have and use that to decide which version of the template to use? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 23:08, 22 November 2013 (UTC)&lt;br /&gt;
::I have to avoid that the bot is running twice, Internet Timeouts and more. And the comics are also published later sometimes. Look at my release [https://github.com/dgbrt/explainXKCD_update 1.1337], release 2.1337 will be later, Maybe I should start at 2 minutes after 0:00, but let's see right now how the bot does work. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 00:38, 23 November 2013 (UTC)&lt;br /&gt;
Uhh, what a huge discussion here. The bot will get a major update soon: Scheduler does start it once and until a comic is found and uploaded it here or an other limit is reached (maybe the end of the day) the bot will poll by a small delay. But every poll is still an entire download from the main page, When a new comic is found bot stops.&lt;br /&gt;
:Why, you could use http://xkcd.com/info.0.json, right?[[Special:Contributions/108.162.231.52|108.162.231.52]] 07:38, 2 December 2013 (UTC)Synthetica&lt;br /&gt;
::The BOT performs perfect and I prefer to analyze the original page. A title text like the one from today (a text showing a link) will be covered in the future.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 10:35, 2 December 2013 (UTC)&lt;br /&gt;
A great enhancement would be also covering a new comic like 1190 Time was. I'm looking forward on this, some ideas, it does require a complete analyse of the page and then finding some strange content. &lt;br /&gt;
--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 23:05, 27 November 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Require description for 'incomplete' tags ==&lt;br /&gt;
I've been trying to fix some of the incompletes, but several explanation pages I've come across are tagged incomplete without any reason given. The reason should be a required part of the tag. --[[Special:Contributions/173.245.52.223|173.245.52.223]] 03:35, 7 December 2013 (UTC)&lt;br /&gt;
:This incomplete tags are just older than the recent change of that template. Current adds require a description, but it's not easy to figure out all that old reasons. If someone does find a reason, please just add it. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:22, 7 December 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Should there be a subwiki to cover the shop links that appear above the comic?  ==&lt;br /&gt;
&lt;br /&gt;
The current one (as of writing) is [http://imgs.xkcd.com/store_news/store_gd_b11_1ze4.png] but this is a different than the usual, and there was also a third in between these.&lt;br /&gt;
[[User:Rsranger65|Rsranger65]] ([[User talk:Rsranger65|talk]]) 06:00, 8 December 2013 (UTC)&lt;br /&gt;
:Those are very ephemeral. They aren't going to exist for very long, I don't know how valuable it would be to archive that stuff. We could probably do it, but having to figure out another naming convention and all for advertisements doesn't appeal to me at the current moment. If you can flesh it out, I'd love to see how you think we should do it. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 07:24, 8 December 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
== New Character ==&lt;br /&gt;
&lt;br /&gt;
OK, I think we need a name for the character with a goatee and glasses in comics [[435: Purity]], [[796: Bad Ex]] and [[964: Dorm Poster]] as well as possibly others. Edit: oh and I suggest Goatee and Glasses Guy, but I'm open for suggestions Edit 2: also in [[826: Guest Week: Zach Weiner (SMBC)]] Halfhat {{unsigned|Halfhat}}&lt;br /&gt;
edit 3: Another sighting [[954: Chin-Up Bar]] [[User:Halfhat|Halfhat]] ([[User talk:Halfhat|talk]]) 16:57, 13 January 2014 (UTC)&lt;br /&gt;
: In the transcript, he is called &amp;quot;Person with Glasses and a Goatee&amp;quot; --[[User:Jeff|&amp;lt;b&amp;gt;&amp;lt;font color=&amp;quot;orange&amp;quot;&amp;gt;Jeff&amp;lt;/font&amp;gt;&amp;lt;/b&amp;gt;]] ([[User talk:Jeff|talk]]) 15:39, 21 March 2014 (UTC)&lt;br /&gt;
:: &amp;quot;Glasses Guy&amp;quot;, &amp;quot;Goatee Guy&amp;quot; are both probably descriptive enough! --[[User:Jeff|&amp;lt;b&amp;gt;&amp;lt;font color=&amp;quot;orange&amp;quot;&amp;gt;Jeff&amp;lt;/font&amp;gt;&amp;lt;/b&amp;gt;]] ([[User talk:Jeff|talk]]) 15:41, 21 March 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== What If Comics ==&lt;br /&gt;
&lt;br /&gt;
Hi, I was thinking, maybe at some point we should do the comics in the ''What If?'' section, like [http://what-if.xkcd.com/imgs/a/36/cornstarch_bitcoins.png this one.] [[User:Halfhat|Halfhat]] ([[User talk:Halfhat|talk]]) 20:01, 13 January 2014 (UTC)&lt;br /&gt;
: Start creating the pages for them! --[[User:Jeff|&amp;lt;b&amp;gt;&amp;lt;font color=&amp;quot;orange&amp;quot;&amp;gt;Jeff&amp;lt;/font&amp;gt;&amp;lt;/b&amp;gt;]] ([[User talk:Jeff|talk]]) 15:36, 21 March 2014 (UTC)&lt;br /&gt;
: I think I can start creating one or two pages for What If, if that helps... [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 16:14, 5 April 2014 (UTC)&lt;br /&gt;
:: If nobody has any problem with it, I'm gonna give it a try later. :) [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 13:14, 8 April 2014 (UTC)&lt;br /&gt;
:::I thought they were already pretty self-explanatory though. Also, how are we gonna organize and present them? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 16:31, 8 April 2014 (UTC)&lt;br /&gt;
::::I totally agree with David: Read the entire What-If page and follow the links provided by Randall. No one of us can do that better in depth. But an overview page for this site is maybe not a bad idea, we just need a proper link here — a link at the main menu on the left. Translations to other languages are just another issue. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:37, 8 April 2014 (UTC)&lt;br /&gt;
:::::Yes, I was thinking of an overview, summarizing the contents and discoveries of each what if page. Not to mention, we could also organize what if pages by categories, such as physics/love.&lt;br /&gt;
:::::Would you like me to post here an example of what I would write? That way we can decide if it's worthy of creating an actual page. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 12:53, 9 April 2014 (UTC)&lt;br /&gt;
:Adding pages for What If? posts would be very helpful. Although the articles themselves are obviously self-explanatory, there are almost as many subtle references, running gags, and in-jokes in What If? posts these days as in the comics themselves.&lt;br /&gt;
I often visit explain xkcd when I feel like I'm missing an inside joke or a pop culture reference in a comic, and it would be very helpful to many people (especially those from other cultures/subcultures) to have the same service.&lt;br /&gt;
For example, today's What If? contains multiple allusions to the Superman Movie, a running Citation Needed joke, and a whole comic that is a not-so-subtle dig at Elon Musk and the Hyperloop. It would be awesome if the community here at explainxkcd could tackle stuff like that.&lt;br /&gt;
Anonymous 20:05, 31 July 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
I agree. I don't understand the mouseover text on the first image in &amp;quot;Snow Removal&amp;quot;, for example. [[User:Benjaminikuta|Benjaminikuta]] ([[User talk:Benjaminikuta|talk]]) 22:57, 23 February 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Transcripts ==&lt;br /&gt;
&lt;br /&gt;
The whole point of the transcripts is to have those who are unable to view images to still be able to read the comic, right?&lt;br /&gt;
&lt;br /&gt;
Then why is it required to stick to strictly official transcripts, where sometimes rewriting them slightly would make them flow better or otherwise get the ideas across better? I've tried rewriting a few, but they get reverted. I think that having easier-to-understand transcripts would be more important than strictly following official transcripts; what do you think? (For a few examples, see [http://www.explainxkcd.com/wiki/index.php?title=207:_What_xkcd_Means&amp;amp;diff=60061&amp;amp;oldid=57400 this edit] and [http://www.explainxkcd.com/wiki/index.php?title=995%3A_Coinstar&amp;amp;diff=59862&amp;amp;oldid=57316 this edit]. [[User:Zowayix|Zowayix]] ([[User talk:Zowayix|talk]]) 17:38, 19 February 2014 (UTC)&lt;br /&gt;
:We use the original transcript to try and deduce original author intent if it's unclear from the image. I remember one comic where Beret Guy was off in the distance and it was difficult to distinguish him from the image, but the official transcript said it was him. We don't stick to the original transcript if it's obviously wrong, or it has typographical errors: see [[Laser Scope]]. Those edits seem to be mainly targeted at language and clarity, and should be fine. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 23:06, 19 February 2014 (UTC)&lt;br /&gt;
::Would it be helpful to have another (optional) section for expanding on the official transcripts? I too think it could be helpful, especially for complex images (such as 1079/United Shapes [http://www.explainxkcd.com/wiki/index.php/1079]). Or does supplemental description belong in the Explanation sections? Cheers. [[User:Karenb|Karenb]] ([[User talk:Karenb|talk]]) 23:00, 20 March 2014 (UTC)&lt;br /&gt;
:::Naaah, how many people even know there's an original transcript? If the original is wrong, change it. If your additions begin to verge on explanatory, move eet to the trivia/explanation sections. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 00:52, 21 March 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== &amp;quot;Characters in this Comic&amp;quot; section ==&lt;br /&gt;
&lt;br /&gt;
Should there be a &amp;quot;Characters in this Comic&amp;quot; section in each comic explanation? (I feel like this should be longer but don't have anything else to say.) [[User:Z|Z]] ([[User talk:Z|talk]]) 23:33, 11 May 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
:There is a Category section at the bottom of each comic. Just scroll down and you will see any character belonging to a specific comic. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:50, 12 May 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Adding the Radiation chart from XKCD ==&lt;br /&gt;
&lt;br /&gt;
Hi &lt;br /&gt;
As there are already other comics with explanations even though they are not part of the number system.&lt;br /&gt;
This one does not seem to have any yet:&lt;br /&gt;
http://xkcd.com/radiation/&lt;br /&gt;
And as it is very alike the Money strip (the unexplained of the week) so I think it should be explained as well.&lt;br /&gt;
If you agree please add it as I'm not sure how to do that.&lt;br /&gt;
&lt;br /&gt;
Best regards&lt;br /&gt;
:[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 18:47, 7 June 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Reddit comments? ==&lt;br /&gt;
&lt;br /&gt;
There should be a link in each comics explanation page somewhere linking to the comment section for the relevant comic on /r/xkcdcomic or reddit.&lt;br /&gt;
:The reddit comments page isn't ''that'' close to what we do though. If this is more popular, we'll do it, though there'll need to be a fair bit of post-hoc editing since I don't think there's a standard URL scheme for all the past comics. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 03:15, 23 June 2014 (UTC)&lt;br /&gt;
:I just came here to ask if we could do this, but I looked into it and it wouldn't be simple. Could we write a bot to run on the xkcd subreddit to post the link here? --[[User:Eluvatar|Eluvatar]] ([[User talk:Eluvatar|talk]]) 05:53, 6 November 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Not insulting new users ==&lt;br /&gt;
&lt;br /&gt;
I am writing a response to a vulnerability assessment.  I have included a link to http://www.explainxkcd.com/wiki/index.php/936 noting that it contains a good explanation of the relative security of passwords vs passphrases.  I just noticed that the top of that page contains &amp;quot;Explain xkcd: It's 'cause you're dumb.&amp;quot;  Looks like I'll have to find a different site to link to.  --[[User:Pascal|Pascal]] ([[User talk:Pascal|talk]]) 17:33, 28 June 2014 (UTC)&lt;br /&gt;
:I agree.  While I'm sure it can seem cute or funny in various circles, that text has always seemed immature and inappropriate to me, and I'm sure to many folks we'd like to invite to the site. I suggest that it be changed.  [[User:Nealmcb|Nealmcb]] ([[User talk:Nealmcb|talk]]) 19:52, 23 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:The XKCD  http://www.explainxkcd.com/wiki/index.php/936 suggestion for password is actually not that good. [http://security.stackexchange.com/questions/62832/is-the-oft-cited-xkcd-scheme-no-longer-good-advice read here] for some more discussion.   [[Special:Contributions/162.158.253.6|162.158.253.6]] 23:49, 10 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
:I also agree.  I'm not here because I'm stupid, I'm here because I don't know something and I'm hoping this site can help.  It's off putting to have that text there, and there's no benefit to it.  What about just repeating the thing at the top of XKCD.com: &amp;quot;Romance, Sarcasm, Math, and Language: Explained&amp;quot;?&lt;br /&gt;
&lt;br /&gt;
I agree, and there is actually a very long talk page started about this subject in the miscellaneous section. Eventually people voted to keep it, but the main argument on that side was that that was the way things had always been. I am fairly new to the site (this is actually my first post on it), so I don't know how these things work, but I do think that that should be changed. There were actually a large number of good proposals for replacements with the other one, and I thought it would be funny if there was a randomly selected character every time you loaded a page, with each character having their own tagline. Is there any way to try to get this changed again?[[Special:Contributions/172.68.78.52|172.68.78.52]]&lt;br /&gt;
&lt;br /&gt;
== RSS feed ==&lt;br /&gt;
&lt;br /&gt;
Is there an RSS feed (or some equivalent) of Explain XKCD available? It's helpful for those using feed readers, and superior to the primary XKCD RSS since there are explanations and the mouse over text is transcribed for the lazy. Thanks [[Special:Contributions/108.162.219.154|108.162.219.154]] 08:24, 28 August 2014 (UTC)&lt;br /&gt;
:[http://www.explainxkcd.com/wiki/index.php?title=Special:NewPages&amp;amp;feed=atom&amp;amp;hideredirs=1&amp;amp;limit=90&amp;amp;offset=&amp;amp;namespace=0&amp;amp;username=&amp;amp;feed=&amp;amp;tagfilter= Why yes, we do!] It's the regular new pages log that all wikis have. It's a little ugly at the moment, and sometimes junk gets in there when a bot chucks spam at us, so a nicer feed is in the works, but the linked one should do you excellently for now. When the nice one is done, you'll see it in the sidebar below the &amp;quot;Help&amp;quot; button. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 11:31, 28 August 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Navigation Pane Link - Categories ==&lt;br /&gt;
&lt;br /&gt;
How about having a link to the &amp;quot;Special:Categories&amp;quot; page in the navigation pane?&lt;br /&gt;
&lt;br /&gt;
A fair amount of effort has gone into categorising the comics, and at the moment it isn't particularly obvious how to browse by category. Is this worth doing?{{unsigned|Pudder}}&lt;br /&gt;
:Space on the sidebar is on a premium. I dunno, I'd probably be against it, but I want to hear what other admins say as well. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 16:45, 29 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Alternate realities what if would benefit from a wiki entry ==&lt;br /&gt;
&lt;br /&gt;
The what if entry from the end of November 2014 providing excerpts from alternate reality what ifs would benefit from an explain page. &lt;br /&gt;
I suspect these may have been typos that have been made into jokes, but some of the humor might not be apparent to all.  &lt;br /&gt;
I doubt I have access (or maybe know how) to set it up myself. &lt;br /&gt;
&lt;br /&gt;
Cheers {{unsigned ip|199.27.133.42}}&lt;br /&gt;
&lt;br /&gt;
:  Made it. Check out [[What If: 120: Alternate Universe What Ifs]]. [[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 09:10, 26 December 2014 (UTC)&lt;br /&gt;
::We don't actually have a structure for what if pages in general, so I'll have to take that down, but when we do we can make pages for every what if. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 09:57, 26 December 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Secondary URLs? ==&lt;br /&gt;
&lt;br /&gt;
I have made http://www.xkcd.ga and http://www.xkcd.tk both forward to http://www.explainxkcd.com/wiki/index.php/Main_Page. Is this ok? [[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 08:50, 26 December 2014 (UTC)&lt;br /&gt;
:While we probably won't advertise them because we can't guarantee the uptime of third-party URLs, and they add an additional redirect layer and lack our shortened URL features, you're free to purchase and link URLs to us independently. We are not owned by Randall and as such cannot claim to actually be xkcd, so I'm not hugely comfortable with you using the plain name &amp;quot;xkcd&amp;quot; to link to us; a url in the format http://www.xkcd.[TLD] should by rights link to the main xkcd site, but no trademark claim has been made or likely will be made, so you should be fine with doing whatever you want to do with URL redirects '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 09:57, 26 December 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
== LaTeX (Or MathML, TeX) support? ==&lt;br /&gt;
&lt;br /&gt;
[[1489:_Fundamental_Forces|In the most recent comic at the time of posting]], there was use of formulae, being:&amp;lt;br/&amp;gt;F&amp;lt;sub&amp;gt;gravity&amp;lt;/sub&amp;gt; = G m&amp;lt;sub&amp;gt;1&amp;lt;/sub&amp;gt;m&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;/d&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;br/&amp;gt;F&amp;lt;sub&amp;gt;static&amp;lt;/sub&amp;gt; = K&amp;lt;sub&amp;gt;e&amp;lt;/sub&amp;gt; q&amp;lt;sub&amp;gt;1&amp;lt;/sub&amp;gt;q&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;/d&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;br/&amp;gt;&lt;br /&gt;
There are probably many more comics using formulae that cannot be rendered properly without the use of LaTeX or something. The [http://en.wikipedia.org/wiki/Help:Displaying_a_formula help page on Wikipedia] says that the following should work:&amp;lt;br/&amp;gt;&amp;lt;math&amp;gt;F_{gravity}=G\frac{m_1m_2}{d^2}&amp;lt;/math&amp;gt;&amp;lt;br/&amp;gt;&amp;lt;math&amp;gt;F_{static}=K_e\frac{q_1q_2}{d^2}&amp;lt;/math&amp;gt;&lt;br /&gt;
Provided that one has to set &amp;lt;source lang=&amp;quot;php&amp;quot; enclose=&amp;quot;none&amp;quot;&amp;gt;$wgUseTeX = true;&amp;lt;/source&amp;gt; in [[mw:Manual:LocalSettings.php|LocalSettings.php]]. Is there any reason for this to be disabled? If there is, is there any alternative?  —[[Special:Contributions/141.101.106.95|141.101.106.95]] 21:18, 20 February 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:The wgUseTeX flag was deprecated in mediawiki 1.18 in a move to simplify base mediawiki and move niche features into seperate plugins. I vaguely remember this being requested in the past, can't find any evidence of me implementing it. I'll try it now, see what stopped me last time. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 01:12, 21 February 2015 (UTC)&lt;br /&gt;
:Ah, there's a bit of configuration work to it and I was busy at the time probably. I'll put it on the growing to do list on my userpage. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 01:20, 21 February 2015 (UTC)&lt;br /&gt;
This problem is '''solved'''. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 12:03, 15 June 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Merge Cueball &amp;amp; Rob ==&lt;br /&gt;
&lt;br /&gt;
At the risk of posting this idea too many places and annoying everyone, I would like to propose that we consider merging [[Cueball]] and [[Rob]] and redirecting Cueball to Rob, much as [[Cutie]] now redirects to [[Megan]]. The most common name given for a Cueball-like character in the strip is &amp;quot;Rob&amp;quot;. Like Megan, he is not always named. Also, like Megan, Rob tends to have distinct characteristics such as being a nerdy alter-ego to Randall (e.g. [[1168: tar]]) just as Megan often is the appearance given to comic representations of Randall's wife (see [[1141: Two Years]], before hair loss). Megan and Cueball appear to have a relationship (e.g. [[159: Boombox]]) and Megan clearly hangs out with Rob in ways not inconsistent with adventurous couples (e.g. [[782: Desecration]]). Finally, comics that feature both [[Black Hat]] and &amp;quot;Cueball&amp;quot; seem to depict them as friends and possibly roommates. However, we learn in [[1102: Fastest-Growing]] that Black Hat's roommate is named &amp;quot;Rob&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
In short, I believe if [[159: Boombox]] had called &amp;quot;Cueball&amp;quot; &amp;quot;Rob&amp;quot; we would've rewritten both Cutie and Cueball to redirect there.  Because we learned that &amp;quot;Cueball's&amp;quot; name is actually Rob much later (I think the earliest occurrences are [[647: Scary]], and [[716: Time Machine]]; the first time he is seen with Megan in a capacity that might indicate a relationship is [[782: Desecration]]). [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 19:05, 11 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:As I answered your comment on [[1496: Art Project]] Rob is [http://www.explainxkcd.com/wiki/index.php/Category:Comics_featuring_Rob  already listed] as part of the category for Comics featuring Cueball: and this is listed as the first entry when going to the page for [http://www.explainxkcd.com/wiki/index.php/Category:Comics_featuring_Cueball Category:Comics featuring Cueball]. Cueball is such an integral part of explain xkcd that I do not think any other users wish to change. Also the 9 incidences with Rob is maybe a specific person and at the time Randall did not think to give him any features. Also Cueballs have no specific behavior as you allude to. Neither has Megan. You can always find several Cueballs and Megans that behave a certain way. But then you can find many other comics where they behave the opposite way. Thus Rob and Cueball should not be merged. Also there are several comics with more than one Cueball. And here we have this problem: It is typically the first who writes the transcript who decides who of the Cueballs (or Megans) he feels represents the &amp;quot;real&amp;quot; Cueball. However, there is no real behavior of Cueball. So who should decide. I could change all these transcripts so it becomes the other character who becomes Cueball, because I think that the first transcriber did it wrong. And this is why in a comic with more than one Cueball (where neither is called Rob or the like) neither of the two should be called Cueball. It would still be in the category with Cueball, because that is just comics with a Cueball like character no matter how many. But they cannot be named Cueball and friend or Rob and friend (unless Rob's name is mentioned!) They could be called Cueball 1 and Cueball 2, but then guy or man would be better. I know several places have comics with two Cueballs where someone has designated one of them Cueball and the other friend of foe etc. But this should be corrected so none of these are called Cueball. Same should go for more than one Megan. But this is very rare, and I have only found one other than ''Art project'' and here only one Megan had any lines. The problem with different opinions on which Cueball is which came for the first time up with Megan in ''Art project'': The two Megan-like characters was first named (left to right) Megan and Danish. Then unidentified girl and Megan. Then Megan and unidentified girl, then two Megan like girls with short and long hair and finally you reverted it to my first change away from Danish to unidentified girl and Megan. (I can live with that as there is difference in hair length and behavior). But as far as I see it Cueball is not Rob as well as Megan should have continued to be called Cutie (but I would not like to change that now, as I have grown fond of Megan). But at the time the change was done I believe it was wrong. The same fondness for the name Cueball also makes me sure that no one else would wish to call him Rob, even if that is as much his name as Megan is Cuties... --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:57, 11 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
::My argument is that it is inertia and sentiment (&amp;quot;fond of Megan&amp;quot;) that prevents an objective, equal treatment here. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 22:47, 11 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
::Also, regarding the analogy made above to Danish.  I am fine with a nickname when Randall hasn't named a character.  So she was &amp;quot;unidentified girl&amp;quot; and then became &amp;quot;Danish&amp;quot;.  But, when we named her &amp;quot;Danish&amp;quot;, we went back to &amp;quot;Journal 1&amp;quot; and other places and renamed her.  My proposal is that we should go back through and rename &amp;quot;Cueball&amp;quot; as &amp;quot;Rob&amp;quot;.  Alternatively, we should reinstate &amp;quot;Cutie&amp;quot; for cases in which it is not clear that a character is &amp;quot;Megan&amp;quot; per se, but just Megan in her &amp;quot;everywoman&amp;quot; capacity. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 00:00, 12 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
I'm not sure how to post a poll, but I see the following options:&lt;br /&gt;
&lt;br /&gt;
1) Status quo: Cueball for all unidentified males without distinct characteristics (e.g. hats), Megan for all shoulder-length brunettes.  Rob only for named Cueballs.  Multiple Cueballs in a comic mean one is named Cueball and others get named &amp;quot;Friend&amp;quot;, etc.&lt;br /&gt;
&lt;br /&gt;
2) Symmetry 1: Cueball/Rob stays as is.  Unnamed brunettes get named &amp;quot;Cutie&amp;quot;.  &amp;quot;Megan&amp;quot; like &amp;quot;Rob&amp;quot; is reserved for comics in which a name is used.&lt;br /&gt;
&lt;br /&gt;
3) Symmetry 2: Megan stays as is.  Rob is the default for indistinct males.  &amp;quot;Cueball&amp;quot; page redirects to &amp;quot;Rob&amp;quot; (as &amp;quot;Cutie&amp;quot; now redirect to &amp;quot;Megan&amp;quot;).&lt;br /&gt;
&lt;br /&gt;
4) Expunge all Cueballs from multi-Cueball comics: Basically the status quo, except that in comics with multiple Cueballs none are named &amp;quot;Cueball&amp;quot; and are just all given names &amp;quot;Man 1&amp;quot;, &amp;quot;Man 2&amp;quot;, etc.&lt;br /&gt;
&lt;br /&gt;
I am ambivalent regarding options 2 or 3.  I could live with 1 if there is consensus for it, but I don't like it.  4 is a disaster in my mind and gains nothing. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 22:47, 11 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:We are probably the only one who reads these post...? But anyway as is clear I'm for 4. Which has been used several places already.´I can live with 1. I think 2 and 3 are disasters. Also it would be completely confusing for those who have used this page for many years. Why do you bring this up now? Is it because of the multiple Megan comics, or have you just signed up here, and dislike that it doesn't follow the rules you would have expected?--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:19, 12 March 2015 (UTC) &lt;br /&gt;
::I suggest instead that we create a category for multiple Cueballs, so it is easy to explain why the Cueball is not a specific character, and thus can never be Rob (except when it is clear from the text), or be expected to behave a certain way. And in reverse we make a Named Megan category so it is easy to find the few (three?) where she has been named. This by the way has nothing to do with the other suggestions, so I might just do that to get an overview. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:19, 12 March 2015 (UTC)&lt;br /&gt;
::: It seems more consistent to me to use [[Cutie]] for all unnamed &amp;quot;Megans&amp;quot; and reserve &amp;quot;Megan&amp;quot; for named comics. Thus, Rob is '''a''' Cueball and Megan is '''a''' Cutie. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 13:30, 13 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
::::I've read through some of your discussions (Here, Kynde's talk page, Art Project discussion), and thought I might put my thoughts forwards. Essentially we have three questions here:&lt;br /&gt;
::::1) Should we merge Cueball and Rob, and rename all Cueballs as Rob?&lt;br /&gt;
::::2) Should we rename all Megans as Cutie, except where she is explicitly named?&lt;br /&gt;
::::3) Once questions 1 &amp;amp; 2 are answered, what do we do where the 'same' character appears multiple times in one comic?&lt;br /&gt;
&lt;br /&gt;
::::*I understand the objective argument for renaming Cueball to Rob, however I'm unconvinced of the importance of being entirely objective, and I can't imagine Cueball being renamed to anything other than Cueball. &lt;br /&gt;
::::*I think its fairly clear where the Cueball label has come from, even if it might not be immediately obvious to some. Even if readers don't make the link between Cueball's head and a cue-ball, it is quite a generic label, which I think fits well with the transient every-man nature of Cueball's usage.&lt;br /&gt;
::::*There is something far more specific about the name Rob, which suggests that he is the same character every time. The origin of the name isn't obvious, which I think would be likely to cause confusion. &lt;br /&gt;
::::This brings me to conclude that for me, the answer to Q1 has to be that Cueball should stay as Cueball, unless explicitly named something else. &lt;br /&gt;
&lt;br /&gt;
::::The question of changing Megan to Cutie is one where I am less confident. Following the arguments I've made above, the outcome has to be that we rename to Cutie unless specifically named Megan, however I am not entirely convinced. The name Megan has a history, there are surely lots of people who now know her as Megan, what do we really stand to gain from all the work of changing to Cutie? I would also suggest that the name Cutie may not be accepted well by those with strong feminist views.&lt;br /&gt;
&lt;br /&gt;
::::As far as multi-character comics, I don't have time right now, but I will come back later and add my thoughts. Now that we've only got a few incomplete comics, we've had to resort to discussing renaming characters!--[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 15:07, 13 March 2015 (UTC)&lt;br /&gt;
:::::I agree with the reasons for keeping Cueball and Megan. And also that Cutie is such a loaded word, that it should never have been used anyway. This I did not immediately think about, but Cutie sounds like something from either a porn movie, or else a Bond Babe... Like the phrase from one of those movies: &amp;quot;Hello, I'm Plenty...&amp;quot; Then we should have to find a third name. And everyone here knows her as Megan. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 13:24, 15 March 2015 (UTC)&lt;br /&gt;
::::::I have created the [http://www.explainxkcd.com/wiki/index.php/Category:Multiple_Cueballs Category:Multiple Cueballs] to locate them and to show how often there are more than one. Feel free to add any I haven't found yet. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 09:45, 16 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
I think Rob is Black Hat's roommate and Megan's boyfriend/partner/husband (see above).  The &amp;quot;Cueball&amp;quot; in comics such as [[159: Boombox]] and [[542: Cover-Up]] should, in my view, be renamed &amp;quot;Rob&amp;quot;, even though he is not explicitly called that in those comics.  Most other &amp;quot;Cueball&amp;quot; comics can stay unchanged. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 00:43, 14 March 2015 (UTC)&lt;br /&gt;
:I have left my reason to disagree also with this on the two comics talk page. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 13:24, 15 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
In my opinion, it is quite clear that [[Randall]] has chosen to name the main male protagonist [[Rob]], for the few occasions where he needs characters to call upon each other, in the same way as he has chosen [[Megan]] for the main female protagonist. We should therefore try to overcome our nostalgia, follow Randall, and call the common male protagonist Rob. The problem with multiple cueballs can most often be resolved by identifying the protagonist, from the first-person narration or the general perspective. Thus, in [[525: I Know You're Listening]] Rob is the comic's &amp;quot;I&amp;quot;, to the left. In [[1110: Click and Drag]], Rob is obviously flying with a balloon. In [[610: Sheeple]] Rob is arguably the guy in the foreground facing us. Non-Rob &amp;quot;cueballs&amp;quot; we could refer to as &amp;quot;friend&amp;quot; &amp;quot;man&amp;quot;, etc. In this way roughly half of the &amp;quot;multiple cueballs&amp;quot; would be resolved. I think I can live with a few unclear cases, like [[220: Philosophy]]. [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 12:22, 19 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:A featureless character has been ''specifically'' named Rob in 9 comics, compared with 968 'Comics featuring Cueball'. I believe it is fundamentally flawed to assert that because a featureless character is named Rob in less than 1% of appearances, that all featureless characters should therefore be assumed to be Rob. As I've discussed above, I think that Rob strongly implies a specific person, whereas Cueball is a vague 'everyman' character. I feel it would be a huge error to change all Cueballs to Robs.--[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 17:37, 19 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
::The problem with that logic is that &amp;quot;Megan&amp;quot; is only named in a small number of comics (fewer that &amp;quot;Rob&amp;quot;).  So we should have a different name for an unnamed generic female.  [[Cutie]] is fine, but if people perceive that as sexist, then another name, maybe &amp;quot;Cuegirl&amp;quot; or &amp;quot;Brunette&amp;quot; would work.  (Side note: I doubt &amp;quot;Cutie&amp;quot; would be perceived as sexist and there's history there.)  What I '''do''' find sexist is the fact that there is asymmetry between male and female &amp;quot;everyperson&amp;quot;s.  In sum, I would say there is at less evidence to support naming Megan-everywoman &amp;quot;Megan&amp;quot; in all cases as there is to name Rob-everyman (here called &amp;quot;Cueball&amp;quot;) &amp;quot;Rob&amp;quot; in all cases.  Asymmetry here ignores the fact that Randall clearly intends his name to be &amp;quot;Rob&amp;quot; and also that we are using a proper name for everywoman but a contrived name for everyman, while creating an artificial distinction between Rob and Cueball and smearing out any possible distinction between Megan-everywoman and Megan-properName. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 13:18, 27 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:::As I put in my earlier comment (see above), I do agree that the logical conclusion is that Megan should no longer be named Megan, and should have an equivalent generic name. As an aside, I'm quite partial to your suggestion of Cuegirl. I disagree with your assertion that &amp;quot;Randall clearly intends his name to be Rob&amp;quot;, and I think that is the central point of this discussion. I don't believe that there is anywhere near enough evidence to assign a specific name to what I believe is a generic character. If we want to go for formal logic, consider the syllogism &amp;quot;Some non descipt characters are called Rob, there are many non-descript characters, therfore all non-descript characters are called Rob&amp;quot;. The conclusion simply does not follow. --[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 14:22, 27 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
::::Great, I vote for Cuegirl &amp;amp; Cueball :: Megan &amp;amp; Rob!  [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 01:31, 31 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
I agree with Djbrasier's and St.nerol's arguments, and I too feel that the arguments against dealing with this in an objective, symmetrical and logical way seem mostly based on nostalgia. Either we agree that a few named instances of the everywoman are sufficient to generalize to the (vastly more numerous) unnamed instances, and apply the same standard to the everyman, which is only consistent (and even more justified in the case of Rob since he is named in more comics than Megan), or we decide that the extrapolation is unjustified and we revert the Cutie--&amp;gt;Megan merge. The alternative --having double standards and deciding things based on historical baggage and emotional attachment rather than rationality-- makes no sense for followers of the comic that ''literally invented'' nerd-sniping!&lt;br /&gt;
&lt;br /&gt;
I'd also add that, as a non-native speaker, &amp;quot;cueball&amp;quot; doesn't ring any immediate bells unless the connection to cue balls is pointed out explicitly -- so actually Rob works even better as a generic name than Cueball. We have already [[#New character|agreed previously]] that clarity is better than cleverness when we named [[Hairy]], forgoing the less obvious alliteration &amp;quot;Harry&amp;quot;, so I vote we use the name Randall ''actually'' gave us, let go of our attachments to a creation he never endorsed, and honor our collective nerdiness by doing the logical thing: apply our standards uniformly and adopt Rob the same way we adopted Megan. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 06:09, 10 April 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:I've already put my thoughts forward above, so I won't repeat the same ground I've covered, other than to say I believe it would be a mistake to turn all Cueballs into Robs. While I will admit to having some nostalgia for the name Cueball, that isn't a major facet of my argument. I believe that any generic name is better than a specific name. Call them Stickboy &amp;amp; Stickgirl if you want! I know there are a fairly significant number of contributors and visitors who do not have English as their first language, but I don't believe that is a reason to choose a specific name, rather than a generic name, even if the origin of the latter isn't immediately obvious to all. It would be interesting to know whether each of us sees Cueball as always being the same person, or Cueball *is* Randall, or Cueball is just a changeable everyman.&lt;br /&gt;
&lt;br /&gt;
:To me, he is a changeable everyman, who I guess may represent or be based on: Randall, his friends, family or acquaintances, famous people, someone he saw in the street, or a completely made up character used to fill a specific role in the comic. The reason I argue againt merging Rob &amp;amp; Cueball is that the Cueball I see is this morphing and fluid character, and to use a specific name to tie him down to being the same character all the time runs completely counter to that. --[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 08:31, 10 April 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:: Understood, and sorry for mischaracterizing your argument (the nostalgia part does cloud the discussion though). I suppose I would be somewhat ambivalent to either have Rob+Megan, or Cueball+Cutie -- Cuegirl doesn't work because she has hair :) --, in the interests of reason and symmetry. But I lean slightly towards Rob+Megan because those are names Randall actually gave us, while anything else is our own invention and thus has no claim to legitimacy other than popular support.&lt;br /&gt;
:: Particularly, while I understand your concern about shoehorning the various personality traits the Cueballs show in different comics into a single persona, that doesn't seem to have been a problem for Megan -- not to mention real people ''are'' indeed complex and multi-faceted beings (or &amp;quot;morphing and fluid&amp;quot;, to use your terms) rather than one-dimensional caricatures. Heck, even Black Hat has his romantic side! :) So in light of that, I don't think we have to worry about ruining Cueball by naming him Rob -- if anything, that'd add more depth to him as a character! --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 16:35, 10 April 2015 (UTC)&lt;br /&gt;
:::I'm still very much against changing things here. Call it nostalgia, but there are many users who will never read these arguments, who one day comes back and cannot find Megan or Cueball, and will ask who the heck are Cuegirl/Cutie. I'm completely with Pudder on the problem with giving Cueball the name Rob. It just doesn't make sense. I agree that we have a inconsistency with Megan. But then everyone who uses this page a few times, becomes familiar with that name. However the main problem with all your great ideas is this. Who should correct the either 984 pages where Cueball is mentioned because he is a part of it (and all the other pages relevant to him or where he is exactly mentioned because he isn't part of the comic) and/or who should do the same for 487 comics (plus loose pages) for Megan. Unless those in favor for changing the names will do this, then the discussion is moot. It is already clearly stated in the relevant pages that these two characters are generic and that they have been named but a few times. So what more can we do unless someone is willing to use several days to change this back. I sincerely doubt you can keep the correct syntax if you just try a brute force replacement? There are so many interconnecting links etc. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 13:21, 25 April 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
I completely disagree with merging Cueball and Rob. Rob has [[276|Emily]] and [[632|Lisa]] as girlfriends, and Cueball has Megan. Rob also lives a more action-filled and stereotypical life compared to Cueball. --[[User:Youforgotthisthing|Youforgotthisthing]] ([[User talk:Youforgotthisthing|talk]]) 13:14, 15 April 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
I think the main stances here are clear:&lt;br /&gt;
* Keep as is&lt;br /&gt;
* Rename Cuball to Rob&lt;br /&gt;
* Change Megan back to Cutie/Cuegirl&lt;br /&gt;
Since keeping it status quo wouldn't change anything and is asymmetrical, I'll go over the others:&lt;br /&gt;
* Rename Cueball to Rob - Arguments:&lt;br /&gt;
** Randall gave him this name;&lt;br /&gt;
** It would offer symmetry to Megan;&lt;br /&gt;
** If the Cutie -&amp;gt; Megan logic is to be followed (as she was changed once named in the comics) then Cueball should be Rob;&lt;br /&gt;
** Even though cueball is a generic everyman name, Rob seems more like a name you could give anyone and would be more recognizable to non-native English speakers.&lt;br /&gt;
* Change Megan back to Cutie/Cuegirl - Arguments:&lt;br /&gt;
** It would cause symmetry again, letting her have an everywoman name;&lt;br /&gt;
** Nostalgia for Cueball;&lt;br /&gt;
** Megan is not always the same character, so she should not always have the name Megan&lt;br /&gt;
&lt;br /&gt;
I happen to agree with the idea of merging Cueball and Rob, but I'm not closed to the idea of Cutie/Cuegirl. The main problem is that these characters are typically interchangeable everymen/everywomen and there can be more than one in a comic. So another question is what we should do for multiple Cueballs/Robs. In my opinion, we should have all the comics with more than one depict them as Man 1, Man 2, etc. --[[User:Sensorfire|Sensorfire]] ([[User talk:Sensorfire|talk]]) 17:04, 20 May 2015 (UTC)&lt;br /&gt;
:Well I disagree. The users are used to refeer to these characters now by these names. It is also impractical to try to change them all. Megan is rarely twice in a comic. Maybe she is more the same like Black Hat is. But it is made clear that they are not the same in every comic in their pages. If there are muliple Cueballs but one is the main protagonist then he us cueball. If none can be singled out then Cueball like guy to the left/right can be used. I have done that for tbose cases I have found so far ([[:Category:Multiple_Cueballs|49 today]]).--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:58, 7 June 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
Well, somebody pointed out that the title text of [[1783: Emails]] suggests that the Cueball in the comic is most certainly not Rob, and calling the main comic character 'Man 1' as above would be silly. And on top of all this, 'Cueball' occurs so much we would probably need to take a regex to every explanation in [[:Category:Comics featuring Cueball]]. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 14:50, 9 January 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
Why hasn't anyone thought of the name &amp;quot;Hairball&amp;quot;? {{unsigned ip|172.68.189.187}}&lt;br /&gt;
:Please don't forget to sign your posts. And everybody should read this first: [[Characters]] and [[Rob]]. For short: Rob is a named Cueball. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 11:57, 15 June 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
== How to fit explanations of new classes of xkcd-related mysteries into the site: what-if, t-shirts, posters, special comics etc. ==&lt;br /&gt;
&lt;br /&gt;
I suggest that the [http://explainxkcd.com/wiki/index.php/explain_xkcd:About explain xkcd] page should explain how this site is laid out, and what sorts of things are explained here besides the online numbered xkcd comics that come out three times a week.&lt;br /&gt;
&lt;br /&gt;
For example, there is the [[A Smarter Planet]] series, and there are ideas for explaining some of the [http://what-if.xkcd.com/ What-If] series.  I'd like to add my explanation of the [https://gist.github.com/nealmcb/398af29a72f7b3efc202 XKCD Greek t-shirt, with mathematical, scientific and engineering uses for greek letters] and perhaps some other t-shirts, posters and the like.&lt;br /&gt;
&lt;br /&gt;
But I can't even figure out how to find non-numbered-comic-explanations, without going thru the entire [[Special:AllPages]] listing, which includes a huge set of unnumbered aliases as well as the numbered ones.  &lt;br /&gt;
&lt;br /&gt;
I've taken a stab towards that by editing the About page to point to some categories (and to start with a little overview), but since I'm just poking around, I might have missed some things.  [[User:Nealmcb|Nealmcb]] ([[User talk:Nealmcb|talk]]) 19:40, 23 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Link to &amp;quot;Special pages&amp;quot; on main page ==&lt;br /&gt;
&lt;br /&gt;
I think there should be a link to [[Special:SpecialPages]] on the main-page--[[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 11:55, 29 March 2015 (UTC)&lt;br /&gt;
:Special pages is a default feature in every mediawiki installation. It's also in the sidebar of every page, and it's not relevant to xkcd. Why does it merit space on the main page? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 18:56, 29 March 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Science comic ==&lt;br /&gt;
&lt;br /&gt;
Should the Science Magazine comic be added? http://m.sciencemag.org/content/342/6154/58.full [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 03:14, 4 April 2015 (UTC)&lt;br /&gt;
:I think that would be a great idea. Could there be other copyright rules when the comic has been published on Science? It there anyway to find out if Randall also has a link to it from (or has it on) xkcd? As he has done with the other [[:Category:Extra_Comics|Extra_Comics]]. And how do we create such a page, if there can be no link directly to xkcd (at the top of the comic)? --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 13:24, 30 April 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== &amp;quot;what if?&amp;quot; section? ==&lt;br /&gt;
&lt;br /&gt;
I would like to start a new &amp;quot;what if?&amp;quot; section explaining and discussing what if pages.--[[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 06:08, 8 April 2015 (UTC)&lt;br /&gt;
:Why does it need to exist? The main xkcd comic needs it, because Randall tends to be obtuse at times, but the what if articles are sourced and written out already. Supposedly, they're already explanations to questions sent in to Randall. Why do we need to explain explanations? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 06:29, 8 April 2015 (UTC)&lt;br /&gt;
::Explaining them indeed seems unnecessary, but we could certainly catalog and summarize them. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 16:38, 10 April 2015 (UTC)&lt;br /&gt;
::The images on what if? also have title texts that could further be explained, and we could organize what if pages by categories, as well as provide summaries. There are also subtle references, running gags, and in-jokes in What If? that should be explained.--[[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 08:44, 11 April 2015 (UTC)&lt;br /&gt;
::This https://what-if.xkcd.com/120/ is a example of a what if that could do with some explanations.--[[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 08:47, 11 April 2015 (UTC)&lt;br /&gt;
:::That's one of 135 what-ifs, and it's entirely self referential and can be figured out by reading the rest of the archive. The substance of the majority of pages is going to be incredibly thin, Randall doesn't tend to leave much for explanation. Comics that are simple one-shot images are our least used pages for good reason, and the what-if images pretty much all fall into that category, or are used to illustrate Randall's point that he makes in the immediately preceding paragraph. We could archive/catalog all the what-if pages and be a second archive button for the series, though there's a little less value to that than the archiving we did for [[Time]] and [[Externalities]] because there's already an archive along the same lines on the main site. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 19:14, 11 April 2015 (UTC)&lt;br /&gt;
::::I think the main value we could add is a summary (TL;DR style) of each entry, in a short Q&amp;amp;A format. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 12:13, 13 April 2015 (UTC)&lt;br /&gt;
If we are going forward with this, is there anyway to find the date in which the what if was first published?--[[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 09:01, 11 April 2015 (UTC)&lt;br /&gt;
:At the bottom of the page, there's an archive button. Click that. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 19:14, 11 April 2015 (UTC)&lt;br /&gt;
Well, fact is,  the [[what if?]] page is much, '''much''' larger now. [[User:Nk22|Nk22]] ([[User talk:Nk22|talk]]) 11:52, 20 April 2015 (UTC)&lt;br /&gt;
:Thank you, Nk22!  I've added a link from the [http://www.explainxkcd.com/wiki/index.php/explain_xkcd About explain xkcd] page. {{unsigned|Nealmcb}}&lt;br /&gt;
&lt;br /&gt;
== Userscript ==&lt;br /&gt;
&lt;br /&gt;
Hello there, just wrote a simple userscript that adds an 'Explain' button to the original xkcd.com&lt;br /&gt;
&lt;br /&gt;
https://gist.github.com/magazov/934de662d60c9fb5fea9&lt;br /&gt;
&lt;br /&gt;
You can run it via Greasemonkey, Tampermonkey and other similar plugins :)&lt;br /&gt;
&lt;br /&gt;
[[Image:Screen_Shot_xkcd_button.png]]&lt;br /&gt;
{{unsigned|Magazovski}}&lt;br /&gt;
&lt;br /&gt;
:Yeah, there's a few of these floating around. In the future, could you use an imgur link instead of uploading stuff like that to the wiki? Thanks. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 18:02, 21 April 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
::So maybe explainxkcd should host &amp;amp; maintain one of them? --[[User:Magazovski|Magazovski]] ([[User talk:Magazovski|talk]]) 09:30, 22 April 2015 (UTC)&lt;br /&gt;
:::Why would we host an image hosting site? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 23:17, 23 April 2015 (UTC)&lt;br /&gt;
::::He means we could host and maintain a userscript to help our fans get here from xkcd....  [[User:Nealmcb|Nealmcb]] ([[User talk:Nealmcb|talk]]) 14:36, 9 May 2015 (UTC)&lt;br /&gt;
:::::Hum, that's not a bad idea. I'll put it on the list of things to do. Although, if they're already here, why do they need a userscript to help them get here? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 00:34, 11 May 2015 (UTC)&lt;br /&gt;
::::::For people who mainly view the comics through the official site, but sometimes need an explanation of the comic. --[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 09:23, 11 May 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Updating the incomplete comic of the day ==&lt;br /&gt;
&lt;br /&gt;
Currently, I think the incomplete comic of the day should be changed more often (i.e. daily), since the incomplete comics are piling up, and most users aren't seeing the notice, as it is dismissible.--[[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 11:40, 22 April 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:While I agree that the comic of the day could be changed more often, I wouldn't say that the incomplete comics are ''piling up''. Over the months I've been active here, the number of incomplete comics had fallen considerably. In fact if you check the comics which are still marked as incomplete, most of them are one where a significant effort would be required to complete them. For example the large comics (Money, Time, Congress) or dynamic comics (Externalities, Click &amp;amp; Drag, Pixels). --[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 15:32, 23 April 2015 (UTC)&lt;br /&gt;
::Yeah. Of the 15 incomplete &amp;quot;pages,&amp;quot; only 10 of them are actual comics that need the attention, and the full count is still dropping. I've been keeping it on single comics as of late because the remaining actual incomplete comics have been cycled through ~3 times already, with no significant effort made on them, because they're such monumental pieces of work. Making the message dismissable is by design, we are a service first and foremost, we're not trying that hard to make visitors do our work for us. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 23:17, 23 April 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Infrequently recurring minor charachters ==&lt;br /&gt;
&lt;br /&gt;
Should we just group all of the characters that are not of enough significance to warrant their own character page into a single page (i.e. [[Other Minor Characters]])?  --{{User:17jiangz1/signature|02:58, 09 May 2015}}&lt;br /&gt;
:See comic [[1000]] for a sample of what this entails. Also, what value to we stand to provide by cataloging every unique character that has appeared in xkcd? Does it help us explain the comics any better? '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 11:32, 9 May 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Comic page creation ==&lt;br /&gt;
&lt;br /&gt;
Is comic page creation not automated? If it isn't, then [[Help talk:How to add a new comic explanation]] should be created.--{{User:17jiangz1/signature|14:19, 26 May 2015}} 14:19, 26 May 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Comic explanation was, at one point, automated. However, the bot ran on a schedule, and so sometimes there would be a few hours between a new comic being posted and the page getting created. Some editors just can't wait that long, so they do the bot's work before the bot even gets going. I agree that this page should be created and be kept up to date. Historically no one has read any of the help pages I've written. ;p [[User:Lcarsos|lcarsos]]&amp;lt;span title=&amp;quot;I'm an admin. I can help.&amp;quot;&amp;gt;_a&amp;lt;/span&amp;gt; ([[User talk:Lcarsos|talk]]) 17:42, 26 May 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:However, I think that the page should be [[Help:Comic Explanation Page Creation]]. [[User:Lcarsos|lcarsos]]&amp;lt;span title=&amp;quot;I'm an admin. I can help.&amp;quot;&amp;gt;_a&amp;lt;/span&amp;gt; ([[User talk:Lcarsos|talk]]) 17:43, 26 May 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Re-proposing merging Cueball and Rob ==&lt;br /&gt;
&lt;br /&gt;
Okay, so this was previously [[http://www.explainxkcd.com/wiki/index.php/explain_xkcd:Community_portal/Proposals#Merge_Cueball_.26_Rob discussed] but I felt that it was worth bringing up again. Really, at this point, there's no logical reason why the two should not be merged, or Megan and Cutie should be un-merged. Rob and Cueball clearly seem to be the same person, at least when cueball appears as a specific character. In the instances where there are multiple Cueballs, we should just refer to them as Man 1, Man 2, and so on. Can we get a vote or something this time? Yes, I understand that Cueball isn't always the same character. But neither is [[Megan]], and yet we always refer to the short black haired girl (formerly [[Cutie]]) as Megan. If that logic applies to her, it applies to Rob. It's pretty clear that Randall intended to name the character Rob, as most named Cueballs are named Rob and not Fred or something.&lt;br /&gt;
&lt;br /&gt;
In short: Please don't bring nostalgia into this, it's really not relevant. Changing Cueball to Rob or Megan back to Cutie (or Cuegirl?) would have symmetry and make sense. {{unsigned ip|Sensorfire}}&lt;br /&gt;
:I'm ok with dumping a marginal character page that only served to add confusion to character identification in new comics, but this was a subject of contention before so we probably need to see more of people's thoughts first. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 01:03, 5 September 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:I agree: let's list the arguments for both sides, ensure that everyone agrees with the objectiveness of that listing, and then vote. If there's support for this plan, and nobody does it first, I'll take a stab at producing a first draft of the summary. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 23:57, 14 September 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Randall is currently on a booktour. So, how about, instead of us (without the ability to read minds) arguing about his intention or who is/isn't the same character, someone go see him and ask? Then we'll know with absolute 100% certainty. [[User:WaltG123|WaltG123]] ([[User talk:WaltG123|talk]]) 04:49, 25 November 2015 (UTC)&lt;br /&gt;
::Randall never called either character Cueball and Cutie so of course this is not his names. Asking him would make no meaning at all. For any user of xkcd it will create lots of confusion to change the names of Megan and Cueball now. Regarding Rob he is already listed as Cueball in his category. And Cueballs have been called other names several times. Rob is just the only one that has been used a few times. I agree that it may have been wrong to call her Megan, (the name has been used like three times?) Similar it is just as wrong to call Black Hat's girlfriend [[Danish]], a nick name used once. But it is actually very nice to have a real name or at least useful name when speaking of characters. And it has also been mentioned that Cutie could be perused as a sexist name, so we should not move back to that. Well recently even [[Hairbun]] has her name changed from Hairbun girl since a user thought that was a problem given it most often was a grown woman.  So I think we should stick to the solution of the previous debate and leave Cueball, Rob and Megan alone as they are! --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:56, 29 June 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Adjective phrases ==&lt;br /&gt;
&lt;br /&gt;
Overwhelmed with the need to be picayune, I am compelled to point out that on the homepage there is the sentence that begins &amp;quot;There are a lot of comics that don't have set in stone explanations...&amp;quot; This sentence contains a adjective phrase which should be hyphenated thus: &amp;quot;set-in-stone&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Please pretend that I have said something witty here, as I am too tired to think of anything funny. {{unsigned|Gamewriter}}&lt;br /&gt;
:Is it actually grammatically wrong in it's current state? Huh. I guess I'll change it. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 20:42, 1 November 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
::This is long after the fact, but I'll throw my two cents in on Davidy22's question. Yes, it is wrong. If the 'set in stone' phrase were after the word explanations (&amp;quot;explanations set in stone&amp;quot;) it would not require hyphens, but used as an adjective before the noun (&amp;quot;set-in-stone explanations&amp;quot;) it requires them. D Miller [[Special:Contributions/108.162.221.41|108.162.221.41]] 18:26, 21 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Update MediaWiki ==&lt;br /&gt;
&lt;br /&gt;
You are currently using MediaWiki 1.19.17. It's ''really'' outdated. Maybe update to 1.26.2, the current recommended stable version? There is an [[mw:Manual:Upgrading|official guide]] for that. [[Special:Contributions/141.101.80.77|141.101.80.77]] 12:03, 24 January 2016 (UTC) (PS my IP address is wrong it's not what you think it is)&lt;br /&gt;
&lt;br /&gt;
== Rename Hair Bun Girl ==&lt;br /&gt;
&lt;br /&gt;
The character [[Hair Bun Girl]] was named in April 2015. There wasn't any discussion of the name at the time, so I'd like to open that discussion now please.&lt;br /&gt;
&lt;br /&gt;
At present we have several other characters named after distinctive visual features: [[Ponytail]], [[Black Hat]], [[White Hat]], [[Beret Guy]], and arguably [[Hairy]] and [[Cueball]]. In all but one of those cases, the name matches the distinctive feature itself, without the addition of &amp;quot;guy&amp;quot;, &amp;quot;girl&amp;quot;, etc. Given the number of comics that Beret Guy is in it's probably too late to modify his name, but it's not too late for Hair Bun Girl.&lt;br /&gt;
&lt;br /&gt;
Besides the consistency issue, there's also the inaccuracy of referring to a grown woman with the term &amp;quot;girl&amp;quot;, particularly when the character has been presented as older than [[Megan]]. I'd really like to fix this while her number of appearances is still manageable.&lt;br /&gt;
&lt;br /&gt;
The name &amp;quot;Hairbun&amp;quot; has been proposed and I think that matches really nicely with Ponytail in particular.&lt;br /&gt;
&lt;br /&gt;
[[User:Jkshapiro|Jkshapiro]] ([[User talk:Jkshapiro|talk]]) 04:23, 9 February 2016 (UTC)&lt;br /&gt;
:As the &amp;quot;guy&amp;quot; who created the Hair Bun Girl characther, I have no objection to changing the name. I did not think about the issue with girl/woman, probably because I'm not native English speaker. (And with the Beret Guy as an example). Jkshapiro was so kind as to [[User_talk:Kynde#Hair_Bun_.22Girl.22|ask my opinion]] before starting this discussion. At first I thought that ''Hairbun'' was a little weird, but then again so is Ponytail in this context. So I '''support''' the change to '''Hairbun'''! --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 13:06, 9 February 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
I vote '''change''' Hair Bun to Hairbun and '''keep''' girl. [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 21:02, 10 February 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
OK, I'm going ahead. [[User:Jkshapiro|Jkshapiro]] ([[User talk:Jkshapiro|talk]]) 02:47, 25 March 2016 (UTC)&lt;br /&gt;
:Well as I said I would not mind, but you cannot say you got any other to agree with you on this though. Mimek wished to keep girl... It will be a huge job to get all the instances correct, also be careful no to change those places where the talk is of a girl who has a hair bun. You cannot just change all placed with hair bun girl to Hairbun, in case is actually says the hair bun girl about a small girl who has a hair bun!  --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 09:59, 25 March 2016 (UTC)&lt;br /&gt;
::Seems no one cares, so I will remove the notes now. Great job Jkshapiro with changing the names. I like the new name now :-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:35, 2 April 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Mobile friendly website ==&lt;br /&gt;
&lt;br /&gt;
Can we get a mobile friendly version of the wiki?  If we already have one, what about forwarding the main site to it when viewed on a phone? [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 20:59, 10 February 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
Ditto. And/or an app. I would like to be able to keep track of which comics/explanations I have read. [[User:Calion|Calion]] ([[User talk:Calion|talk]]) 13:36, 31 July 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
== New categories ==&lt;br /&gt;
&lt;br /&gt;
I think there may be a need to propose a standard way to decide on categories: what new ones are needed, what are the prerequisites for creating a new category, how to maintain new categories and make sure they are actually used when they apply etc. For now I have gathered all previous discussions about new categories under this section. -- [[User:Malgond|Malgond]] ([[User talk:Malgond|talk]]) 13:39, 17 February 2016 (UTC)&lt;br /&gt;
:I think that whenever there are more than 4-5 comics that you wish to refer to in a given explanation because they are of the same topic as the current comic, then having a category is much to prefer rather than listing 5, 6 or 7 comics. I have made several categories for these instances, for instance for sport including the most used sports. At the time being I keep them up to date. One of the things this site does so well is giving you an easy way to find a specific comic even though you cannot remember the title of any precise quotes etc. If you just have an idea of what the topic was you might find it based on the categories. In this way I do not think we can have too many categories. As long as they describe a recurring subject. Only fault is that there seems to be no way to search for a comic based on more than one category? That would be great. In some cases even only 3 comics in a category can make sense. For instance I would be sorry to see this one go [[:Category:Puts on sunglasses]] (and I did not make it!) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 13:09, 19 February 2016 (UTC)&lt;br /&gt;
::For instance I have long wished for categories that covered all the space probe related comics, particularly all those referencing the Mars rovers. So today I made them with 16 and 9 comics in them already. [[:Category:Space probes]] [[:Category:Mars rovers]]. I hope people will generally think this was a great idea! :-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:42, 20 February 2016 (UTC)&lt;br /&gt;
:::And [[:Category:The Lion King]]... --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:47, 1 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
=== Category: Protip ===&lt;br /&gt;
&lt;br /&gt;
Anyone for adding ''Protip'' as a [[:Category:Comic series|Comic series]]. I have found five so far: [[653]], [[711]], [[1022]], [[1047]] and [[1156]]. (There are also a few comics with a protip title text.) -- [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 10:25, 4 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:I think that qualifies as a recurring topic (thus worthy of a category), but not as a series, where you can see a clear sequence. In fact, [[:Category:My Hobby|My Hobby]] has the same limitation, for what I suggest it to be removed from [[:Category:Comic series]]. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 11:42, 4 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
::Seconded. Looks general and common enough to be a category. '''[[User:Davidy22|&amp;lt;span title=&amp;quot;I want you.&amp;quot;&amp;gt;&amp;lt;u&amp;gt;&amp;lt;font color=&amp;quot;purple&amp;quot; size=&amp;quot;2px&amp;quot;&amp;gt;David&amp;lt;/font&amp;gt;&amp;lt;font color=&amp;quot;green&amp;quot; size=&amp;quot;3px&amp;quot;&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;sup&amp;gt;&amp;lt;font color=&amp;quot;indigo&amp;quot; size=&amp;quot;1px&amp;quot;&amp;gt;22&amp;lt;/font&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 14:57, 4 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:::Okay, great! Do you think that the ones with a &amp;quot;protip:&amp;quot; title text should be included? Besides, I think I might be the one responsiple for moving My Hobby from [[:Category:Comics by topic|Comics by topic]] to Comic series. I felt that all the My Hobby comics were about different topics, but maybe i've got to narrow an interpretation of the word &amp;quot;topic&amp;quot;. -- [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 15:31, 4 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:::: Can you link to the protip-in-title-text comics?&lt;br /&gt;
:::: As for My Hobby, note that categories aren't mutually exclusive. They can be in the &amp;quot;my hobby&amp;quot; topic, and each of them further categorized as appropriate: music, math, etc. Makes sense? --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 03:45, 5 January 2013 (UTC)&lt;br /&gt;
:::: I just searched for protip in the xkcd search bar. Here: [[1084]], [[427]]. And yes, makes sense. I've moved My Hobby back to &amp;quot;by topic&amp;quot;. -- [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 12:06, 5 January 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
=== Category: Sports ===&lt;br /&gt;
&lt;br /&gt;
How about creating a new &amp;quot;Sports&amp;quot; category?  [[User:Ekedolphin|Ekedolphin]] ([[User talk:Ekedolphin|talk]]) 15:31, 28 January 2013 (UTC)&lt;br /&gt;
:Well, maybe. Everyone aren't so keen on new categories here. Which comics are you thinking of, for a start? –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 20:32, 28 January 2013 (UTC)&lt;br /&gt;
::We definitely need to reach an agreement as a community on when to create new categories. Something simple like a minimum of 3 (or, say, 5) existing comics. Since we're already at the proposals' portal... what do you guys think about that? --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 21:44, 28 January 2013 (UTC)&lt;br /&gt;
:::My opinion:  Five would be enough to qualify.  [[User:Ekedolphin|Ekedolphin]] ([[User talk:Ekedolphin|talk]]) 09:31, 29 January 2013 (UTC)&lt;br /&gt;
::::I vote for four. But it should also be a reasonable thing to categorize, like sports, not like &amp;quot;sports with Cueball containing at least three anagram words&amp;quot;. Wich sholdn't be a problem. :) But the best name choice could be tricky sometimes. e.g. &amp;quot;Film &amp;amp; television&amp;quot;, Film &amp;amp; TV&amp;quot;, &amp;quot;Film&amp;quot;, &amp;quot;Films&amp;quot;, or &amp;quot;Movies&amp;quot;? –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 12:59, 29 January 2013 (UTC)&lt;br /&gt;
:::&lt;br /&gt;
::::Agreed, five should be enough to create the category without having to discuss it. - [[User:Cos|Cos]] ([[User talk:Cos|talk]]) 00:50, 26 February 2013 (UTC)&lt;br /&gt;
: OK, let's start with [[588: Pep Rally|588]], [[1092: Michael Phelps|1092]], [[904: Sports|904]] and [[1107: Sports Cheat Sheet|1107]].  Should be able to find a few more.  [[User:Ekedolphin|Ekedolphin]] ([[User talk:Ekedolphin|talk]]) 05:00, 29 January 2013 (UTC)&lt;br /&gt;
::Yeah, it's a broad subject so there are probably several more.  -[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 12:59, 29 January 2013 (UTC)&lt;br /&gt;
:::I found another one, sort of, in [[929:Speculation|929]] (although it hasn't been explained yet).  Should I get the ball rolling (no pun intended) on setting up the category?  Don't wanna do it unilaterally and get yelled at.  ;)  [[User:Ekedolphin|Ekedolphin]] ([[User talk:Ekedolphin|talk]]) 06:18, 30 January 2013 (UTC)&lt;br /&gt;
::::I think you should. On a wiki, getting stuck in discussions which die without a conclusion, to the point that motivated people give up without having done anything, is definitely counter-productive, and phrases like [[wikipedia:Wikipedia:Be bold|Wikipedia:Be bold]] are here to remind us of that. Seems like people agreed that you ''could'', and after a while nobody said that you ''shouldn't'', so I'd say do it. - [[User:Cos|Cos]] ([[User talk:Cos|talk]]) 00:50, 26 February 2013 (UTC)&lt;br /&gt;
:I did it without looking here first, because it was obvious there were many [[:Category:Sport|sport comics]]. I have even created four under categories (only one was there before, Chess). There are 10 comics at present that are related to other sports than the five under categories. And given the way Randall thinks about sport (not very much) he still has plenty of comics about the subject. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 07:33, 14 February 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
=== Category: Sex ===&lt;br /&gt;
&lt;br /&gt;
I think we should also create a Sex category.  There's no ''doubt'' we can find more than three examples.  I'll start looking for them and post the ones I find in here; again, I don't wanna create a large category by myself without community consent.  [[User:Ekedolphin|Ekedolphin]] ([[User talk:Ekedolphin|talk]]) 09:20, 2 February 2013 (UTC)&lt;br /&gt;
*OK, the ones for Category: Sex that I've found so far are [[443]], [[219]], [[550]], [[1026]], [[575]], [[468]], [[592]], [[320]], [[1101]], [[417]], [[713]], [[672]], [[230]], [[436]], [[940]], [[532]], [[649]], [[176]], [[1006]], [[596]] and [[717]], and I'm sure there are many more.  Should we create this category?  [[User:Ekedolphin|Ekedolphin]] ([[User talk:Ekedolphin|talk]]) 23:17, 3 February 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Same as [[#Category: Sports|above]], do it. Oh, already did; well, all the better. - [[User:Cos|Cos]] ([[User talk:Cos|talk]]) 00:53, 26 February 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
=== Category: Flowcharts ===&lt;br /&gt;
&lt;br /&gt;
Hello, the line &amp;quot;Randall has made use of flowcharts before.&amp;quot; in today's comic explanation made me want a [[:Category:Flowcharts|flowcharts category]] to navigate into...&lt;br /&gt;
&lt;br /&gt;
As it didn't exist, I proceeded to create it, but as the log says, [[User:lcarsos|lcarsos]] deleted such a category in November, saying ''&amp;quot;Insufficient differentiation from Category:Comics with charts, diluting the depth of comics tagged charts&amp;quot;''.&lt;br /&gt;
&lt;br /&gt;
I don't agree with that, and I think we could profit from such a subcategory. I found those pages fitting it:&lt;br /&gt;
* [[94: Profile Creation Flowchart]]&lt;br /&gt;
* [[210: 90's Flowchart]]&lt;br /&gt;
* [[488: Steal This Comic]]&lt;br /&gt;
* [[627: Tech Support Cheat Sheet]]&lt;br /&gt;
* [[844: Good Code]]&lt;br /&gt;
* [[851: Na]]&lt;br /&gt;
* [[854: Learning to Cook]]&lt;br /&gt;
* [[1195: Flowchart]]&lt;br /&gt;
&lt;br /&gt;
So? - [[User:Cos|Cos]] ([[User talk:Cos|talk]]) 10:59, 5 April 2013 (UTC)&lt;br /&gt;
:Weell if you're willing to take charge of the category and personally make sure it's added to all relevant comic explanations, go ahead. The usual objection to making new categories is that we admins can't remember all the categories when we're reviewing new explanations, but it's K if you're willing to take up that responsibility yourself. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 11:17, 5 April 2013 (UTC)&lt;br /&gt;
:&lt;br /&gt;
:: OK. I did it without waiting for further replies, because I think it will be especially profitable today (to viewers).&lt;br /&gt;
:: It doesn't seem a big issue to me if the correct category is not added when a new explanation is made: a passing editor will do it later on... But hey, I'm OK with taking special care of adding pages to this category.&lt;br /&gt;
:: [[User:Cos|Cos]] ([[User talk:Cos|talk]]) 12:28, 5 April 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
::: I just want to add that Cos' view is indeed the appropriate way to work in wikis: there is no concept of a single author for a page, category, or piece of text, and the workload is meant to be distributed among several editors: it is not necessary that any single editor remembers all existing categories, or knows the wiki markup by heart, or knows how to work with all the features of mediawiki, etc. The reason why wikis can be edited by anyone is precisely a recognition that there *will* be errors and any page can be improved somehow. That reasoning against categories should, IMO, be abandoned, or at most only kept as the opinion of some editors. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 22:00, 6 April 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
Isnt there a page which lists all the categories? If not, there should be one, and it should be accessible to all. Such a page could be useful when trying to quick-add categories to comics. [[Special:Contributions/117.194.83.155|117.194.83.155]] 13:43, 24 April 2013 (UTC)&lt;br /&gt;
:Yes, there is. [[Special:Categories]]. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 14:07, 24 April 2013 (UTC)&lt;br /&gt;
::Of course, there's a gazillion of 'em, over several pages, so I understand any reluctance to add new categories (having just suggested a new one myself which I feel is justified, but knowing that the upkeep needed may be the key point of contention so remaining philosophical about it).&lt;br /&gt;
::A solution perhaps to carry over from another locale that I frequent is to have a &amp;quot;Categories of Character&amp;quot; page, a &amp;quot;Categories of Object&amp;quot; one, perhaps &amp;quot;Categories of Event&amp;quot;, and a &amp;quot;Categories of Publication&amp;quot;.  For each new comic someone can easily check the shorter Character categories list against those present, the Object list against itemsin use, Events, etc, and of course the Publication one has the &amp;quot;Tuesday Comic&amp;quot;/equivalent, and other date-based ones (although isn't that automatic from templated creation?  ...never added a comic, but would imagine it is).  After that it's a trawl through the miscelania categories (perhaps a meta-category just for them?).  But, yeah, a lot of work to set up.  Wouldn't wish it on anyone who wasn't already willing to do it, and I remain an anon-IP person right now so can hardly commit ''myself'' as volunteer maintainer of this. [[Special:Contributions/178.98.31.27|178.98.31.27]] 17:20, 22 June 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
=== Category: (Barred/banned from?) Conferences ===&lt;br /&gt;
&lt;br /&gt;
I come here after realising I erroneously posted (in reply) to the Main page Talk, being anonymous (or at least IP-only) and without a list of qualifying articles to support me, just yet, but still wish to put forward the above category before I forget.  There's no apparent equivalent, that I found, but it's definitely a recurring meme.  I should be back (named or otherwise) with my suggested list of members, if someone else doesn't get there first, but I thought I'd start with the placemarker. [[Special:Contributions/178.98.31.27|178.98.31.27]] 16:41, 22 June 2013 (UTC)&lt;br /&gt;
:Ok, so I got the bee in my bonnet and spent a few minutes actually looking into this.  Revising &amp;quot;Barred from Conferences&amp;quot; (actually more often &amp;quot;Banned&amp;quot; or even &amp;quot;Thrown out of&amp;quot;/equivalent) to just &amp;quot;Conferences&amp;quot;, the subset of comics that I can easily find that are involved is *[[153]], *[[177]], *[[365]], *[[410]], *[[463]], *[[541]], [[545]], [[685]], [[829]] and [[867]], but I'm sure there are more recent ones that I didn't spot/recall.  One alternative title to &amp;quot;Conferences&amp;quot; is &amp;quot;Presentations&amp;quot;, and I'm sure if I'd searched for that I'd have found more potential candidates (less some that might ''exit'' the renamed category).  The asterisked ones ''do'' deal with being barred/banned/thrown out/etc, making it still a suitable category in its own right, IMO, but I'll leave it up to your combined musings to decide. [[Special:Contributions/178.98.31.27|178.98.31.27]] 17:07, 22 June 2013 (UTC)&lt;br /&gt;
::I add [[690]] to the list. --[[User:Chtz|Chtz]] ([[User talk:Chtz|talk]]) 08:12, 13 September 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
::: Great suggestions! I created [[:Category:Public speaking]] and [[:Category:Banned from conferences]]. I also added [[Wikipedian Protester]] to the mix, of course :) --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 21:59, 13 November 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
=== Category: Wishes ===&lt;br /&gt;
&lt;br /&gt;
[http://explainxkcd.com/1391/ Several] [http://explainxkcd.com/1086/ comics] [http://explainxkcd.com/wiki/index.php/152:_Hamster_Ball now] [http://xkcd.com/879/ exist] that talk about wishes - probably more. Should there be a category for this? [[User:Z|Z]] ([[User talk:Z|talk]]) 23:22, 7 July 2014 (UTC)&lt;br /&gt;
:Doesn't seem significant enough. If you promise to maintain the category you can make it yourself, although it will be cleared out if it gets neglected as new comics are released. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 15:20, 8 July 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
=== Category: Artificial Intelligence ===&lt;br /&gt;
&lt;br /&gt;
Hello world.&lt;br /&gt;
&lt;br /&gt;
There are a handful of comics involving Ai - [[1540]], [[1530]], [[1450]] and [[948]] for instance - and maybe it's an idea to give them their own category {{unsigned|Nk22}}&lt;br /&gt;
&lt;br /&gt;
:The usual objection to new categories is that they get abandoned and are too narrow for other people to think of picking them up. If you're going to own it and update it with new comics, you can make it. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 21:01, 23 June 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
=== Category: Size Comparisons ===&lt;br /&gt;
There are numerous comics comparing sizes of things.  I can't get a list right now, but off the top of my head, radiation dosages, money, today's comic, and space shuttles in horses. [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 19:23, 29 February 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
===Category: Katamari Damacy ===&lt;br /&gt;
&lt;br /&gt;
There are quite a few comics about this game. [[User:DPS2004|DPS2004]] ([[User talk:DPS2004|talk]])&lt;br /&gt;
&lt;br /&gt;
== Adding Ratings for Explanations ==&lt;br /&gt;
&lt;br /&gt;
I found [http://www.explainxkcd.com/wiki/index.php/1652 today's explanation] excellently written however that is not always the case.   Frequently explanations are walk through of the conversation that are too wordy without any succinct explanation of why or how a strip is funny -- while many of those low quality explanations are not strictly &amp;quot;incomplete&amp;quot; they could benefit from a careful rewrite.   I was wondering if we should add a rating tool such as &amp;quot; ''Was this explanation helpful? yes/no'' &amp;quot; so as to identify explanation that could benefit from improvement without having to be tagged as &amp;quot;incomplete&amp;quot;. [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 17:57, 8 March 2016 (UTC)&lt;br /&gt;
:We have a rather prominent discussion page for feedback, do we really need an additional add-on for this? I did a little research and found that other wikis use [https://www.mediawiki.org/wiki/Extension:Semantic_Rating semantic rating] and [https://www.mediawiki.org/wiki/Extension:ArticleRatings article ratings], which I can install if enough other users want it. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 05:54, 26 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== New Speculation Sections ==&lt;br /&gt;
&lt;br /&gt;
I often see a lot of speculation and conjecture within the explanation of the comic itself. I don't think it has any place in the explanation but I know many editors enjoy speculating and interpreting the comic and the meaning behind it so I've decided to start this discussion on whether we should provide a section where we can provide different speculations.&lt;br /&gt;
&lt;br /&gt;
What I am thinking would not be like the discussion page, where comments are made and discussed, but an edited and reviewed section which outlines different speculations and interpretations of the comics themselves and perhaps even the author's intent.&lt;br /&gt;
&lt;br /&gt;
Of course tone and presentation should be held to the same standards of the comic explanation but I think this would be a good way to better organize a review of the comic.&lt;br /&gt;
&lt;br /&gt;
I have been away too long to remember if there are any comic explanations with something like this so I have no idea how well it would work.&lt;br /&gt;
&lt;br /&gt;
As an example;&lt;br /&gt;
&lt;br /&gt;
This part from comic 1642: [[Gravitational Waves]]&lt;br /&gt;
&lt;br /&gt;
&amp;quot; It seems that Randall knew in advance about this announcement because this comic was published on a Thursday, not following the normal publish schedule, to coincide with the announcement &amp;quot;&lt;br /&gt;
&lt;br /&gt;
Is well supported, and rather likely correct, conjecture which belongs in the body of the explanation because not only is it backed by strong evidence but it provides background on the comic and the time in which the comic was released and aids in understanding the comic itself.&lt;br /&gt;
&lt;br /&gt;
However, this part from comic 478: [[The Staple Madness]]&lt;br /&gt;
&lt;br /&gt;
&amp;quot;From just reading the comic by itself, one may presume that in the last panel, Cueball has been stapled to the ceiling (as obvious evidence to Megan that Beret Guy has indeed been abusing her staple gun). According to the comic's official transcript, however, it is in fact God who is speaking.&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Is almost as equally well supported and certainly a valid interpretation of simply the comic. It is only refuted by the official transcript. I believe it is important to acknowledge and may even be a more humorous interpretation than the one which is provided by the official transcript.&lt;br /&gt;
&lt;br /&gt;
If we added a speculation section (or something of the sort) then we would have a place to talk about this interpretation more freely and expound upon it more.&lt;br /&gt;
&lt;br /&gt;
[[User:Lackadaisical|Lackadaisical]] ([[User talk:Lackadaisical|talk]]) 15:16, 13 May 2016 (UTC)&lt;br /&gt;
: Problem is the whole &amp;quot;explanation&amp;quot; is actually conjecture. None of us the author, we're all just guessing. [[User:Jkshapiro|Jkshapiro]] ([[User talk:Jkshapiro|talk]]) 15:23, 13 May 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
: Many of the current explanations are conjecture, that's true but not every explanation. Providing information on the science or mathematics behind a particular comic is not conjecture. Stating whether the author intended to belittle the field or state that one field is superior over another (unless fairly explicitly stated) is. And there are many things which can be inferred without being simple speculation. Not every comic would need a section like this, and not every comic needs a trivia section, and I'm not ready to start adding this proposed section myself. But I think it should be considered. [[User:Lackadaisical|Lackadaisical]] ([[User talk:Lackadaisical|talk]]) 15:35, 13 May 2016 (UTC)&lt;br /&gt;
::The intention of the discussion pages was to serve as a place for people to put their conjecture and reaching interpretations of the comics. They're presented alongside the explanation to make people's interpretations more readily visible. Some people may have trouble distinguishing an ungrounded interpretation of a comic from an explanation of it, and they will insert weak text into explanations. If you find something you disagree with, feel free to bring it up in the discussion section and edit it out of the explanation liberally '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 06:17, 17 May 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Unixkcd ==&lt;br /&gt;
&lt;br /&gt;
Hello everyone. I was just wondering: is there anything on http://uni.xkcd.com/. Because I was just looking and the only thing I found on Unixkcd is a mention of a bug in [[1350]]. There is not even a mention on the April fools article.&lt;br /&gt;
:There's nothing on this site, there's a couple of novel tidbits on the xkcd site that are at best tangentially related to the comic, as Randall originally intended to make xkcd.com his personal site for hosting his own projects. That particular one doesn't show up in any comics. Also, proposals might not be the best place to put this. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 08:46, 21 May 2016 (UTC)&lt;br /&gt;
::I added the unixckd information to [[721: Flatland]]. According to [https://vimeo.com/78912850 Randalls Øredev 2013 talk] unixkcd was the April Fools' prank for April 1st 2010. [[User:Condor70|Condor70]] ([[User talk:Condor70|talk]]) 09:00, 1 December 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
== New character category for blonde woman news reporter (from 1699) ==&lt;br /&gt;
&lt;br /&gt;
From today's comic [[1699: Local News]] I just got the idea that there may be needing a new category for either blonde woman and/or comics with news reports. I posted this [[Talk:1699:_Local_News#New_character_category|post]], in the talk page of that comic. Any comments, and if agreeing that there might be one or two different character categories needed then please suggest what they should be called. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:00, 27 June 2016 (UTC)&lt;br /&gt;
:Agree with Blondie as new character name and with adding a category for news reports. [[User:Jkshapiro|Jkshapiro]] ([[User talk:Jkshapiro|talk]]) 00:47, 28 June 2016 (UTC)&lt;br /&gt;
:Agree with new character category for Blondie --[[User:Lackadaisical|Lackadaisical]] ([[User talk:Lackadaisical|talk]]) 12:38, 28 June 2016 (UTC)&lt;br /&gt;
:: Thanks for the replies. Could be nice with a few more chipping in. One issue I just found is  [[Miss Lenhart]] and ambiguous situations like in comic [[59: Graduation]], where I would remove the miss reference. But then miss would be a sub category of Blondie (or Blonde? which Randall cals the girl in 59) as [[Rob]] is for [[Cueball]]... --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:07, 9 July 2016 (UTC)&lt;br /&gt;
:: I think blondie is fine for a name. Miss Lenhart is another character who uses a similar design so I think treating her like Rob is perfectly acceptable. The only thing more I think we should discuss is the role blondie plays in most of the comics (Like how cueball is an everyman, whitehat is often a strawman, Blackhat is blackhat etc.) [[User:Lackadaisical|Lackadaisical]] ([[User talk:Lackadaisical|talk]]) 12:04, 13 July 2016 (UTC)&lt;br /&gt;
:::There are also these two that looks like Blondie:  [[Mrs. Roberts]] or her daughter [[Elaine Roberts]]. I think this is part of why no one has made the category, as there are already three named women with the same hair. But there are so many other comics with this kind of woman, that I think she should be created. I hope I will get the time, but if anyone has any other ideas than just calling them &amp;quot;Blondie&amp;quot; and letting the other three be an subcategory like Rob is of Cueball then say so now before anyone creates Blondie. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:19, 24 August 2016 (UTC)&lt;br /&gt;
:::Agree with new character category and characters with the same appearance as sub-categories [[User:Lackadaisical|Lackadaisical]] ([[User talk:Lackadaisical|talk]]) 18:04, 24 August 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
Based on the discussion she is now called [[Blondie]] --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 07:27, 10 September 2016 (UTC)&lt;br /&gt;
&amp;lt;br&amp;gt;And now there is also a [[:Category:News anchor]] with 15 entries already. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:22, 10 September 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== fix a page ==&lt;br /&gt;
&lt;br /&gt;
The page Comics featuring Summer Glau is missing:&lt;br /&gt;
https://www.explainxkcd.com/wiki/index.php/526:_Converting_to_Metric {{unsigned ip|108.162.241.130}}&lt;br /&gt;
:Done. In the future, you can add categories yourself, just scroll to the bottom and follow the template the others go by. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 03:56, 7 July 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== New xkcd book out. ==&lt;br /&gt;
&lt;br /&gt;
Any chance of posting a section of explanation pages for the cartoons in the new xkcd book, hopefully explaining some of the cryptic red notes? Thanks! {{unsigned ip|199.27.133.102}}&lt;br /&gt;
&lt;br /&gt;
== Business Plan category ==&lt;br /&gt;
&lt;br /&gt;
I propose renaming [[:Category:Beret Guy's Business]] into Business Plans, and adding it to [[1721: Business Idea]] [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 08:15, 17 August 2016 (UTC)&lt;br /&gt;
::(Note I added a &amp;quot;:&amp;quot; to your category link to show the link instead of adding this page to the category. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:43, 10 September 2016 (UTC)) &lt;br /&gt;
:No of course not, that comic is about [[Cueball]]. This is Beret Guy's business we are talking about here. This category is not about business idea but about what [[Beret Guy]] does just like the page with [[:Category:Strange powers of Beret Guy]]. Both are used in the explanation of who he is. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:43, 10 September 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Comics with header text ==&lt;br /&gt;
&lt;br /&gt;
Several comic have some header text, such as [[851]] or [[1052]]. Shouldn't there be a category for them or something? I think it is quite a notable feature. [[User:Jaalenja|Jaalenja]] ([[User talk:Jaalenja|talk]]) 15:23, 16 September 2016 (UTC)&lt;br /&gt;
:I feel like it's not a particularly defining feature, it feels like making a category for comics that have frames with no borders or something, it's just a technique Randall uses. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 07:35, 21 September 2016 (UTC)&lt;br /&gt;
::To me it feels more like a second title text. It is not technically part of the comic itself, but is a separate piece of information included with it on the xkcd website. There is a category for comics without title text, this is the same, only reverse, in my humble opinion [[User:Jaalenja|Jaalenja]] ([[User talk:Jaalenja|talk]]) 07:13, 24 September 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== purpose of detailed transcripts ==&lt;br /&gt;
&lt;br /&gt;
There are two styles of comic descriptions in the transcripts. Some&lt;br /&gt;
are fairly terse, giving only the information required to understand&lt;br /&gt;
the comic (e.g. &amp;quot;Cueball is talking to Megan, who looks excited&amp;quot;).&lt;br /&gt;
Others give lots of graphic details, as if one should be able to&lt;br /&gt;
reconstruct the picture from the description (e.g. &amp;quot;Cueball, on the&lt;br /&gt;
left, is talking to Megan, on the right. His left hand is pointing to&lt;br /&gt;
her. Megan's arms are raised above her head and her excitement is&lt;br /&gt;
shown by short lines around her head...&amp;quot; and so on). The former style&lt;br /&gt;
used to be the norm, the latter has become increasingly&lt;br /&gt;
common in recent months.&lt;br /&gt;
&lt;br /&gt;
Being visually impaired, I am extremely pleased with the terse style&lt;br /&gt;
of transcript, and have no interest in the verbose style. To me it is&lt;br /&gt;
useless and sometimes fairly annoying. Of course, this is a community&lt;br /&gt;
and I can happily live with it if others find it useful.&lt;br /&gt;
&lt;br /&gt;
So, I'd like to know who needs detailed, graphical transcripts, and&lt;br /&gt;
for what purpose? Were they requested by some users, or did those&lt;br /&gt;
writing transcripts just decide to adopt this new style? If there is&lt;br /&gt;
a clearly identified reason for describing pictures in detail, fine.&lt;br /&gt;
If not, I vote for switching back to the old, terse style.&lt;br /&gt;
&lt;br /&gt;
Zetfr 14:10, 27 September 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Sorry we did not see this at the time. As we can see you finally found ears for you comment after [[1798]] and a new discussion has begun on  [[User_talk:Kynde#Transcript_TLDR.3B|my user page]]. (Should probably have been here?) But anyway I'm responsible for your problems, and I will try to write less in the transcript and add &amp;quot;other important&amp;quot; either below in the trivia or below the main comic (as maybe - Detailed image description...) It was meant as a way to search for any thing in the comic if you needed it. I guess most people do not read the transcript, so of course annoying if it is not useful for those who always need to read it. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 16:21, 17 February 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Rename Science Girl &amp;quot;Jill&amp;quot; ==&lt;br /&gt;
&lt;br /&gt;
Following the Precedent of &amp;quot;[[Megan]]&amp;quot; and &amp;quot;[[Danish]]&amp;quot; (but oddly enough not [[Rob]]), I propose that we rename [[Science Girl]] Jill, as per [[1662]]. This could serve to give her an easier name and to use in cases where the character doesn't have a connection with science but seems to be the same girl. [[User:Sensorfire|Sensorfire]] ([[User talk:Sensorfire|talk]]) 18:19, 26 October 2016 (UTC)&lt;br /&gt;
:The only time she's called Jill is in Jack and Jill comics (of course), and the only reason you'd want to do that is since [[Randall]] displays them similarly. In some cases Science Girl is even clearly older. We might do that if there was a [[Child-Blackhaired-Ponytail]] character, but these characters are always either Science Girl or Jill. Also, Jill has very, very few appearances anyway. [[User:Jacky720|Jacky720]] ([[User talk:Jacky720|talk]]) 21:37, 2 December 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Make an official transcript site ==&lt;br /&gt;
I've already taken the liberty of making {{template|transcript}}, and think we, together, can do better- which is why I'm implementing [https://jackm.000webhost.com/transcript.html this site], in order to display the official transcript in its intended format. However, it is bugged, and could do better if moved to explain xkcd. Is anyone in on this? [[User:Jacky720|Jacky720]] ([[User talk:Jacky720|talk]]) 21:36, 2 December 2016 (UTC)&lt;br /&gt;
:The transcript site doesn't seem to be accessible. Is the project dead? If it's not I can try to help. [[User:Errpell|Errpell]] ([[User talk:Errpell|talk]]) 21:06, 11 July 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
== HTTPS Links Back to XKCD Interfere with Random Button ==&lt;br /&gt;
&lt;br /&gt;
The Links back to the comics that are present just above the comic itself on the wiki pages (and adjacent to the next and previous links) provides an HTTPS link back to XKCD. However, this interferes with users who want to click that link, and then click `random` - because `c.xkcd.com` does NOT support HTTPS, and thus clicking 'random' after returning to xkcd from explainxkcd does not work. These links should be switched back to HTTP.&lt;br /&gt;
&lt;br /&gt;
--[[User:9000 volts|9000 volts]] ([[User talk:9000 volts|talk]]) 21:15, 13 December 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Rearrange for our visually impaired friends. ==&lt;br /&gt;
&lt;br /&gt;
I have a great friend who is blind and he uses this site to &amp;quot;read&amp;quot; XKCD so we can talk about it.  However, there are two things that he finds frustrating.  The first, while it means no harm and most readers gloss over it, when listening to the content of the page every day it can become demeaning to hear &amp;quot;it's because you're dumb&amp;quot; every time.  I certainly agree, I use explain XKCD because I am significantly dumb-er than Randall, but my friend uses it because he's blind.  This is not that big of a deal, but a friendly suggestion.&lt;br /&gt;
&lt;br /&gt;
The second suggestion is to move the transcript section to the top before the explanation so as not to spoil the content of the comic with user explanation right away--in the case that those listening to the article are in fact smart enough to get the joke before needing an explanation.&lt;br /&gt;
&lt;br /&gt;
Thanks for your consideration.&lt;br /&gt;
&lt;br /&gt;
== Incomplete in spotlight ==&lt;br /&gt;
&lt;br /&gt;
The incomplete comic in spotlight should be changed more often, the current one is not even incomplete. [[User:Dontknow|Dontknow]] ([[User talk:Dontknow|talk]]) 16:52, 31 March 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Duplicate Navigation tools at bottom of page (please!) ==&lt;br /&gt;
&lt;br /&gt;
I'm enjoying revisiting xkcd canon through the lens of Explain, but frustrated that after studiously reading through the explanation and discussion, I have to scroll back up to the top to get to the Next button.&lt;br /&gt;
What would the harm be in duplicating the buttons at the foot of each page? &lt;br /&gt;
Thanks for considering this.&lt;br /&gt;
Regards&lt;br /&gt;
&lt;br /&gt;
That would be nice, would help a lot. Also, please sign your comments with four tildes. [[User:Dontknow|Dontknow]] ([[User talk:Dontknow|talk]]) 19:46, 2 May 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
== JSON endpoint ==&lt;br /&gt;
There is a [http://www.xkcd.com/info.0.json endpoint] to retrieve information about the comics on the xkcd website. However the info there is not complete, specially when it comes to the transcripts. explainxkcd should provide a similar interface. It would be very useful specially for bots/scripts. The commmunity could help completing the information on the xkcd website and/or provide a new interface. The transcript are already retrieved from this website and a copy can be found [https://github.com/nhatzHK/randi/blob/master/json/xkcd.references.json here]. If there isn't already a complete file or databse with all the information, this file could help building it. However, this document has been compiled by scraping the html of explainxkcd, so there's some errors in it. These errors can be avoid with a clear and easy to access interface like JSON, similar to what is available on the xkcd website. [[User:Errpell|Errpell]] ([[User talk:Errpell|talk]]) 20:43, 11 July 2017 (UTC)&lt;br /&gt;
:Maybe there is a mediawiki addon to support a JSON file. Any ideas? --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 19:08, 1 August 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Suggestion for small improvement to interface ==&lt;br /&gt;
Am I the only one that wishes the Previous / Next buttons were repeated at the bottom of the page?  After reading the explanation, I often want to go to the next one in sequence.&lt;br /&gt;
(Obviously, I don't check this wiki every day :)&lt;br /&gt;
Scrolling back to the top isn't hard, but having the buttons near the bottom would make navigation easier.&lt;br /&gt;
&lt;br /&gt;
Hope you agree!&lt;br /&gt;
Murray in NJ&lt;br /&gt;
&lt;br /&gt;
PS: Aha! I see others have suggested the same thing :) {{unsigned ip|162.158.75.232}}&lt;br /&gt;
:This was also mentioned before. I don't agree because the layout is based on the original xkcd site. '''Protip''': Do not &amp;quot;scroll back&amp;quot;, just use your keyboard. The magic key is called &amp;quot;Home&amp;quot;. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 19:14, 1 August 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Category for The Little Prince? ==&lt;br /&gt;
&lt;br /&gt;
How many comics need to feature/mention a certain thing before we need a category?&lt;br /&gt;
&lt;br /&gt;
I think there are enough featuring the Little Prince to deserve a Category of its own.&lt;br /&gt;
&lt;br /&gt;
== mediawiki things ==&lt;br /&gt;
&lt;br /&gt;
could admin please update to the latest version of mediawiki and add the [https://www.mediawiki.org/wiki/Skin:Timeless?useskin=timeless timeless skin], thx. also would help if you added &amp;lt;code&amp;gt;line-height: 1.5em&amp;lt;/code&amp;gt; to the edit box (&amp;lt;code&amp;gt;#wpTextbox1&amp;lt;/code&amp;gt;) while making it taller to compensate, or added the 2010 code editor to aid readability. [[Special:Contributions/162.158.92.4|162.158.92.4]] 11:50, 4 January 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
== The state of &amp;quot;incomplete&amp;quot; explanations and an unified policy ==&lt;br /&gt;
&lt;br /&gt;
Hello, everybody. Recently I went through the &amp;quot;incomplete&amp;quot; explanations and I saw several problems... I think I better split this into sections.&lt;br /&gt;
&lt;br /&gt;
'''1) Many seemingly old and complete explanations are marked either with various creative variations of the auto-generated tag or something along the lines of &amp;quot;rough draft&amp;quot;.''' I have personally removed several incomplete tags during the last days, sometimes adding few information before doing so, but usually not. But there are so many of them and it just would not feel right to take it upon myself to reap them all, so, if anyone can spare a few minutes to quickly scan them and remove (or update, in some cases) the tags, it would be nice. Here is a list of explanations with this particular problem, for convenience: [[1874]], [[1906]], [[1908]], [[1912]], [[1915]], [[1919]], [[1925]], [[1926]], [[1929]], [[1930]], [[1937]]&lt;br /&gt;
&lt;br /&gt;
1940 and 1941 also seem complete IMO, but given how recent they are, they could be given some time.&lt;br /&gt;
&lt;br /&gt;
'''2) Some incomplete tags seem like abuse of the feature.''' [[1909]] is probably the best example of this. Table might be nice, but it is not necessary to explain the comic, it would be just &amp;quot;gilding&amp;quot;. There is nothing wrong about perfecting complete articles, but marking an article incomplete because someone got an idea how it could be done (and is too lazy to do it themselves) should be discouraged IMO. Other examples: [[1904]] - here I actually disagree with the proposal - why should information that does not represent percentages be represented using them? - but that's my personal view. [[1895]] - this one is asking for further perfection of a perfective information. [[1688]] - a '''huge''' example, asks for something that would require quite a lot of effort without helping anyone understand the comic, a cool project, but not needed for the article to be complete. [[1701]] - I really don't think this is necessary and the explanation is already twice the size I'd expect for such simple comic (*obligatory personal opinion disclaimer*).&lt;br /&gt;
&lt;br /&gt;
'''3) Some tags are just... vague.''' [[1856]] and [[1733]]. &amp;quot;Someone could maybe improve this&amp;quot; applies to pretty much everything in the universe, sorry.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''4) A policy proposal.''' Here comes the second half of the topic title. There appear to be two conflicting schools of thoughts among editors. Some seem to prefer long, meticulously detailed explanations. Others, including myself, prefer short and concise explanations. On more than one occasion, this has led to mess, so I think there should be some official policies about what kind of information should be considered considered necessary, useful, and superfluous. Obviously, every comic is different, and defining hard rules for this is impossible, so maybe &amp;quot;guideline&amp;quot; is a better word than &amp;quot;policy&amp;quot; here. Here are some suggestions about what this guideline could contain (please, take this as a &amp;quot;sub-suggestion&amp;quot;, if a guideline gets accepted, but will end up containing nothing out of this, I will still be happy):&lt;br /&gt;
&lt;br /&gt;
* NECESSARY: named people, groups, organizations, websites, works of art, geographic locations etc. should be briefly introduced, unless they can be presumed to be universally known (e.g. Google, Shakespeare, New York). Obscure words should be defined. Scientific and technical terms should be explained.&lt;br /&gt;
* SUPERFLUOUS: recursive explanations - an explanation that mentions concepts that themselves need explaining, but were not relevant to the comic itself.&lt;br /&gt;
&lt;br /&gt;
I guess that's it. Maybe a little disclaimer that I don't have much time now, so I may not be here to further lead this discussion. Maybe I should have waited with posting this when I do have time, but that may not be for a long time, so for what it's worth, here it is.&lt;br /&gt;
--[[User:Jaalenja|Jaalenja]] ([[User talk:Jaalenja|talk]]) 12:16, 13 January 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Your &amp;quot;policy (or guideline) proposal&amp;quot; is that what's widely excepted here. There are some overwhelming explanations and you are welcome to help on more precise writings. But in general there is no censorship here, less important content may be moved to a trivia section below the transcript. Irrelevant content (who decides that?) may be moved to the talk page with a given reason. I'm also a fan of &amp;quot;short and concise explanations&amp;quot; but who will judge what this really is? Further more I really dislike many of those tables, it's bad layout. But changing this takes a lot of work. [[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 13:51, 19 May 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
::The main reason why I want there to be an official policy is so the process of marking explanations as complete can be more straightforward. There would be a community-approved list of things an explanation needs to contain, if an explanation has all that, it is complete. Of course there would still be lot of room for interpretation because every comic is different and coming up with rules that fit all is impossible, but I believe this could still be a massive improvement over the current state.&lt;br /&gt;
::Also, '''please''', when I say something is merely a sub-suggestion, I mean it. Your reply gives me the feeling you understood my proposal as something along the lines of &amp;quot;We should make it an official policy that explanations should look like this:&amp;quot;, whereas it was more along the lines of &amp;quot;There should be an official policy about what explanations should contain. Here is an example of what such policy could maybe look like:&amp;quot; [[User:Jaalenja|Jaalenja]] ([[User talk:Jaalenja|talk]]) 06:49, 22 June 2018 (UTC)&lt;br /&gt;
:::In general I don't think this is a big issue. The vast majority (99%) of the comics is ''not'' marked as incomplete and those you are citing here should be discussed at the corresponding talk pages. Thus I don't see a ''massive improvement'' anyway.&lt;br /&gt;
:::However we can enhance the proper section at the [[explain xkcd:Editor FAQ|Editor FAQ]] by one or two concise sentences. But when you say ''&amp;quot;There should be...&amp;quot;'' nothing would happen; that's why I say: ''&amp;quot;We should make it&amp;quot;''. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 09:36, 23 June 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Tables vs bold text ==&lt;br /&gt;
&lt;br /&gt;
There are many, many, many comics with several things mentioned in the comic that need to be individually explained, and there are two ways we can do it, one being tables (for example: [[1930: Calendar Facts]]), the other being using bold text to separate paragraphs into sections (for example: [[1972: Autogyros]]). The thing is for the most cases, it seems like we should be using tables, but then using bold text to seperate paragraphs looks better, and is also easier... So when should we use tables, and when bold text? [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 12:20, 15 June 2018 (UTC)&lt;br /&gt;
:IMHO we have far too much tables - a structured floating text is much easier to read. Consider this:&lt;br /&gt;
:*A ''List of all planets in our solar'' system with a few columns for distance (in km, mi, and AU), size, and temperature. That's a classical table.&lt;br /&gt;
:*The table in [[1930: Calendar Facts]] contains far too much text in many cells. Try to read this on a smartphone. And furthermore on my ''Google Chrome for Android'' all the tables from this comic are not shown at all when using the ''Simplified View''.&lt;br /&gt;
:*Or compare this: [[1363: xkcd Phone]] and [[1549: xkcd Phone 3]]. I prefer the floating text and even more when I'm using a mobile device.&lt;br /&gt;
:But that's only my opinion.&lt;br /&gt;
:Nevertheless I'm also working on a real mobile version of this Wiki (similar to Wikipedia) and that will require some restrictions to the layout to get it properly rendered. But this will not happen before the FIFA World Cup 2018 is over ;) --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 13:17, 15 June 2018 (UTC)&lt;br /&gt;
::Agreed. Narrow columns with simple facts are ok, but longer text should not be put in a table. --[[User:SlashMe|SlashMe]] ([[User talk:SlashMe|talk]]) 10:15, 18 June 2018 (UTC)&lt;br /&gt;
::: I second this. [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 11:22, 27 August 2018 (UTC)&lt;br /&gt;
::::Please check also this new [[explain xkcd:Editor FAQ|Editor FAQ]] and the belonging talk page. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 13:04, 27 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Add the comic to the edit page ==&lt;br /&gt;
&lt;br /&gt;
While editing the explanation, it would be nice to be able to see the comic on that same page, especially for the transcript. (it's difficult for mobile editors to see two pages at once)&lt;br /&gt;
:Please sign your comments, and that’s not possible from what I know, considering how this website is set up. (I can still edit fine on mobile)  [[User:Netherin5|Netherin5]] ([[User talk:Netherin5|talk]]) 13:49, 15 March 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Dark theme/night mode ==&lt;br /&gt;
&lt;br /&gt;
Should I explain this?&lt;br /&gt;
&lt;br /&gt;
It's for all of us who edit the wiki at 1am and like our retinas.&lt;br /&gt;
&lt;br /&gt;
Firefox has a [https://addons.mozilla.org/en-US/firefox/addon/dark-theme-enhanced/?src=recommended Dark Theme Extension], and it looks pretty good on the Wiki. [https://chrome.google.com/webstore/detail/dark-theme-for-google-chr/annfbnbieaamhaimclajlajpijgkdblo Chrome does too], but I haven't tried it out.&lt;br /&gt;
&lt;br /&gt;
== Change dates to match ISO 8601. ==&lt;br /&gt;
&lt;br /&gt;
Can we change the timestamps to match [[1179: ISO 8601]]? I'm surprised this hasn't been suggested earlier [[User:9yz|9yz]] ([[User talk:9yz|talk]]) 20:33, 5 April 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Add bookmark ==&lt;br /&gt;
&lt;br /&gt;
I have used some simple javascript to create a bookmarklet that automatically opens the wiki-page of the xkcd page that you are reading. I would like to provide it on the wiki. It works as follows.&lt;br /&gt;
&lt;br /&gt;
1. Make a bookmark, give it a recognizable name.&lt;br /&gt;
2. For the url, enter the following: javascript: document.location = document.URL.replace('xkcd.com','explainxkcd.com');&lt;br /&gt;
3. Create the bookmark. To use it, open any xkcd page and click it to go to the corresponding wiki page.&lt;br /&gt;
&lt;br /&gt;
Thanks for considering.&lt;br /&gt;
[[User:Kwonunn|Kwonunn]] ([[User talk:Kwonunn|talk]]) 18:27, 3 May 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Regarding using facebook like and google captcha - Privacy concerns ==&lt;br /&gt;
&lt;br /&gt;
Considering that they track users across various sites, it is not in the best interests of the users' privacy. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
https://complianz.io/google-recaptcha-and-the-gdpr-a-possible-conflict/  - This article explains the issues better than I can. &lt;br /&gt;
&lt;br /&gt;
Especially the users who use VPNs affected more - it takes noticeably longer and more tries to pass the google captcha. Preventing/dis-incentivizing new contributors from behind a VPN. There is anecdotal evidence (in the form of reddit posts) that google captcha discriminates firefox users and allow chrome users to get simpler challenges or none at all. &lt;br /&gt;
&lt;br /&gt;
The Facebook like button is an iframe. Users visiting this page(s) have not explicitly consented to being tracked by facebook and google. &lt;br /&gt;
&lt;br /&gt;
I am speculating here, but from the amount of data these two items are gathering, it seems possible to de-anonymize the users who are behind a vpn. I don't trust either of these companies to not grab the free data. In the article listed above, it seems captcha alone can capture a screenshot of the pages without users' (explicit) consent. I haven't read through all the privacy and terms.  &lt;br /&gt;
&lt;br /&gt;
Captcha is necessary for avoiding spam. There are alternatives. Anything but google one should suffice. Regarding the facebook like button, I think that should be replaced by a link to the facebook page.&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:1652:_Conditionals&amp;diff=180805</id>
		<title>Talk:1652: Conditionals</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:1652:_Conditionals&amp;diff=180805"/>
				<updated>2019-10-03T03:20:13Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The title text... So he should both stop being pedantic in general and stop caring about conditionals in particular. What is it he does in the title text... the current explanation of that part is not clear to me. Is it completely clear who speaks which line in the title text...? --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 15:03, 7 March 2016 (UTC)&lt;br /&gt;
:It is fairly obvious that the line &amp;quot;If you're done being pedantic, we should get dinner,&amp;quot; is provided by Cueball's friend, as it is already established that Cueball was the one being pedantic about conditionals in the first place. [[Special:Contributions/108.162.216.12|108.162.216.12]] 15:15, 7 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
To me the word &amp;quot;Conditionals&amp;quot; is clearly in the grammatical sense. Computer programming was invented literally centuries after the grammatical meaning, and the joke would have been as meaningful 3000 years ago as it is today. [[Special:Contributions/108.162.221.13|108.162.221.13]] 15:17, 7 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
The particular kind of conditional that Cueball's friend is using is called a &amp;quot;biscuit conditional,&amp;quot; after the example &amp;quot;There are biscuits in the sideboard if you want some&amp;quot; (from the philosopher J.L. Austin). There's a bit of discussion of them at [http://languagelog.ldc.upenn.edu/nll/?p=1469 Language Log]--Cueball is doing what Sam C talks about in the first comment, deliberately misunderstanding the conditional. The characteristic of these conditionals is that the truth of the consequent doesn't depend on the truth of the antecedent (the &amp;quot;if&amp;quot; clause), but the consequent isn't relevant if the antecedent isn't true--if Cueball didn't want to hang out, it wouldn't matter that his friend was in the city.&lt;br /&gt;
In the title text, Cueball thinks that his friend is uttering another biscuit conditional, and that just saying that they should get dinner. But the truth of the consequent really is dependent on the truth of the antecedent--if Cueball isn't done being pedantic his friend doesn't want to get dinner. So I think it is accurate to say &amp;quot;The intent is to show that because the initiator still believes that Cueball is still being pedantic, then he believes that it is not a good idea to have dinner together,&amp;quot; though maybe it could be expressed more clearly. [[Special:Contributions/162.158.60.23|162.158.60.23]] 15:57, 7 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
Didn't Demitri Martin do this joke like 10 years ago? :P [[Special:Contributions/108.162.221.63|108.162.221.63]] 18:11, 7 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
Whenever there is something like this that annoys me and I find out it has a name (like relevance conditional), it stops bothering me. [[User:HisHighestMinion|HisHighestMinion]] ([[User talk:HisHighestMinion|talk]]) 20:20, 7 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
The one that always bugs me is the Steven Universe intro song:&lt;br /&gt;
&lt;br /&gt;
    ''We are the Crystal Gems&lt;br /&gt;
    ''We'll always save the day,&lt;br /&gt;
    ''and if you think we can't&lt;br /&gt;
    ''We'll always find a way.&lt;br /&gt;
&lt;br /&gt;
Something about the &amp;quot;if&amp;quot; being at the beginning of the biscuit clause throws me. What if I think they can save the day? Then there's no guarantee that they will! But if I AM always thinking that they can't save the day, then they will ALWAYS find a way. Therefore I think they will always find a way. It's so circular![[User:NotLock|NotLock]] ([[User talk:NotLock|talk]]) 20:28, 7 March 2016 (UTC)&lt;br /&gt;
:By the way... {{w|Steven Universe}} was references twice in [[1608: Hoverboard]], [http://www.explainxkcd.com/wiki/images/3/39/1608_1031x1095y_Steven_Universe_family_and_ice_cream_prediction.png first the family with a &amp;quot;gem&amp;quot;] (to the right of course) and then [http://www.explainxkcd.com/wiki/images/f/fa/1608_1077x1109y_Darth_Vaders_talks_about_Steven_Universe_on_the_bridge_Megan_adjust_antenna.png Vader himself talks about them], both inside the Destroyer. I never hear of the show before experiencing the Hoverboard comic, but since I have seen part of an episode and now this comment ;-) You learn so much from reading xkcd. But I'm not sure most of it is useful. But almost always funny. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:29, 7 March 2016 (UTC)&lt;br /&gt;
:: &amp;quot;You learn so much from reading xkcd. But I'm not sure most of it is useful. But almost always funny.&amp;quot; This should be on a banner at the top of explainxckd. [[Special:Contributions/162.158.255.162|162.158.255.162]] 00:49, 8 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
The title text (you did it again - no I didn't) hearkens back to [[725: Literally]] [[Special:Contributions/108.162.216.58|108.162.216.58]] 21:14, 7 March 2016 (UTC)&lt;br /&gt;
:Thanks for the ref. I have included this in the explanation. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 23:10, 7 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
So I read the caption as &amp;quot;WHEN I try not to be pedantic about conditionals&amp;quot; and was thinking that it was about &amp;quot;if/only if&amp;quot; directionality. ;-) {{unsigned ip|173.245.54.16}}&lt;br /&gt;
&lt;br /&gt;
The relevance-conditional that always gets me is &amp;quot;If you're interested in buying something, my name is X&amp;quot;.  Always makes me think, &amp;quot;And what is your name if I'm just looking?&amp;quot; [[User:KieferSkunk|KieferSkunk]] ([[User talk:KieferSkunk|talk]]) 01:27, 8 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
:If you're interested in buying something, I'm Joe. If you're just a lookie-loo, call me Chuck. That way, at the end of the month, Chuck has a lower close ratio than me, and I get the bonus. :P --[[Special:Contributions/162.158.255.82|162.158.255.82]] 11:04, 11 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Thank you! ==&lt;br /&gt;
&lt;br /&gt;
It's amazing how much you can learn about things you thought you already knew. Explainxkcd is so much more than xkcd! [[User:Mumiemonstret|Mumiemonstret]] ([[User talk:Mumiemonstret|talk]]) 22:03, 7 March 2016 (UTC)&lt;br /&gt;
:Yes thanks to those who made today's explanation. This was outside my English capabilities, and I really needed others to explain! :-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:24, 7 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
+1! This is one of the best (clearest, succinct, well written) explanations on this site. Kudos to all who participated. [[Special:Contributions/108.162.221.40|108.162.221.40]] 14:38, 8 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
+1 -- [http://www.explainxkcd.com/wiki/index.php/explain_xkcd:Community_portal/Proposals#Adding_Ratings_for_Explanations Add you comment here] if you think that every explanation should be this well written [[Special:Contributions/162.158.253.6|162.158.253.6]] 23:05, 9 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
Is this another case of [[1650:_Baby#Small_talk_category|small talk]] problems just mentioned after the release of [[1650: Baby]]? Maybe there should be a category (see link for more)...--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 23:10, 7 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
;Philosophy&lt;br /&gt;
&lt;br /&gt;
There are some underlying elements of solipsism here. If the other person is hanging out with Clueball, she actually exists. But if that other person is not present, does she exist? &amp;quot;Where will you be&amp;quot; means that the other person existence becomes unsure, at least from Clueball's point of view.&lt;br /&gt;
&lt;br /&gt;
As an off topic, it would be interesting to see what modern solipsism supporters have to say about the usage of cell phone communications. If one were to spend all day alone say in a forest and talked to a bunch of people over cell phone for the whole day, what would that say about the existence of others outside the forest? Would other's existence still be unsure? Is talking to someone via a mechanical device validating or invalidating of their actual existence?&lt;br /&gt;
[[User:Ralfoide|Ralfoide]] ([[User talk:Ralfoide|talk]]) 16:29, 8 March 2016 (UTC)&lt;br /&gt;
:For them hard solipsists it is irrelevant if they experience another being face-to-face or over the phone. They cannot be sure the other person, the phone, and the surrounding woods, really exist. Both living and dead matter are experienced through unreliable senses. For us soft solipsists, it is also irrelevant if we talk to someone over the phone or face-to-face. We still can't know for sure if the other person have a mind, have consciousness (like I do), or if it is just a mindless animal, a robot (albeit with functional repertoire of feelings and ability to learn skills). [[Special:Contributions/141.101.80.33|141.101.80.33]] 01:35, 17 September 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
The issue I have with this comic is that there isn't anything wrong with saying I'll be in the city tomorrow if you want to hang out. It's logically equivalent to (you want to hang out tomorrow) -&amp;gt; (I'll be in the city) which isn't equivalent to (you don't want to hang out tomorrow) -&amp;gt; (I won't be in the city). In fact the only other logical inference that can be made from this statement is (I won't be in the city) -&amp;gt; (you don't want to hang out tomorrow), or in English, if I'm not in the city tomorrow, you didn't want to hang out. The person can be in the city tomorrow in either case. {{unsigned ip|162.158.255.113}}&lt;br /&gt;
&lt;br /&gt;
:Yes, but as a logical conditional, if Randall is going to be busy tomorrow, he's learned nothing about his friend's location--which is why he asks. --[[Special:Contributions/162.158.255.82|162.158.255.82]] 11:04, 11 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is it just me, or did Randall mis-spell IFF? {{unsigned ip|162.158.176.77}}&lt;br /&gt;
&lt;br /&gt;
The title text here, and in [[725: Literally]], may also reference Monty Python's [https://www.youtube.com/watch?v=yTl9zYS3_dc 'Argument Clinic' sketch].[[User:These Are Not The Comments You Are Looking For|These Are Not The Comments You Are Looking For]] ([[User talk:These Are Not The Comments You Are Looking For|talk]]) 03:13, 12 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
This made me think of the &amp;quot;Drinker paradox&amp;quot; [[Special:Contributions/108.162.238.221|108.162.238.221]] 03:20, 3 October 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:994:_Advent_Calendar&amp;diff=179909</id>
		<title>Talk:994: Advent Calendar</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:994:_Advent_Calendar&amp;diff=179909"/>
				<updated>2019-09-15T14:10:13Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;To me this is a lesson in moderation, too much chocolate is not only a problem on x-mas, but also on Halloween. If we don't learn moderation, we will wake up on 25th with huge belly and type-1 diabetes. Enjoy responsibly (which is true for every good thing and state altering drugs). - e-inspired [[Special:Contributions/98.211.199.84|98.211.199.84]] 15:42, 27 February 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
I'll have you know that type 1 diabetes has nothing to do with sugar overdose, since it's mostly an autoimmune disease. Type 2 diabetes is the fatty's version, whose only connection to type 1 is the symptoms (and sometimes the treatment)&lt;br /&gt;
[[Special:Contributions/141.101.98.212|141.101.98.212]] 05:42, 20 January 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
I'm glad that isn't what this is for me. [[Special:Contributions/81.135.136.159|81.135.136.159]] 10:42, 9 October 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
I think the humor is too about the way most people find difficult to wait for the next day before eating the chocolate...--[[Special:Contributions/141.101.89.203|141.101.89.203]] 14:49, 7 April 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Advent then is the opposite of lent, when one gives up, say, chocolate {{unsigned ip|173.245.54.167}}&lt;br /&gt;
&lt;br /&gt;
AAAHH!!  Stop being an idiot!  Type 1 diabetes... what they said.  I have type 1!!  Stop accusing me of making myself diabetic!!! {{unsigned ip|173.245.55.73}}&lt;br /&gt;
&lt;br /&gt;
I don't get why people think Zeno's paradox is interesting as it relies on the stupid notion that objects somehow move by halving the distance between one and the other rather than moving in discrete amounts of distance over time. I hope Zeno got punched for being so dumb at least once in his lifetime. -Pennpenn [[Special:Contributions/108.162.250.162|108.162.250.162]] 05:10, 12 January 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
It's interesting because it's not really a paradox.  Of course they knew that the runner will get to his destination in finite time.  The whole point was that it's absurd to claim otherwise.  The reason it gets repeated so often is that, any philosophical arguments aside, it's a good story to explain that an infinite sum has a finite solution.  Sigma(n=0-&amp;gt;inf,1/(2^n))=2. 15:30, 29 October 2018 (UTC) {{unsigned ip|172.68.189.19}}&lt;br /&gt;
&lt;br /&gt;
Makes me think of Thomson's Lamp. [[Special:Contributions/108.162.238.221|108.162.238.221]] 14:10, 15 September 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2101:_Technical_Analysis&amp;diff=168551</id>
		<title>2101: Technical Analysis</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2101:_Technical_Analysis&amp;diff=168551"/>
				<updated>2019-01-24T19:21:18Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: /* Explanation */ Added link to Net Present Value Wikipedia article to the sentence about the theoretical value of a stock.&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2101&lt;br /&gt;
| date      = January 21, 2019&lt;br /&gt;
| title     = Technical Analysis&lt;br /&gt;
| image     = technical_analysis.png&lt;br /&gt;
| titletext = &amp;quot;I [suspect] that we are throwing more and more of our resources, including the cream of our youth, into financial activities remote from the production of goods and services, into activities that generate high private rewards disproportionate to their social productivity. I suspect that the immense power of the computer is being harnessed to this 'paper economy', not to do the same transactions more economically but to balloon the quantity and variety of financial exchanges.&amp;quot; --James Tobin, July 1984&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete| Comic is still undergoing TECHNICAL ANALYSIS (this is just the prologue). Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
There are two recognized methods to attempt to predict the stock market, each with its own pros and cons:&lt;br /&gt;
&lt;br /&gt;
*{{w|Technical analysis}} is more appropriate for traders seeking to benefit off short-term fluctuations in stock prices, by attempting to look for trends, momentum, patterns etc. in the stock prices.&lt;br /&gt;
*{{w|Fundamental analysis}} is more appropriate for investors seeking to benefit off long-term fluctuations in stock prices, by attempting to guess future earnings based on some fundamental factor about the stock. Investors can choose to look for good Price/Earnings ratio or other indications that a stock may be a solid investment.&lt;br /&gt;
&lt;br /&gt;
[http://www.investopedia.com/terms/r/randomwalktheory.asp Random Walk theory] suggests that neither of these methods are particularly useful at predicting the future of the stock market (see link for a funny story about dart throwing monkeys).&lt;br /&gt;
&lt;br /&gt;
The theoretical value of a stock is it's [https://en.wikipedia.org/wiki/Net_present_value net present value] which is the sum of all its future earnings, with earnings in the future discounted appropriately to account for the {{w|time value of money}}. Because these earnings are never fully predictable, traders may have different ideas about the true value of a stock, and buy the stock if they believe the currently offered prices are particularly low, or sell it when the prices are high.&lt;br /&gt;
&lt;br /&gt;
Technical analysis, however, does not even attempt to understand the earnings of the stock, instead focusing on the shapes and patterns that result from traders making their moves. While there is a human behavioral component to stock trading, it is not clear that one can extract much information from the shapes of stock charts. To the extent it does work, a substantial part of its success may be simply an artifact of the herd behavior of traders who engage in technical analysis, a zero-sum game.&lt;br /&gt;
&lt;br /&gt;
The comic displays a {{w|Candlestick chart|stock price chart}}, annotated with labels which purport to be technical analysis. These labels are nonsense from the perspective of technical analysis, but do accurately describe the graph itself: &amp;quot;{{w|allegro}}&amp;quot; (a musical term used to set the tempo at the beginning of a score), &amp;quot;{{w|prologue}}&amp;quot; (an introductory section of a play, book, or similar), &amp;quot;{{w|lumbar}} support&amp;quot; (the thing in a chair shaped to better support your back), &amp;quot;bathtub&amp;quot; (possibly a reference to the so-called &amp;quot;{{w|Bathtub curve}}&amp;quot;), &amp;quot;{{w|uptalk}}&amp;quot; (a speech pattern). One label celebrates that &amp;quot;these two points define a line! Promising signal.&amp;quot; (In geometry, any two points define a line.)&lt;br /&gt;
&lt;br /&gt;
The shape of the chart is similar to the exponential behavior of cryptocurrencies when they are successful, where price (positional height on the chart) roughly increases while volatility (height of the bars or candles themselves, and of the peaks and troughs, on the chart) does the same.  Technical analysis used to be an esoteric domain held by well-paid stock analysts, but as cryptocurrency has spread and taken down the many barriers to engaging in investment trading, people from all walks of life have begun staring at charts like this.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|+Graph labels and possible meanings&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Allegro_(music)|Allegro}}&lt;br /&gt;
|Tempo notation in music: played quickly and brightly (translation from Italian: cheerful, lively) - a series of very small changes in this region of the graph might suggest notes played quickly&lt;br /&gt;
|-&lt;br /&gt;
|Prologue&lt;br /&gt;
|A prologue is an introduction to a book or other work; this presumably refers to the initial period of minimal growth which is moving toward a much more active period&lt;br /&gt;
|-&lt;br /&gt;
|Decline&lt;br /&gt;
|Describes a negative trend&lt;br /&gt;
|-&lt;br /&gt;
|Doldrums&lt;br /&gt;
|A stagnant section of the graph with little movement&lt;br /&gt;
|-&lt;br /&gt;
|Spline&lt;br /&gt;
|A {{w|Spline (mathematics)|spline}} is a mathematical means of generating a smooth curve, referring to the smoothed curve shown here&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Lumbar}} Support&lt;br /&gt;
|A cushion or other device that provides support to the lower part of the ''spine'', a play on the preceding ''spline''&lt;br /&gt;
|-&lt;br /&gt;
|Renewal&lt;br /&gt;
|Strong upward trend; also might suggest the growth of green bars, like greening up in the spring&lt;br /&gt;
|-&lt;br /&gt;
|Hmm!&lt;br /&gt;
|The three circles this label points to mark periods of growth that immediately preceded a decline. Ideally for someone performing a technical analysis, if such occurrences can be foreseen accurately it would be a major boon for the stockholder, as they could be tipped to sell it right away before the price drops and net a cash profit. &lt;br /&gt;
|-&lt;br /&gt;
|Hark! The cliffs!&lt;br /&gt;
|A long bar suggesting a steep cliff&lt;br /&gt;
|-&lt;br /&gt;
|Declination&lt;br /&gt;
|A term which sounds similar to decline, but actually refers to the angular distance of a point from one of the poles. The declination of magnetic north is used to correct the difference between true and magnetic north.&lt;br /&gt;
|-&lt;br /&gt;
|Inflection&lt;br /&gt;
|A point at which the slope of a graph changes from an increasing slope (getting steeper) to a decreasing slope (getting less steep).&lt;br /&gt;
|-&lt;br /&gt;
|Uptalk&lt;br /&gt;
|A pattern of speech in which each sentence ends with rising inflection? like a question? A play on &amp;quot;uptick&amp;quot;, and also on the second meaning of &amp;quot;inflection&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
|Bathtub&lt;br /&gt;
|possibly a reference to the so-called &amp;quot;{{w|Bathtub curve}}&amp;quot;, also, the shape is similar to that of a bathtub, and is drawn containing water.&lt;br /&gt;
|-&lt;br /&gt;
|These two points define a line! Promising signal.&lt;br /&gt;
|In geometry, any two points define a line; also looks somewhat like a communication line between two towers.  It is tempting when looking at market charts to draw imaginary lines that connect the extrema and hope it means something about the future. The drawn line in this case also just so happens to ignore the many periods of decline marked under &amp;quot;Declination&amp;quot; -- in this case it did eventually recover, but later labels (such as &amp;quot;likely to continue forever&amp;quot; at the end) suggest that this is more likely a case where blind optimism just so happens to have been right for those two particular points (as opposed to the many more possible pairs of points where the line wouldn't be so positive). &lt;br /&gt;
|-&lt;br /&gt;
|Yikes&lt;br /&gt;
|This section of the chart refers to the actual use of a candlestick chart, which is to document the difference between the opening and closing value of a stock. A long red bar shows that a stock closed at a much lower value than it opened at, which would be disastrous for someone trading that stock.&lt;br /&gt;
|-&lt;br /&gt;
|Wrong!&lt;br /&gt;
|The circled pair of bars are the only pair in the whole graph where two red bars (negative growth) that large are next to each other -- larger red bars exist, but not next to another one of similar magnitude. Labeling it &amp;quot;wrong&amp;quot; suggests the analyst is choosing to ignore reality by throwing out actual past data rather than revise the theory being held.&lt;br /&gt;
|-&lt;br /&gt;
|If I add some lines here I can convince myself I'm doing something more than just seeing patterns in the graph of a random walk&lt;br /&gt;
|A {{w|random walk}} is a mathematical object that describes a path that consists of a succession of random steps. Randall is trying to convince himself that the patterns in the stock chart are more meaningful than just random data. The {{w|Random walk hypothesis|random walk hypothesis}} is a financial theory that states that stock prices evolve according to a random walk, thus short-term price changes are random and cannot be predicted from past history.&lt;br /&gt;
|-&lt;br /&gt;
|Slope!&lt;br /&gt;
|The {{w|slope}} of a graph is the ratio of the &amp;quot;vertical change&amp;quot; to the &amp;quot;horizontal change&amp;quot;. A measure of slope on a financial chart can be used to predict possible specific returns or losses, or to analyze those from the past, but Randall simply prints the word in his chart annotation, with an exclamation point possibly indicating how exciting its value is, rather than labeling the actual numeric slope.  This could also be a play on a second meaning of slope, meaning a rising or falling surface in general.&lt;br /&gt;
|-&lt;br /&gt;
|Could be an omen&lt;br /&gt;
|This again makes reference to the financial meaning of the candlestick chart. The top of the small grey tick represents the highest value that the stock sold at over that day. The joke is that even though the stock did not grow appreciably, and actually sold at some point in the day for much lower, that it &amp;quot;could be an omen&amp;quot; that the value was rising.&lt;br /&gt;
|-&lt;br /&gt;
|Red + Green = Christmas&lt;br /&gt;
|Red and green are traditional colors for the {{w|Christmas}} holiday in the U.S.&lt;br /&gt;
|-&lt;br /&gt;
|Likely to continue forever&lt;br /&gt;
|This is a mistaken opinion often held by buyers in a rising market. It's been rising so much, surely it's the best time to buy!  We could make millions!  Such times are generally followed by a sharp downturn resulting in significant losses, as can be seen historically farther back on the chart.  Cryptocurrency communities have significant members who call themselves &amp;quot;hodlers&amp;quot; -- these people always trust that the price will eventually go up even higher, because it has recovered so many times in the past.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
The title text is a quote from {{w|James Tobin}} (from his 1984 paper [https://economicsociologydotorg.files.wordpress.com/2014/12/tobin-on-the-efficiency-of-the-financial-system.pdf ''On the efficiency of the financial system'']) that raises a question of very talented people building systems to make themselves a lot of money without actually accomplishing anything worth money. The quote was about the stock market and high speed traders in particular. It comments on the 'financialization' of the economy, where activities like speculation and abstracted financial products have become an increasingly large part of the economy, as opposed to investment in productive industry.&lt;br /&gt;
&lt;br /&gt;
Interestingly, this comic appeared the day after [https://www.oxfamamerica.org/explore/stories/billionaire-wealth-grows-by-25-billion-a-day-while-poorest-wealth-falls/ Oxfam] reported that the world's 2,200 billionaires had added 12% to their wealth in 2018, while the 3.8 billion people comprising the poorest half of the world's population had lost 11%. Perhaps this prompted what appears to be Randall's jab at those whose business is merely making money.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[A series of red and green box-and-whisker plots form a line that starts in the bottom left corner of the image and wiggles up to the top right corner, with a series of peaks and troughs that resemble a typical stock market diagram. The diagram is annotated with lines, arrows and text.]&lt;br /&gt;
&lt;br /&gt;
::[Title in top left corner]&lt;br /&gt;
::The basics of technical analysis&lt;br /&gt;
&lt;br /&gt;
::[A roughly horizontal section with mostly green boxes:]&lt;br /&gt;
::Allegro&lt;br /&gt;
&lt;br /&gt;
::[A horizontal bracket encompasses the next three sections]&lt;br /&gt;
::Prologue&lt;br /&gt;
&lt;br /&gt;
::[Slope becomes slightly negative. Mostly red boxes, bordered with a black line above and below:]&lt;br /&gt;
::Decline&lt;br /&gt;
&lt;br /&gt;
::[A roughly horizontal section with mostly green boxes, bordered with a black line above and below:]&lt;br /&gt;
::Doldrums&lt;br /&gt;
&lt;br /&gt;
::[Line curves upwards with mostly green boxes, with a dashed black line below:]&lt;br /&gt;
::Spline&lt;br /&gt;
&lt;br /&gt;
::[Three green boxes at minor peaks in the line are circled and indicated with arrows:]&lt;br /&gt;
::[Hmm!]&lt;br /&gt;
&lt;br /&gt;
::[A section with slight positive slope and a mixture of red and green boxes, with a solid black line below:]&lt;br /&gt;
::Lumbar support&lt;br /&gt;
&lt;br /&gt;
::[Slope increases. All green boxes, with a black line through the centre:]&lt;br /&gt;
::Renewal&lt;br /&gt;
&lt;br /&gt;
::[A sharp upwards incline, with two large green boxes:]&lt;br /&gt;
::Hark! The cliffs!&lt;br /&gt;
&lt;br /&gt;
::[Two black dots and a dashed black line connect two major peaks:]&lt;br /&gt;
::These two points define a line! Promising signal&lt;br /&gt;
&lt;br /&gt;
::[Inside trough between two major peaks is a roughly drawn black triangle:]&lt;br /&gt;
::Bathtub&lt;br /&gt;
&lt;br /&gt;
::[Slope becomes negative, mostly red boxes with a black line through the centre:]&lt;br /&gt;
::Declination&lt;br /&gt;
&lt;br /&gt;
::[At the lowest point of the trough:]&lt;br /&gt;
::Inflection&lt;br /&gt;
&lt;br /&gt;
::[Slope becomes positive, mostly green boxes with a black line through the centre:]&lt;br /&gt;
::Uptalk&lt;br /&gt;
&lt;br /&gt;
::[Slight negative slope, with large error bars. Mixture of red and green boxes. One red box is marked with an arrow:]&lt;br /&gt;
::Yikes!&lt;br /&gt;
&lt;br /&gt;
::[Negative slope, all red boxes. Gap between two central boxes is circled:]&lt;br /&gt;
::Wrong!&lt;br /&gt;
&lt;br /&gt;
::[Line rises then falls. Mixture of red and green boxes with non-parallel dashed black lines above and below:]&lt;br /&gt;
::If I add some lines here I can convince myself I'm doing something more than just seeing patterns in a graph of a random walk.&lt;br /&gt;
&lt;br /&gt;
::[Positive slope, all green boxes with a black line through the centre:]&lt;br /&gt;
::Slope!&lt;br /&gt;
&lt;br /&gt;
::[One error bar on a green box is circled:]&lt;br /&gt;
::Could be an omen?&lt;br /&gt;
&lt;br /&gt;
::[Arrow indicating peak:]&lt;br /&gt;
::Red + Green = Christmas!&lt;br /&gt;
&lt;br /&gt;
::[Positive slope, all green boxes with a wiggly black arrow through the centre. A separate arrow points off the edge of the page:]&lt;br /&gt;
::Likely to continue forever&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Charts]]&lt;br /&gt;
[[Category:Christmas]] &amp;lt;!-- mentioned at the end --&amp;gt;&lt;br /&gt;
[[Category:Music]] &amp;lt;!--  “allego” and “prologue” --&amp;gt;&lt;br /&gt;
[[Category:Comics featuring real people]]  &amp;lt;!-- Title text: James Tobin--&amp;gt;&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1208:_Footnote_Labyrinths&amp;diff=159631</id>
		<title>1208: Footnote Labyrinths</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1208:_Footnote_Labyrinths&amp;diff=159631"/>
				<updated>2018-07-04T16:56:24Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: 6%6=0≠6=(6-1)%6+1; validated by Google's calculator: https://www.google.com/search?hl=en&amp;amp;q=(6%2D1)%256%2B1 https://www.google.com/search?hl=en&amp;amp;q=6%256&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1208&lt;br /&gt;
| date      = May 6, 2013&lt;br /&gt;
| title     = Footnote Labyrinths&lt;br /&gt;
| image     = footnote_labyrinths.png&lt;br /&gt;
| titletext = Every time you read this mouseover, toggle between interpreting nested footnotes as footnotes on footnotes and interpreting them as exponents (minus one, modulo 6, plus 1).&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
This is a logic puzzle where the reader has to follow a confusing network of footnotes to determine whether the word &amp;quot;no&amp;quot; is to be ignored or not. The title text references comic [[1184]], playing on the typographical similarity between footnotes and exponents, as well as adding even more ridiculous rules.&lt;br /&gt;
&lt;br /&gt;
In the following solutions, &amp;quot;right-associative&amp;quot; means that the footnotes are evaluated from right to left or top to bottom, and left-associative from left to right or bottom to top (e.g. (2&amp;lt;sup&amp;gt;6&amp;lt;/sup&amp;gt;)&amp;lt;sup&amp;gt;&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt; is left-associative, and 2&amp;lt;sup&amp;gt;(6&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;)&amp;lt;/sup&amp;gt; is right-associative).&lt;br /&gt;
&lt;br /&gt;
===Interpreting nested footnotes as footnotes on footnotes, left-associative===&lt;br /&gt;
&lt;br /&gt;
no&amp;lt;sup&amp;gt;1&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt; = (no&amp;lt;sup&amp;gt;1&amp;lt;/sup&amp;gt;)&amp;lt;sup&amp;gt;&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt; = &amp;quot;ignore this&amp;quot; (it is meaningless to increment a phrase by 2), so the correct statement is &amp;quot;we found evidence for it in our data&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
===Interpreting nested footnotes as footnotes on footnotes, right-associative===&lt;br /&gt;
&lt;br /&gt;
&amp;quot;no&amp;lt;sup&amp;gt;1&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;quot; = &amp;quot;no&amp;lt;sup&amp;gt;1 + 2&amp;lt;/sup&amp;gt;&amp;quot; = &amp;quot;no&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;&amp;quot;. We turn to the definition of &amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;, which is &amp;quot;not true&amp;lt;sup&amp;gt;3&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;quot; = &amp;quot;not true&amp;lt;sup&amp;gt;3 + 2&amp;lt;/sup&amp;gt;&amp;quot; = &amp;quot;not true&amp;lt;sup&amp;gt;5&amp;lt;/sup&amp;gt;&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
Now &amp;lt;sup&amp;gt;5&amp;lt;/sup&amp;gt; is &amp;quot;true&amp;lt;sup&amp;gt;2&amp;lt;sup&amp;gt;6&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;quot;. The 6 says that the 2 footnote is really 1&amp;lt;sup&amp;gt;2&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt; = 1&amp;lt;sup&amp;gt;(4. ibid.)&amp;lt;/sup&amp;gt; = 1&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;, but the 3 tells us that the 6 is &amp;quot;not true&amp;lt;sup&amp;gt;5&amp;lt;/sup&amp;gt;&amp;quot;, getting us into an infinite loop, meaning there is no solution.&lt;br /&gt;
&lt;br /&gt;
===Interpreting footnotes as exponents (minus one, modulo 6, plus 1)===&lt;br /&gt;
&lt;br /&gt;
Because applying the operations &amp;quot;minus one, modulo 6, plus 1&amp;quot; to an integer always results in an integer between one and six (inclusive), no sequence of integer exponents will ever end up referencing a footnote that does not exist.&lt;br /&gt;
&lt;br /&gt;
In mathematics, nested exponents are exclusively right-associative. &amp;quot;no&amp;lt;sup&amp;gt;1&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;quot; = &amp;quot;no&amp;lt;sup&amp;gt;1&amp;lt;/sup&amp;gt;&amp;quot;, so we ignore the &amp;quot;no&amp;quot; and the correct statement is &amp;quot;we found evidence for the data.&amp;quot; &lt;br /&gt;
&lt;br /&gt;
Meanwhile, &amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt; becomes &amp;quot;not true&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;&amp;quot;, an {{w|infinite recursion}}, and since 2&amp;lt;sup&amp;gt;6&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt; mod 6 = 4, we just get &amp;quot;ibid&amp;quot; and the 5 refers back to the 3. Footnote 6 is equivalent to 1&amp;lt;sup&amp;gt;4&amp;lt;/sup&amp;gt;, and since 4 is &amp;quot;ibid.&amp;quot;, we now get &amp;quot;ignore this&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;&amp;quot;, so all roads but the solution lead to an infinite recursion.&lt;br /&gt;
&lt;br /&gt;
&amp;quot;ibid.&amp;quot; is short for &amp;quot;ibidem&amp;quot;, or &amp;quot;at the same place&amp;quot;, meaning the reference was noted on the same page just before.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Excerpt from what appears to be an academic paper with footnotes.]&lt;br /&gt;
:experiments to observe this and we found no&amp;lt;sup&amp;gt;1&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt; evidence for it in our data.&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;sup&amp;gt;1&amp;lt;/sup&amp;gt;Ignore this&lt;br /&gt;
:&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;Increment by 2 before following&lt;br /&gt;
:&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;Not true&amp;lt;sup&amp;gt;3&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&lt;br /&gt;
:&amp;lt;sup&amp;gt;4&amp;lt;/sup&amp;gt;Ibid.&lt;br /&gt;
:&amp;lt;sup&amp;gt;5&amp;lt;/sup&amp;gt;True&amp;lt;sup&amp;gt;2&amp;lt;sup&amp;gt;6&amp;lt;sup&amp;gt;3&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&lt;br /&gt;
:&amp;lt;sup&amp;gt;6&amp;lt;/sup&amp;gt;Actually a 1&amp;lt;sup&amp;gt;2&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:My Hobby]]&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1190:_Time&amp;diff=67927</id>
		<title>1190: Time</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1190:_Time&amp;diff=67927"/>
				<updated>2014-05-23T16:35:01Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: /* Format */  Just fixing a grammar error.&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1190&lt;br /&gt;
| date      = March 25, 2013&lt;br /&gt;
| title     = Time&lt;br /&gt;
| image     = time-animated.gif&lt;br /&gt;
| titletext = The end.&lt;br /&gt;
}}&lt;br /&gt;
&amp;lt;div class=&amp;quot;toclimit-3&amp;quot; style=&amp;quot;float:right; margin-left: 10px;&amp;quot;&amp;gt; __TOC__ &amp;lt;/div&amp;gt;&lt;br /&gt;
==Explanation==&lt;br /&gt;
This comic is an animation, which was showing a new image every hour. In the beginning the interval was only half an hour. The unfolding story is set in the far future, at a time when the {{w|Strait of Gibraltar}} has long been blocked and the {{w|Mediterranean Sea}} has largely dried up leaving smaller, hypersaline seas behind. Megan and Cueball, living on the shores of one of these seas and unaware of its natural history, notice one day while building a huge sand castle on the beach that the sea level is starting to rise. They start a journey of exploration trying to find out why. Eventually they discover that the Straits of Gibraltar have once again been breached, and that the Mediterranean Basin is being flooded. They run back to their home, assemble their village, and board a makeshift raft. At the end they reach land with their rafts, searching for a new home.&lt;br /&gt;
&lt;br /&gt;
On frame 2925 the title text changed from &amp;quot;Wait for it.&amp;quot; to &amp;quot;...&amp;quot;, and one frame later to just &amp;quot;RUN.&amp;quot;. At approximately 2944, when Megan announces that it is too late to escape overland, the title text changed back to &amp;quot;...&amp;quot;. On Frame 3094, the words '''THE END''' appear in the middle of the screen and the title text changed to &amp;quot;The end.&amp;quot;. The image now links to the scrollable collection of frames at [http://geekwagon.net/projects/xkcd1190/ geekwagon.net/projects/xkcd1190/]. The comic image on xkcd is currently looping through the last five frames of the comic.&lt;br /&gt;
&lt;br /&gt;
This comic now has its own {{w|Time (xkcd)|article}} on Wikipedia.&lt;br /&gt;
&lt;br /&gt;
This comic has been nominated for the [http://www.thehugoawards.org/hugo-history/2014-hugo-awards/ 2014 Hugo Award for Best Graphic Story]. Members of the 2014 World Science Fiction Convention will vote to select the winning nomination.&lt;br /&gt;
&lt;br /&gt;
===Format===&lt;br /&gt;
This comic is actually a series of images which play as a rough animation (the animated image on this page is still an incomplete compilation of all the images). The pictures were updated over the course of time. The comic ran for 2973 hours (over 124 days) and consists of 3101 image frames.&lt;br /&gt;
&lt;br /&gt;
For the first 120 hours, a new frame replaced the previous frame every 30 minutes, at :00 and :30 of each hour; the remaining frames have since been revealed every hour. The update was done server-side, with the server redirecting the image link (time.png) to a different image every hour. The source images have very long random hash names, which made it virtually impossible to access future frames. There is no way to view past frames on the official xkcd website, and only the current frame is posted there at any given time. Given the unique nature of this comic, the full image archives can be browsed through several websites that have been dedicated to tracking it (see below).&lt;br /&gt;
&lt;br /&gt;
Readers typically have divided the comic into four scenes (see below).  For example, at 850 hours (36 days 10 hours) the first &amp;quot;scene&amp;quot; of the comic ended at frame 971 with a fade to white, ushering in a second scene from frame 972. Some of the last few frames of scene 1 are nearly white, but faint images can be seen in the normalized pictures available below (Day 36, Monday, April 29, 2013, normalized).&lt;br /&gt;
&lt;br /&gt;
==Plot==&lt;br /&gt;
===Scene 1: The castle and the Sea===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
[[Megan]] and [[Cueball]] are alone on a sandy beach near the sea. They begin to build a {{w|sand castle}} on the beach. The two continue to expand the castle back from the seashore as the scene zooms out. Briefly they have fun launching small objects at the castle with a {{w|trebuchet}} before continuing the build.&lt;br /&gt;
&lt;br /&gt;
Both Cueball and Megan each leave the scene for extended periods at times but always return to continue building. They add what appears to be scaffolding and ladders to expand the castle skyward. All the while, Cueball and Megan wax philosophically about the nature of the sea, the feeding river, the rising tides, and what else lies in the world. In the end, the two decide to go off and explore the world as the sea begins to erode the castle and the scene fades to white.&lt;br /&gt;
&lt;br /&gt;
One other character appears during the fade; A girl with a beret, similar to [[Beret Guy]], briefly appears to view the castle before leaving. She returns in the last two frames before the fade-to-white completes, dragging something.&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
===Scene 2: Exploring an unknown world===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
====Scene 2 - Part 1: Walking on flatlands and then reaching the base of the hill====&lt;br /&gt;
Cueball and Megan are walking with bags across a relatively level surface. The terrain looks like frame 1, albeit from a wider angle, showing they are walking along the coast. The scene shifts multiple times between views of them to the left of a river, and 90° rotated views of them walking overland, generally upstream. Sometimes these shifts in angle are marked by corresponding shifts between front and profile views of their bodies.&lt;br /&gt;
&lt;br /&gt;
Megan indicates she has never been so far &amp;quot;this way&amp;quot;. They reach a river they haven't seen before. Cueball slips in and loses his bottle. He contemplates swimming out to get it, but Megan says it is too dangerous. Later when Megan gets too close to the edge, Cueball senses danger and pulls her back.&lt;br /&gt;
&lt;br /&gt;
After a small talk both agree to find a ford. After walking for a while, Megan realizes that the river was wider than they realized. The branch of the river they were walking along joins up with another branch and the opposite bank eventually comes into view.&lt;br /&gt;
&lt;br /&gt;
They stop for a break and Cueball dozes off and mumbles in his sleep. They discuss this river and the differences between it and theirs before continuing upriver.&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 2: Fun on dunes, some Berries, a frog, and the WOW trees from Madagascar====&lt;br /&gt;
The terrain begins to slope noticeably uphill. They wonder if others have noticed the rise of the sea and find tents left by other people. They walk deeper into the dunes, having fun by jumping and sliding. Megan falls after jumping too high.&lt;br /&gt;
&lt;br /&gt;
A bird appears in the sky. They watch it until it's gone, then begin walking again. Some vegetation appears, grass and then small trees. They stop and nap beneath a larger tree, seeming to have never seen one like it before.&lt;br /&gt;
&lt;br /&gt;
After a rest Cueball goes off to explore. He picks some berries and examines a campfire pit, then walks back to Megan and shares his findings. They wonder why the prior owners of the tent have left.&lt;br /&gt;
&lt;br /&gt;
They stop at the river to drink, then climb a ridge, and are awestruck by two tall trees. As they walk through the trees, the first large tree has markings on the trunk and the fourth large tree has a strangely bent top. They comment on these features before they continue on past three more huge trees and a regular-sized one.&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 3: A vineyard, a snake is on their way, and a bird is protecting its baby====&lt;br /&gt;
They enter a vineyard and eat some grapes.&lt;br /&gt;
&lt;br /&gt;
The two travel on. Cueball encounters a snake while climbing a small cliff and falls back. They find another section of the cliff and continue. After that they reach a tree with a nest in it with a young baby bird crying for its food. The bird's mother feeds it, then Cueball takes a short nap while Megan investigates a small river.&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 4: Walking uphill, a large cliff, and some mysterious animals====&lt;br /&gt;
The pair continue to climb the mountain, commenting here and there on the possibility of turning back, but Megan wants to see what's at the top. Eventually, they stumble upon a small shelter and a few other signs of inhabitants. They investigate the surrounding area.&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 5: The cougar attack====&lt;br /&gt;
A cougar attacks Megan, but Cueball gets in the way - although not before it claws her leg. Most of the hit gets absorbed by his backpack, but Cueball is forced to the ground. Megan grabs a stick and attacks the large cat, which runs away.&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 6: Starting to walk to the top of the mountain, the sun sets down====&lt;br /&gt;
Megan decides she would like to press on despite her injuries. Cueball and Megan then take turns sleeping as night arrives. Cueball takes the first watch. While Megan sleeps a meteor appears in the sky. Then Megan takes the next watch. When Cueball wakes up, they start their journey again up the mountain, which is slower due to Megan's injuries as Cueball has to help her over some of the steeper climbs.&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 7: After the night the final attempt to reach the top of the mountain====&lt;br /&gt;
After they reach a plateau there is a tower. Megan climbs up and sees other people. Cueball is curious and climbs the tower too. On top of that tower Megan remarks her wound doesn't hurt much when walking but it does when she climbs.&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
===Scene 3: Finding an unknown tribe===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
====Scene 3 - Part 1: Finding other people====&lt;br /&gt;
Then, they continue their travel at the plateau. They run into three people who speak a language that they are unable to understand. Despite the language barrier, Megan shows her wounded leg and the strangers proceed to take a closer look at her. The strangers then help her to sit down on a stone. After the stranger with the medical equipment is back they do some kind of first aid. Megan expresses her thanks, and the strangers indicate via drawings in the sand that they should follow.&lt;br /&gt;
&lt;br /&gt;
====Scene 3 - Part 2: Walking to the long haired woman====&lt;br /&gt;
After walking uphill again they approach another tower. A device is mounted to the top and more smaller devices are around. They drink some water there and Cueball learns his first word in this new language: &amp;quot;water&amp;quot; or &amp;quot;drink&amp;quot;. To aid communication, they start to draw pictures on the ground. Cueball shows their travel from the sea to the current location, and the stranger adds the rising sea level, indicating that he knows about this happening. The stranger shows a castle some more uphill and a long haired woman behind it. Cueball hopes they can speak to her, and the stranger explains with a drawing that it's less than a day away. The strangers collect their devices and store them somewhere. Then they start the travel to the castle. When they rest, Megan and Cueball taste some food offered by the strangers; they like it. A large flag appears and they encounter a small city. A big castle, still under construction, is visible in front of them. Megan states that she never thought she would ever see a real castle. On their way to the castle they meet another stranger, exchanging some greetings. Then they enter the castle.&lt;br /&gt;
&lt;br /&gt;
====Scene 3 - Part 3: Inside the castle====&lt;br /&gt;
The five people walk down a stairway and enter a large hall. Large windows showing a dazzling light are high above them. They approach a long-haired woman at a desk who greets them. After Cueball asks, it appears she can &amp;quot;somewhat&amp;quot; understand him and Megan. The woman asks where they came from and asks about their home; she asks if they brought anyone else. Megan and Cueball say they're trying to find out why the sea is changing. The woman explains that there is another sea which was once connected to theirs, but has since been cut off. She says that the water is now flowing back into their sea, and that the level will continue to rise. She shows Megan and Cueball a map of the area, including the castle, their sea, and the bigger sea which is joining it. The woman then shows the predicted new shoreline, which closely resembles that of the {{w|Mediterranean Sea}}. Megan assumes that the level rise is slow and will last for some years. The woman disagrees, and explains that the water level will rise over the course of a few days. Faced with knowledge of the imminent destruction of their village, Megan and Cueball bolt from the room and begin to run.&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
===Scene 4: Recovering the people at their home===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
====Scene 4 - Part 1: Megan and Cueball running home====&lt;br /&gt;
They leave the castle and run back the same way as they came. They encounter some people on their way out. By this time the title text has changed from 'Wait for it' to '...' to 'RUN.' They pass some more people they met before and when they are alone, Megan reveals that she has stolen the maps from the long-haired woman. Megan hopes she can give them back sometime. Cueball is happy and they continue their journey by using the maps. They reach their village, where they find that the people are aware of the rising sea levels, and that some of them have already gone up into the now-abandoned hills to see what items were left behind. Megan and Cueball tell them that the sea will continue to rise, and they make preparations to evacuate uphill.&lt;br /&gt;
&lt;br /&gt;
====Scene 4 - Part 2: The tribe gets ready to move on their raft====&lt;br /&gt;
It turns out that Beret Girl from before has turned Megan and Cueball's sandcastle into a boat. Megan has the idea to ride it on the rising waters, but they need to hurry to prepare it.&lt;br /&gt;
&lt;br /&gt;
====Scene 4 - Part 3: The tribe on their raft====&lt;br /&gt;
The raft is hastily made seaworthy and the tribe goes off in pursuit of the rest. They find the others floating on a makeshift canoe from a piece of floating debris. A rope is thrown and the two boats try to pull each other closer. At one point the boats bump into each other and everyone falls over. A new day arises and as Cueball and Megan rebuild their sandcastle on top of the raft, the raft runs aground. The tribe rushes off to explore the new land, and the raft is left behind at the end of the story at the mercy of the wind and waves.&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
==Viewing the comic's history==&lt;br /&gt;
Faster, navigable versions of the comic are available at:&lt;br /&gt;
*A scrollable version is at [http://geekwagon.net/projects/xkcd1190/ geekwagon.net/projects/xkcd1190/] (with code on github), this is now being linked to from the comic's site.&lt;br /&gt;
*[http://xkcd.aubronwood.com xkcd.aubronwood.com].&lt;br /&gt;
*[http://richardwestenra.com/xkcds-time-animated-time-lapse/ richardwestenra.com/xkcds-time-animated-time-lapse/].&lt;br /&gt;
*[http://xkcd.mscha.org/viewer/1 xkcd.mscha.org]&lt;br /&gt;
&lt;br /&gt;
There is also a wiki dedicated to this particular comic and the related forum thread, at [http://xkcd-time.wikia.com/ xkcd-time.wikia.com/]. There is also a physics simulation of the trebuchet written in JavaScript/HTML5, available at [http://thred.github.io/xkcd-time-catapult/ thred.github.io/xkcd-time-catapult/]. The code is hosted on [https://github.com/thred/xkcd-time-catapult GitHub], too. There is an Android app which notifies users when a new image is posted and lets them view the image from within the app, available on [https://play.google.com/store/apps/details?id=com.drewhannay.xkcdtime Google Play]. The code for the app is hosted on [https://github.com/drewhannay/xkcd-time GitHub] and encourages contribution of new features or enhancements. An hourly updated graph of the rising water level is available at [https://dl.dropboxusercontent.com/u/2169004/tide.png]&lt;br /&gt;
&lt;br /&gt;
There is also [http://edfel.atwebpages.com/Time-Map.php a map] with guesses on the locations that Megan and Cueball visit.&lt;br /&gt;
&lt;br /&gt;
Another map of estimated travel paths with terrain data is here: [[Media:TimeTerrainMap.png|TimeTerrainMap.png]].&lt;br /&gt;
&lt;br /&gt;
Additional composite scenes are located here: [[1190: Time: Pictures]]. Some of the images are very large, and may be slow to load.&lt;br /&gt;
&lt;br /&gt;
Investigations on the blurry speech by the woman in the big castle at scene 3 part 3 are here: [[1190: Time: Translator]]. Please help to enhance the pictures there for better readings.&lt;br /&gt;
&lt;br /&gt;
On July 29, 2013 [[Randall]] did a post at his [http://blog.xkcd.com/2013/07/29/1190-time/ blag] about this comic.&lt;br /&gt;
&lt;br /&gt;
===Time's forum thread===&lt;br /&gt;
In the xkcd fora, this comic was given a thread like any other comic. The Time thread expanded over the months of the comic's running to include 1254 pages, or just over 50,000 posts, and continued thereafter at a considerable pace. As of January 26th 2014, it has 68,901 posts and an enormous 3,782,329 views, which easily tops every other thread. 30% of all posts within the [http://forums.xkcd.com/viewforum.php?f=7 Individual XKCD Comic Threads subforum] are in the ''1190: &amp;quot;Time&amp;quot;'' thread. Compared to the thread for [[Click and Drag]], it has 10 times as many views and 90 times as many posts, while the typical comic thread has 30 to 200 posts. Its activity as a percentage of the entire fora can be seen in [http://xkcd.mscha.org/jjjdavidson/timeforumpercentage.128days.htm this graph].&lt;br /&gt;
&lt;br /&gt;
The [http://xkcd.mscha.org/sciscitor/img/avatars.jpg many frequent posters] of the thread developed a culture surrounding Time, creating their own [http://xkcd-time.wikia.com/wiki/Default_footnotes mannerisms], [http://xkcd-time.wikia.com/wiki/Glossary vocabulary], and [http://images2.wikia.nocookie.net/__cb20130610101557/xkcd-time/images/a/a5/X.png jokes] on top of extracting every [http://xkcd-time.wikia.com/wiki/Age_of_the_Slow_Pixel#Quotes detail] from the comic and recording every frame. More information can be found at different places on Time's dedicated wiki, or, of course, on the [http://forums.xkcd.com/viewtopic.php?f=7&amp;amp;t=101043 thread] [http://forums.xkcd.com/viewtopic.php?f=7&amp;amp;t=101043&amp;amp;start=999999999 itself].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
===Scene 1 (The castle and the sea)===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+00:00 [Megan and Cueball sitting on a sandy beach near a body of water.]&lt;br /&gt;
:+01:00 [Megan looks back.]&lt;br /&gt;
:+02:00 [Cueball looks back.]&lt;br /&gt;
:+03:00 [Megan looks up.]&lt;br /&gt;
:+04:00 [Megan reclines. Cueball looks at her.]&lt;br /&gt;
:+06:00 [Cueball gets up and inspects the water.]&lt;br /&gt;
:+07:30 [Cueball &amp;quot;puts a toe in the water&amp;quot;.]&lt;br /&gt;
:+09:00 [Cueball returns to sit next to the still reclining Megan.]&lt;br /&gt;
:+09:30 [Megan sits up.]&lt;br /&gt;
:+12:00 [Megan and Cueball start to build a sandcastle.]&lt;br /&gt;
:+25:30&lt;br /&gt;
::Cueball: Later&lt;br /&gt;
::Megan: Bye&lt;br /&gt;
::[Cueball leaves, Megan continues to build the sandcastle.]&lt;br /&gt;
:+37:00 [Cueball returns and both continue to build.]&lt;br /&gt;
:+43:30 [Megan leaves, Cueball continues to build.]&lt;br /&gt;
:+51:00 [Cueball accidentally slips and destroys part of the castle.]&lt;br /&gt;
:+61:30 [Cueball completes the sandcastle and leaves.]&lt;br /&gt;
:+73:00 [Cartoon zooms out, showing more construction has been taking place off-screen to the left.]&lt;br /&gt;
:+81:00 [Megan plants flags on original sandcastle.]&lt;br /&gt;
:+83:00 [Megan sits down at the beach.]&lt;br /&gt;
:+83:30 [Cueball finished sandcastle on the left and moves to Megan at the beach.]&lt;br /&gt;
:+84:30&lt;br /&gt;
::Megan: Wanna swim?&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
::[They both enter the water and exit the picture.]&lt;br /&gt;
:+86:00 [Castle at far left begins to crumble.]&lt;br /&gt;
:+87:00 [Megan back on the beach, Cueball off screen.]&lt;br /&gt;
::Megan: Pffthh&lt;br /&gt;
::Megan: *cough*&lt;br /&gt;
::Cueball: You OK?&lt;br /&gt;
::Megan: Just got some in my mouth.&lt;br /&gt;
:+91:00 [Cueball takes down two flags and makes the two sandcastles into one large sandcastle.]&lt;br /&gt;
:+106:30 [A rock, fired by Megan with a small trebuchet, smashes part of the castle Cueball just finished.]&lt;br /&gt;
:+107:30 [Megan partially re-enters the scene from stage right.]&lt;br /&gt;
:+108:00 [Megan has fully re-entered the scene, pulling the small trebuchet into the scene with her.]&lt;br /&gt;
:+109:00 [Megan launches an object towards the sandcastle.]&lt;br /&gt;
:+110:00 [The object launched by Megan hits the sandcastle, Cueball looks upset.]&lt;br /&gt;
:+111:30 [Cueball joins Megan at the trebuchet and launches one himself. They alternate launching projectiles.]&lt;br /&gt;
:+114:30 [Cueball launches an object straight up into the air.]&lt;br /&gt;
:+115:30 [They run as the object falls back down. Cueball leaves a few frames later, Megan stays and works on building a large mound in the destroyed center of the castle.]&lt;br /&gt;
:+186:00 [Cueball returns, Megan is working on top of a large mound she's built, as she turns around and stands up to see Cueball, she slips down the side of the mound. Cueball rushes in and helps her rebuild it and flatten out the top.]&lt;br /&gt;
:+199:00 [Building the mound]&lt;br /&gt;
::Megan: Any idea where the river is now?&lt;br /&gt;
::Cueball: Still pretty far out. It's actually retreated a little this week.&lt;br /&gt;
:+248:00 [Cueball begins constructing a miniature version of the sand structure]&lt;br /&gt;
:+263:00 [Megan walks in and notices]&lt;br /&gt;
:+280:00 [Megan re-enters with miniature trebuchet]&lt;br /&gt;
:+281:00 [Megan shoots the miniature sand structure with the miniature trebuchet]&lt;br /&gt;
:+287:00&lt;br /&gt;
::Megan: I don't understand what the sea is doing.&lt;br /&gt;
:+293:00&lt;br /&gt;
::Cueball: I don't think we can build it much taller than this. It's been fun, though!&lt;br /&gt;
:+296:00 [Cueball leaves. Megan turns and examines the structure]&lt;br /&gt;
:+300:00 [Megan brings in a rod, and puts it down]&lt;br /&gt;
:+329:00 [Megan begin construction using the various supplies she has delivered]&lt;br /&gt;
:+342:00 [Cueball returns and begins to help with the construction]&lt;br /&gt;
:+362:00 [Megan leaves]&lt;br /&gt;
:+365:00 [Cueball &amp;quot;sip&amp;quot;s the water]&lt;br /&gt;
:+366:00 [Cueball spits]&lt;br /&gt;
::Cueball: Pfffth&lt;br /&gt;
:+367:00&lt;br /&gt;
::Cueball: Pthuh!&lt;br /&gt;
::Cueball: Yuck.&lt;br /&gt;
:+369:00&lt;br /&gt;
::Cueball: I've had worse.&lt;br /&gt;
:+377:00 [Megan returns and starts making a levee]&lt;br /&gt;
:+410:00 [Cueball and Megan have stranded themselves on top of their new construction by building over their ladder.]&lt;br /&gt;
::Cueball: Guess one of us should climb down.&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+416:00&lt;br /&gt;
::Megan: The sea is rising.&lt;br /&gt;
:+417:00&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+421:00 [Megan shimmies down a support column to re-position the ladder]&lt;br /&gt;
:+426:00 [Water level reaches lowest point of castle. Megan's levee restrains it from here on out.]&lt;br /&gt;
:+441:00&lt;br /&gt;
::Cueball: Sea level rises and falls, right? It's changed before.&lt;br /&gt;
::Megan: Not this fast.&lt;br /&gt;
:+442:00&lt;br /&gt;
::Cueball: The river hasn't even reached the sea yet.&lt;br /&gt;
::Megan: The river is small&lt;br /&gt;
:::The sea is big.&lt;br /&gt;
:+443:00&lt;br /&gt;
::Cueball: How big?&lt;br /&gt;
::Megan: I don't know.&lt;br /&gt;
:+516:00&lt;br /&gt;
::Megan: Does it rain on the sea?&lt;br /&gt;
::Cueball: I don't know.&lt;br /&gt;
:+517:00&lt;br /&gt;
::Cueball: If it does, it seems like a waste.&lt;br /&gt;
:+519:00&lt;br /&gt;
::Cueball: It rains in the hills where the river comes from, right?&lt;br /&gt;
::Megan: Sure.&lt;br /&gt;
:+520:00&lt;br /&gt;
::Cueball: Are there ''other'' rivers?&lt;br /&gt;
:+521:00&lt;br /&gt;
::Megan: I don't know.&lt;br /&gt;
:+538:00&lt;br /&gt;
::Cueball: There must be other rivers.&lt;br /&gt;
:::Otherwise the sea would dry up.&lt;br /&gt;
:+539:00&lt;br /&gt;
::Megan: Maybe it's coming out of the ground.&lt;br /&gt;
::Cueball: Does that happen?&lt;br /&gt;
::Megan: I don't know.&lt;br /&gt;
:+540:00&lt;br /&gt;
::Megan: I don't know how the sea works.&lt;br /&gt;
::Cueball: I don't know how ''anything'' works.&lt;br /&gt;
:+541:00 [The levee finally starts to give way.]&lt;br /&gt;
:+543:00 [Megan and Cueball get down and look at the water, where the levee is now submerged.]&lt;br /&gt;
:+547:00 [Megan begins transferring sand to Cueball via a pulley and bucket system.]&lt;br /&gt;
:+552:00 [Megan attempts to hoist herself up using said pulley and bucket system.]&lt;br /&gt;
:+554:00 [Megan loses her balance and falls off.]&lt;br /&gt;
:+555:00 [Megan lands heavily on sandcastle. She holds her head in pain. Cueball looks on in horror.]&lt;br /&gt;
:+557:00 [Cueball goes to check if Megan is okay. Megan gets up.]&lt;br /&gt;
:+559:00 [Megan starts rebuilding the part of the sandcastle she damaged when she fell. Cueball returns to building. The water level has reached the tower on the right and begins to erode it.]&lt;br /&gt;
:+565:00 [Megan finishes repairing the damage and heads up the ladder to help Cueball build his sandcastle on top of the platform.]&lt;br /&gt;
:+604:00 [Cueball exits.]&lt;br /&gt;
:+671:00 [Megan, having finished work on the platform-castle, takes a nap on the platform.]&lt;br /&gt;
:+678:00 [A girl in a beret enters the frame, looks at the sandcastle and leaves.]&lt;br /&gt;
:+697:00 [Megan begins turning lowest castle into a new, higher levee.]&lt;br /&gt;
:+707:00 [Megan brings Cueball back.]&lt;br /&gt;
:+711:00&lt;br /&gt;
::Megan: I don't think it's going to stop.&lt;br /&gt;
:+712:00&lt;br /&gt;
::Cueball: The sea can't just make more of itself forever.&lt;br /&gt;
::Megan: It can do whatever it wants. It's the sea.&lt;br /&gt;
:+713:00&lt;br /&gt;
::Cueball: There must be a reason. There's a reason for everything.&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+714:00&lt;br /&gt;
::Megan: But it's not always a ''good'' reason.&lt;br /&gt;
:+717:00&lt;br /&gt;
::Cueball: There must be other rivers. Maybe something is wrong with them.&lt;br /&gt;
:+734:00&lt;br /&gt;
::Megan: I like our castle.&lt;br /&gt;
:+735:00&lt;br /&gt;
::Cueball: I think it's going to go away.&lt;br /&gt;
:+736:00&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+738:00&lt;br /&gt;
::Megan: Do you think there are other rivers?&lt;br /&gt;
::Cueball: '''''Something''''' is adding water to the sea.&lt;br /&gt;
:+739:00&lt;br /&gt;
::Megan: Does it have to be water? Maybe something is adding more land somewhere. And it's making the sea overflow.&lt;br /&gt;
:+740:00&lt;br /&gt;
::Cueball: Or maybe it's just raining somewhere. We have no idea what's out there.&lt;br /&gt;
:+741:00&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+743:00&lt;br /&gt;
::Megan: Want to find out?&lt;br /&gt;
::Cueball: Yes.&lt;br /&gt;
:+744:00&lt;br /&gt;
::Megan: I'll get some bags.&lt;br /&gt;
:+760:00&lt;br /&gt;
::Megan: ''bye.''&lt;br /&gt;
:+761:00 [Megan exits.]&lt;br /&gt;
:+775:00 [The entire scene begins a slow fade to white. The 'tide' continues to rise and the castle on the right continues to be subsumed.]&lt;br /&gt;
:+830:00 [Beret Girl drops in for one frame. The fade and tide continue.]&lt;br /&gt;
:+847:00 [Beret Girl drops in again, dragging something. The fade and tide continue.] (This detail is not visible without an aid to undo the fade.)&lt;br /&gt;
:+850:00 [The entire scene is white.]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
===Scene 2 (Exploring an unknown world)===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
====Scene 2 - Part 1 (Walking on flatlands and then reaching the base of the hill)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+851:00 [New scene: ground.]&lt;br /&gt;
:+852:00 [Megan and Cueball walking with bags.]&lt;br /&gt;
:+858:00 [Cueball pauses and Megan looks back at him.]&lt;br /&gt;
:+864:00 [Still walking.]&lt;br /&gt;
::Cueball: Have you ever been this far?&lt;br /&gt;
::Megan: Not this way.&lt;br /&gt;
:+867:00 [Megan and Cueball stop and have a drink from flasks in their bags.]&lt;br /&gt;
:+870:00 [Megan continues walking.]&lt;br /&gt;
:+871:00 [Cueball continues walking.]&lt;br /&gt;
:+875:00 [They stop, sit and eat. The perspective changes showing they're in a landscape similar to time +0:00.]&lt;br /&gt;
:+879:00 (frame 1000) [Megan reclines.]&lt;br /&gt;
:+880:00 [They prepare to continue.]&lt;br /&gt;
:+881:00 [They continue walking. The perspective returns to &amp;quot;parallel to the beach&amp;quot;.]&lt;br /&gt;
:+883:00 [Still walking.]&lt;br /&gt;
::Megan: Maybe the sea doesn't end.&lt;br /&gt;
:+884:00&lt;br /&gt;
::Cueball: We haven't walked very far.&lt;br /&gt;
:+885:00&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
::Megan: But that's what the first part of not ending looks like.&lt;br /&gt;
:+897:00 [Still walking.]&lt;br /&gt;
::Megan: If we don't find something today, we'll have to start using the steam bottle.&lt;br /&gt;
::Cueball: Ugh!&lt;br /&gt;
:+902:00 [They stop, having come to another body of water.]&lt;br /&gt;
:+903:00&lt;br /&gt;
::Megan: Yes.&lt;br /&gt;
::Cueball: Yes what?&lt;br /&gt;
:+904:00 [The scene zooms out briefly, showing the opposite shore.]&lt;br /&gt;
::Megan: There are other rivers.&lt;br /&gt;
:+908:00 [Cueball, having sat on the bank to drink, falls into the river when the bank beneath him crumbles. Megan manages to grab him and pull him back to dry land, but he loses his water bottle in the process.]&lt;br /&gt;
:+914:00 [Megan pulls out a lasso. She and Cueball both use it to try and grab the bottle. They fail.]&lt;br /&gt;
:+920:00&lt;br /&gt;
::Cueball: The river isn't moving that fast. Maybe I could-&lt;br /&gt;
::Megan: Too dangerous.&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+921:00&lt;br /&gt;
::Megan: It's ok. It was an accident.&lt;br /&gt;
:+923:00 [The bottle slips below the surface.]&lt;br /&gt;
::Megan: You're right, though.&lt;br /&gt;
::Cueball: About what?&lt;br /&gt;
:+924:00&lt;br /&gt;
::Megan: The river's not moving very fast.&lt;br /&gt;
:+928:00&lt;br /&gt;
::Megan: It can't be flowing much faster than we walk.&lt;br /&gt;
::Megan: Even if it's as deep as it is wide, I don't think it's enough water.&lt;br /&gt;
:+929:00&lt;br /&gt;
::Cueball: Yeah&lt;br /&gt;
:+931:00&lt;br /&gt;
::Cueball: And this river doesn't ''look'' broken.&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+932:00&lt;br /&gt;
::Cueball: It's pretty neat, though.&lt;br /&gt;
::Megan: ''Yeah.''&lt;br /&gt;
:+935:00 [Cueball grabs Megan's hand and gently pulls her back from the edge.]&lt;br /&gt;
:+937:00&lt;br /&gt;
::Cueball: Sorry.&lt;br /&gt;
::Megan: No, right. Forgot.&lt;br /&gt;
:+941:00 [Megan exits. Cueball begins digging into the ground.]&lt;br /&gt;
:+943:00 [Cueball fills in the hole he created.]&lt;br /&gt;
:+945:00 [Megan is back after checking the sea level.]&lt;br /&gt;
::Megan: It's still rising.&lt;br /&gt;
:+946:00&lt;br /&gt;
::Cueball: It's strange - Rivers flow to meet the sea - Maybe the sea couldn't wait.&lt;br /&gt;
:+948:00&lt;br /&gt;
::Megan: Walk upriver to find a ford, or turn back?&lt;br /&gt;
:+950:00&lt;br /&gt;
::Cueball: We can't go back. We don't understand everything yet.&lt;br /&gt;
:+951:00&lt;br /&gt;
::Megan: &amp;quot;Everything&amp;quot; is a little ambitious. We barely understand anything.&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+952:00&lt;br /&gt;
::Cueball: But that's what the first part of understanding everything looks like.&lt;br /&gt;
:+972:00&lt;br /&gt;
::Cueball: If nothing else, I'm glad we found this river. It's not much farther from home than ours at its driest.&lt;br /&gt;
:+975:00&lt;br /&gt;
::Megan: Oh. This river is even bigger than it looked.&lt;br /&gt;
:+976:00 [The scene zooms out to show the opposite bank again. It continues to zoom out slowly, revealing that the &amp;quot;opposite bank&amp;quot; is actually just an island in the much, much larger river. Cueball and Megan continue to walk away from the viewer.]&lt;br /&gt;
:+990:00 [Megan and Cueball finally pass the end of the island. The scene zooms out even farther once more to show the far bank.]&lt;br /&gt;
:+1001:00 [The scene returns to original zoom, with Megan and Cueball looking out over the river.]&lt;br /&gt;
:+1002:00&lt;br /&gt;
::Megan: Maybe it ''is'' big enough to fill the sea.&lt;br /&gt;
:+1003:00 [The two rest for a while. Cueball fills a bottle with river water. They both drink. Cueball lays down and naps.]&lt;br /&gt;
:+1009:00&lt;br /&gt;
::Cueball (talking in his sleep): Our rope isn't strong enough.&lt;br /&gt;
:+1010:00&lt;br /&gt;
::Megan: What?&lt;br /&gt;
::Cueball (talking in his sleep): Hold this or you'll fall.&lt;br /&gt;
:+1012:00 [Megan pokes Cueball with a stick. He wakes up, groggily.]&lt;br /&gt;
:+1021:00&lt;br /&gt;
::Cueball: When our river gets too big, it fills with stuff.&lt;br /&gt;
:::Wood and leaves and things from the people in the hills.&lt;br /&gt;
:+1022:00&lt;br /&gt;
::Cueball: This river doesn't look like that.&lt;br /&gt;
:+1023:00&lt;br /&gt;
::Megan: Maybe it only flows through empty places.&lt;br /&gt;
:+1025:00&lt;br /&gt;
::Megan: If this river isn't what's making the sea rise, we need to get past it.&lt;br /&gt;
:::Either way, we continue upriver.&lt;br /&gt;
:+1038:00&lt;br /&gt;
::Megan: I wonder how high the water is now.&lt;br /&gt;
:+1039:00&lt;br /&gt;
::Cueball: I wonder if other people have noticed. It's been days.&lt;br /&gt;
::Megan: Not a lot of us by the shore this time of year.&lt;br /&gt;
:::A few kids, maybe.&lt;br /&gt;
:+1040:00&lt;br /&gt;
::Megan: It'd have to rise a lot higher before any tents got wet.&lt;br /&gt;
:+1057:00&lt;br /&gt;
::Cueball: This river flows from bigger hills than ours.&lt;br /&gt;
:+1058:00&lt;br /&gt;
::Megan: If we don't reach a crossing soon, we'll be in them.&lt;br /&gt;
:+1060:00 [Megan and Cueball stand on the edge of a cliff and look down.]&lt;br /&gt;
:+1063:00&lt;br /&gt;
::Megan: I wonder if it's possible to swim in.&lt;br /&gt;
:+1091:00&lt;br /&gt;
::Megan: You OK?&lt;br /&gt;
:+1092:00&lt;br /&gt;
::Cueball: Just thinking.&lt;br /&gt;
:+1097:00&lt;br /&gt;
::Megan: Should we follow the river through there?&lt;br /&gt;
::Cueball: Hmm.&lt;br /&gt;
:+1098:00&lt;br /&gt;
::Cueball: Let's see if we can go over those and rejoin it further up.&lt;br /&gt;
:+1112:00&lt;br /&gt;
::Megan: It must get windier up here.&lt;br /&gt;
:+1129:00 [Megan takes a jump off the top of a hill while Cueball watches.]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 2 (Fun on dunes, some Berries, a frog, and the WOW trees from Madagascar)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+1140:00&lt;br /&gt;
::Cueball: OOF.&lt;br /&gt;
::Megan: These are bigger than they looked.&lt;br /&gt;
:+1144:00 [Megan tries another jump, but lands hard, in a heap.]&lt;br /&gt;
:+1155:00 [A bird appears in the sky, flying towards them. Megan and Cueball stop and watch it for the next few frames before it disappears behind them.]&lt;br /&gt;
:+1193:00 [Grass appears.]&lt;br /&gt;
:+1198:00 [The first small tree appears.]&lt;br /&gt;
:+1216:00 [They come to a bigger tree, taller than them.]&lt;br /&gt;
:+1218:00&lt;br /&gt;
::Megan: Neat.&lt;br /&gt;
:+1220:00 [Megan yawns audibly.]&lt;br /&gt;
:+1221:00 [Cueball sits beneath the tree.]&lt;br /&gt;
:+1222:00&lt;br /&gt;
::Megan: The river isn't much farther...&lt;br /&gt;
:+1223:00 [Cueball leans against the tree. Megan gives in and joins him, laying with her head on her pack. Cueball switches to laying on his pack, as well.]&lt;br /&gt;
:+1257:00&lt;br /&gt;
::Cueball: Berries?&lt;br /&gt;
::Megan: Ooh, Thanks!&lt;br /&gt;
:+1259:00&lt;br /&gt;
::Cueball: There are people here.&lt;br /&gt;
:::Or were.&lt;br /&gt;
:::I found some sort of campsite.&lt;br /&gt;
:+1260:00&lt;br /&gt;
::Megan: Recent?&lt;br /&gt;
::Cueball: Looked like it'd been empty for a while.&lt;br /&gt;
:+1262:00&lt;br /&gt;
::Megan: I'm thirsty. Let's get to the river.&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+1265:00&lt;br /&gt;
::Megan: They leave anything good behind?&lt;br /&gt;
::Cueball: Just some wood. Not enough to build a raft.&lt;br /&gt;
:+1286:00 [Again at the river.]&lt;br /&gt;
::Cueball: This place is beautiful.&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+1287:00&lt;br /&gt;
::Megan: I am surprised we haven't been seen by any people yet.&lt;br /&gt;
:+1288:00&lt;br /&gt;
::Megan: If it's this empty, ''we'' should live here.&lt;br /&gt;
:+1291:00&lt;br /&gt;
::Cueball: Did you notice the sea tasting ''better?''&lt;br /&gt;
::Megan: ...No?&lt;br /&gt;
:+1292:00&lt;br /&gt;
::Megan: I don't know.&lt;br /&gt;
:::I try ''not'' to taste seawater.&lt;br /&gt;
:::Why?&lt;br /&gt;
:+1293:00&lt;br /&gt;
::Cueball: I was thinking.&lt;br /&gt;
:::If a river is putting too much water in the sea, the sea should get fresher.&lt;br /&gt;
:+1294:00&lt;br /&gt;
::Cueball: I tasted the water back before we left.&lt;br /&gt;
::Megan: Ugh. And?&lt;br /&gt;
::Cueball: I thought it was a ''little'' fresher, but maybe it was just me.&lt;br /&gt;
:+1295:00&lt;br /&gt;
::Megan: Probably. I mean, how high was the sea then?&lt;br /&gt;
:::The extra water couldn't have been more than a tiny part of it.&lt;br /&gt;
:+1296:00&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+1298:00&lt;br /&gt;
::Cueball: Well, we may as well continue.&lt;br /&gt;
:::Either we'll figure out the sea, or we'll keep finding beautiful places.&lt;br /&gt;
:+1299:00&lt;br /&gt;
::Megan: That sounds fun.&lt;br /&gt;
:+1313:00 [Megan is falling.]&lt;br /&gt;
:+1315:00&lt;br /&gt;
::Cueball: Are you OK?&lt;br /&gt;
:+1316:00&lt;br /&gt;
::Megan: I found a-&lt;br /&gt;
:+1317:00&lt;br /&gt;
::Frog: RIBBIT&lt;br /&gt;
:+1355:00&lt;br /&gt;
::Megan: Is this like the one you found?&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+1381:00 [After reaching the top of a hill.]&lt;br /&gt;
::Megan: WOW.&lt;br /&gt;
:+1382:00 [Two big trees appear behind that hill, more than ten times larger than the trees before. They walk down to the first one. Megan touches it.]&lt;br /&gt;
:+1392:00&lt;br /&gt;
::Cueball: There are markings on the trunk.&lt;br /&gt;
::Megan: Oh. Yeah.&lt;br /&gt;
:+1393:00&lt;br /&gt;
::Megan: I wonder what they mean.&lt;br /&gt;
:+1402:00 [They arrive at a tree with a strangely bent top.]&lt;br /&gt;
:+1404:00&lt;br /&gt;
::Megan: I wonder if it's supposed to be like that.&lt;br /&gt;
:+1405:00&lt;br /&gt;
::Cueball: It's a pretty big tree.&lt;br /&gt;
:::It probably knows what it's doing.&lt;br /&gt;
:+1436:00 [Megan and Cueball have come to a vineyard. Cueball holds up some grapes.]&lt;br /&gt;
::Cueball: Do you think it's ok to take some?&lt;br /&gt;
:+1437:00&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:::It doesn't look like anyone's been here for a while.&lt;br /&gt;
:+1438:00 [They eat.]&lt;br /&gt;
:+1458:00 [They come to and walk past a table or bench.]&lt;br /&gt;
:+1463:00 [They come to a wooden structure that might be the remains of a {{w|tipi}}.]&lt;br /&gt;
:+1468:00&lt;br /&gt;
::Cueball: This looks like the stuff that floats down our river.&lt;br /&gt;
:+1469:00&lt;br /&gt;
::Cueball: I wonder if these people are related to the people in the hills.&lt;br /&gt;
::Megan: Maybe.&lt;br /&gt;
:+1471:00&lt;br /&gt;
::Megan: But the markings on that tree didn't look familiar.&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+1473:00&lt;br /&gt;
::Megan: We could cross the river now.&lt;br /&gt;
:::We've found more than enough wood for a raft.&lt;br /&gt;
:+1474:00&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+1477:00&lt;br /&gt;
::Cueball: We're almost in the mountains.&lt;br /&gt;
:+1479:00&lt;br /&gt;
::Cueball: We walked along the sea for days and we didn't learn anything.&lt;br /&gt;
:::Up here we're learning lots.&lt;br /&gt;
:+1480:00&lt;br /&gt;
::Megan: We haven't learned why the sea rose.&lt;br /&gt;
::Cueball: Maybe we were never going to.&lt;br /&gt;
:+1481:00&lt;br /&gt;
::Cueball: There's food and water here.&lt;br /&gt;
:::I don't want to go all the way back down, walk along the sea for a few more days, then have to turn around.&lt;br /&gt;
:+1482:00&lt;br /&gt;
::Cueball: Maybe the sea is too big for us to understand.&lt;br /&gt;
:::We can't answer every question.&lt;br /&gt;
:+1483:00&lt;br /&gt;
::Megan: No, but I think we can answer '''''any''''' question.&lt;br /&gt;
:+1484:00&lt;br /&gt;
::Megan: Still, I agree. No need to turn around yet.&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+1485:00&lt;br /&gt;
::Megan: And those mountains ''do'' look neat.&lt;br /&gt;
::Cueball: Yeah!&lt;br /&gt;
:+1487:00&lt;br /&gt;
::Megan: Before we go, we should stock up.&lt;br /&gt;
::Cueball: I'll get more water.&lt;br /&gt;
:+1496:00 [Megan sees a squirrel below a tree.]&lt;br /&gt;
::Megan: Hi!&lt;br /&gt;
:+1498:00 [Megan walks towards the squirrel. It climbs up the tree.]&lt;br /&gt;
:+1499:00 [Megan stops.]&lt;br /&gt;
:+1500:00 [The squirrel comes back down.]&lt;br /&gt;
:+1501:00&lt;br /&gt;
::Megan: It's ok! I won't eat you.&lt;br /&gt;
:+1502:00 [Megan goes down and presents some food.]&lt;br /&gt;
:+1503:00 [Megan drops down some food to the ground and the squirrel seems to be still curious.]&lt;br /&gt;
:+1504:00&lt;br /&gt;
::Megan: Want some food?&lt;br /&gt;
:+1508:00 [The squirrel grabs the food and pulls it away from Megan. She gives up trying to pet it.]&lt;br /&gt;
:+1512:00 [Megan continues on to the vineyard. The squirrel climbs up again onto the tree, then comes back down as she leaves.]&lt;br /&gt;
:+1523:00 [Megan, picking grapes, exits left. The squirrel seems to be creeping in the grass behind her, very hard to see. As Megan returns, it leaves ahead of her and seems to go up the tree.]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 3 (A vineyard, a snake is on their way, and a bird is protecting its baby)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+1548:00&lt;br /&gt;
::Cueball: I wonder where the people who take care of these plants are.&lt;br /&gt;
:+1565:00 [They continue walking. Cueball raises his arms strangely.]&lt;br /&gt;
:+1566:00&lt;br /&gt;
::Megan: What are you doing?&lt;br /&gt;
:+1567:00&lt;br /&gt;
::Cueball: Making shapes with my shadow!&lt;br /&gt;
:+1568:00&lt;br /&gt;
::Megan: When I stare down at mine for long enough while I walk, it starts to look really weird.&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+1571:00&lt;br /&gt;
::Megan: Still, it's better than when we were following the sea,&lt;br /&gt;
:::walking straight into the sun all morning. &lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+1585:00 [Megan and Cueball reach a small ridge that Megan climbs first.]&lt;br /&gt;
:+1592:00&lt;br /&gt;
::Cueball: It's prettier right by the river, but it's easier to walk up here.&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+1593:00&lt;br /&gt;
::Megan: Well, it all gets greener further up. &lt;br /&gt;
:+1608:00 [Megan and Cueball do reach another riff they have to climb on.]&lt;br /&gt;
:+1613:00 [Cueball climbs first.]&lt;br /&gt;
:+1618:00&lt;br /&gt;
::Cueball: Snake!&lt;br /&gt;
:+1618:00 [Cueball falls down.]&lt;br /&gt;
:+1621:00&lt;br /&gt;
::Megan: Are you ok?&lt;br /&gt;
:+1622:00&lt;br /&gt;
::Cueball: I think so-&lt;br /&gt;
:+1623:00&lt;br /&gt;
::Megan: Did it bite you?&lt;br /&gt;
::Cueball: No.&lt;br /&gt;
:+1624:00&lt;br /&gt;
::Megan: Could you see what kind it was?&lt;br /&gt;
:+1625:00&lt;br /&gt;
::Cueball: Brownish and shiny.&lt;br /&gt;
:::Kind of blotchy.&lt;br /&gt;
:+1626:00&lt;br /&gt;
::Megan: Did it have little spikes over it's eyes?&lt;br /&gt;
::Cueball: No, not one of those.&lt;br /&gt;
:+1627:00&lt;br /&gt;
::Cueball: It was weird.&lt;br /&gt;
:::Stubby at both ends.&lt;br /&gt;
:::Like it forgot to have a head and tail.&lt;br /&gt;
:+1628:00&lt;br /&gt;
::Megan: Hmm...&lt;br /&gt;
:+1629:00&lt;br /&gt;
::Megan: No idea.&lt;br /&gt;
:::But let's go around. And watch your feet.&lt;br /&gt;
::Cueball: Ok.&lt;br /&gt;
:+1632:00 [They search for another location to climb the cliff.]&lt;br /&gt;
:+1637:00 [This time Megan climbs first.]&lt;br /&gt;
::Megan: No snakes.&lt;br /&gt;
:+1642:00 [They continue uphill. Megan starts looking back.]&lt;br /&gt;
:+1674:00&lt;br /&gt;
::Megan: I think I can almost see the sea from here.&lt;br /&gt;
:+1676:00&lt;br /&gt;
::Cueball: I don't know.&lt;br /&gt;
:::It's hard to tell what's land and what's sky.&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+1680:00 [They walk uphill again.]&lt;br /&gt;
:+1700:00&lt;br /&gt;
::Megan: It's cooler up here.&lt;br /&gt;
:+1705:00&lt;br /&gt;
::Cueball: Are you hearing quiet chirps?&lt;br /&gt;
:+1707:00&lt;br /&gt;
::Megan: No.&lt;br /&gt;
::Cueball: I don't hear it now either.&lt;br /&gt;
:+1709:00&lt;br /&gt;
::Megan: I heard chirps from the night sky once.&lt;br /&gt;
:+1710:00&lt;br /&gt;
::Megan: I was looking at the stars one night and I heard peeping.&lt;br /&gt;
:::It was very quiet. &lt;br /&gt;
:::Just a single chirp now and then.&lt;br /&gt;
::Cueball: Did you see anything?&lt;br /&gt;
:+1711:00&lt;br /&gt;
::Megan: I thought a few stars flicker. - Nothing else.&lt;br /&gt;
::Cueball: Hmm.&lt;br /&gt;
:+1716:00 [A sound in front of them: (Chirp).]&lt;br /&gt;
:+1717:00 [Again: (Chirp).]&lt;br /&gt;
:+1718:00&lt;br /&gt;
::Cueball: It's coming from up ahead.&lt;br /&gt;
:+1719:00 [Again: (Chirp).]&lt;br /&gt;
:+1723:00 [Megan and Cueball reach some trees.]&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1724:00&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1726:00&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1727:00&lt;br /&gt;
::Megan: Chirp&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1728:00&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1729:00&lt;br /&gt;
::Megan: Chirp&lt;br /&gt;
:+1731:00&lt;br /&gt;
::Megan: Why is it doing that?&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
::Cueball: I don't know.&lt;br /&gt;
:+1732:00&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1733:00&lt;br /&gt;
::Megan: I guess it's angry that we're here.&lt;br /&gt;
:+1734:00&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1736:00 [A larger bird is flying towards the nest.]&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1738:00 [Still flying towards the nest.]&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1738:00 [The larger bird approaches the nest.]&lt;br /&gt;
::Bird in nest: Chirp&lt;br /&gt;
:+1741:00&lt;br /&gt;
::Megan: What's it doing?&lt;br /&gt;
::Cueball: I think it gave it something.&lt;br /&gt;
:+1742:00&lt;br /&gt;
::Megan: Oh! Food!&lt;br /&gt;
:::I bet the loud one is a baby.&lt;br /&gt;
::The larger bird: Chirp&lt;br /&gt;
:+1743:00&lt;br /&gt;
::Both birds: Chirp&lt;br /&gt;
:+1744:00 [Cueball is shouting.]&lt;br /&gt;
::Cueball: Now they're both loud.&lt;br /&gt;
:+1745:00 [The sound of the birds gets louder.]&lt;br /&gt;
:+1746:00&lt;br /&gt;
::Megan: It's ok.&lt;br /&gt;
:::We are not going to eat your baby.&lt;br /&gt;
::Cueball: I don't think it believes you.&lt;br /&gt;
:+1747:00&lt;br /&gt;
::Megan: That's ok. It's just protecting it's baby.&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 4 (Walking uphill, a large cliff, and some mysterious animals)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+1749:00 [Megan continues walking.]&lt;br /&gt;
::Megan: Hey-&lt;br /&gt;
:::I think I see water up ahead.&lt;br /&gt;
:+1753:00&lt;br /&gt;
::Cueball: Don't worry!&lt;br /&gt;
:::You're doing a good job.&lt;br /&gt;
:+1755:00 [Cueball follows Megan.]&lt;br /&gt;
:+1764:00 [Cueball is below a tree and Megan jumps down.]&lt;br /&gt;
::Megan: Hi!&lt;br /&gt;
:+1765:00 [Megan falls on Cueball.]&lt;br /&gt;
:+1767:00&lt;br /&gt;
::Megan: I found a tiny river.&lt;br /&gt;
:+1769:00&lt;br /&gt;
::Megan: You ok?&lt;br /&gt;
::Cueball: Yup!&lt;br /&gt;
:+1786:00 [Megan and Cueball sleep.]&lt;br /&gt;
:+1796:00 [Megan gets bit by a fly and wakes up.]&lt;br /&gt;
::Megan: Facebug!&lt;br /&gt;
:+1797:00 [Cueball is still sleeping.]&lt;br /&gt;
::Cueball: Mrrr gblghx&lt;br /&gt;
:+1805:00 [Megan wakes up Cueball.]&lt;br /&gt;
::Megan: Hey!&lt;br /&gt;
:+1806:00&lt;br /&gt;
::Megan: Come see what I found!&lt;br /&gt;
:+1807:00&lt;br /&gt;
::Megan: This river is flowing toward the big one, so I followed it to see if they connected.&lt;br /&gt;
:+1811:00 [They follow the small river.]&lt;br /&gt;
::Cueball: WOW.&lt;br /&gt;
:+1812:00 [Megan and Cueball are standing on top of a large cliff.]&lt;br /&gt;
:+1817:00 [Back at the small river.]&lt;br /&gt;
::Cueball: I guess the land goes up, but the river stays at the same level.&lt;br /&gt;
:+1818:00&lt;br /&gt;
::Megan: The river has been going up, too.&lt;br /&gt;
:::But not as fast as the land.&lt;br /&gt;
:+1820:00&lt;br /&gt;
::Megan: Can water really wear away rock like this?&lt;br /&gt;
:+1821:00&lt;br /&gt;
::Cueball: I guess it can.&lt;br /&gt;
:+1823:00&lt;br /&gt;
::Megan: I can't imagine how long it must have taken.&lt;br /&gt;
:+1824:00&lt;br /&gt;
::Cueball: Yeah...&lt;br /&gt;
:+1829:00&lt;br /&gt;
::Cueball: A lot of these rocks are pretty crumbly.&lt;br /&gt;
:+1830:00&lt;br /&gt;
::Cueball: Even down there, between all the big rocks, the cliff walls look sandy.&lt;br /&gt;
:::Water eats away sand pretty fast.&lt;br /&gt;
:+1832:00&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+1836:00&lt;br /&gt;
::Megan: I wonder how deep it gets.&lt;br /&gt;
:+1837:00&lt;br /&gt;
::Cueball: Maybe it goes right through the mountain, and it's as deep as the mountain is tall.&lt;br /&gt;
:+1838:00&lt;br /&gt;
::Megan: It could be even deeper.&lt;br /&gt;
:::We don't know how far down the water goes.&lt;br /&gt;
:+1839:00&lt;br /&gt;
::Cueball: Hmm.&lt;br /&gt;
:+1840:00&lt;br /&gt;
::Cueball: I guess it can't be much deeper than the surface of the sea.&lt;br /&gt;
:::If it were, it wouldn't flow fast and cut into the ground.&lt;br /&gt;
::Megan: Oh. Yeah.&lt;br /&gt;
:+1841:00&lt;br /&gt;
::Megan: But then, a river couldn't cut all the way through a mountain, either.&lt;br /&gt;
:::Because how would it get started?&lt;br /&gt;
:+1843:00&lt;br /&gt;
::Megan: I wonder what the top of a mountain is like?&lt;br /&gt;
:+1845:00&lt;br /&gt;
::Cueball: Let's find out.&lt;br /&gt;
:+1850:00 [Megan and Cueball walk back, grab their knapsacks and continue their explorations.]&lt;br /&gt;
:+1902:00 [They reach a rock which is hard to climb.]&lt;br /&gt;
::Cueball: It seems we've reached our journey's end.&lt;br /&gt;
:+1903:00&lt;br /&gt;
::Megan: Want to find an easier spot?&lt;br /&gt;
::Cueball: No, I can do it.&lt;br /&gt;
:::Let me help you up first.&lt;br /&gt;
:+1912:00 [Megan and Cueball reach the top of the boulder while an unknown animal is watching them.]&lt;br /&gt;
:+1913:00 [Cueball points on that animal.]&lt;br /&gt;
::Cueball: Oh!&lt;br /&gt;
:+1916:00 [The animal reveals as hedgehog after it did cover its full body.]&lt;br /&gt;
:+1924:00 [Cueball touches the hedgehog.]&lt;br /&gt;
::Megan: Careful!&lt;br /&gt;
::Cueball: It's OK.&lt;br /&gt;
:+1927:00 [Cueball picks up the hedgehog.]&lt;br /&gt;
::Megan: Does it hurt?&lt;br /&gt;
::Cueball: It's a little prickly.&lt;br /&gt;
:+1928:00&lt;br /&gt;
::Megan: Careful, it might bite.&lt;br /&gt;
::Cueball: Have you seen one before?&lt;br /&gt;
::Megan: Never this close.&lt;br /&gt;
:+1929:00&lt;br /&gt;
::Megan: It's really neat.&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+1930:00&lt;br /&gt;
::Cueball: Ok, we'll stop bothering you.&lt;br /&gt;
:+1931:00 [Cueball puts the hedgehog back to the ground and both continue their journey.]&lt;br /&gt;
:+1976:00&lt;br /&gt;
::Cueball: You OK?&lt;br /&gt;
:+1977:00&lt;br /&gt;
::Megan: Yup!&lt;br /&gt;
:+1979:00&lt;br /&gt;
::Cueball: Maybe it's time to turn around.&lt;br /&gt;
:+1980:00&lt;br /&gt;
::Cueball: The world is too big.&lt;br /&gt;
:::It can go on longer than we can.&lt;br /&gt;
:+1981:00&lt;br /&gt;
::Megan: I'm still going.&lt;br /&gt;
:+1982:00&lt;br /&gt;
::Cueball: But one day we won't be. And we're a long way from home.&lt;br /&gt;
:+1984:00&lt;br /&gt;
::Cueball: Earlier, I thought you wanted to turn around and go back to the sea.&lt;br /&gt;
:+1985:00&lt;br /&gt;
::Megan: I don't want to go back to it. I want to understand it.&lt;br /&gt;
:+1987:00&lt;br /&gt;
::Cueball: By climbing? The sea is down, not up.&lt;br /&gt;
:+1993:00&lt;br /&gt;
::Megan: These bugs have such beautiful wings.&lt;br /&gt;
:+1994:00&lt;br /&gt;
::Megan: You could spend a thousand lifetimes staring at water and sand, thinking as hard as you could, and you'd never guess the world had things like this in it.&lt;br /&gt;
:+1997:00&lt;br /&gt;
::Megan: I wanna see the top.&lt;br /&gt;
:+1998:00&lt;br /&gt;
::Cueball: What do think we'll find?&lt;br /&gt;
::Megan: More world. Maybe different.&lt;br /&gt;
:+2045:00 [Climbing, they reach a plateau with a small tree.]&lt;br /&gt;
::Megan: Weird.&lt;br /&gt;
:+2050:00 [Megan climbs up the tree and tastes a fruit.]&lt;br /&gt;
::Megan: PFFFTHH.&lt;br /&gt;
:+2061:00 [Megan points to a small tree, similar to a Christmas tree.]&lt;br /&gt;
::Megan: Oh!&lt;br /&gt;
:+2081:00 [They encounter an old bunker.]&lt;br /&gt;
::Megan: Hello?&lt;br /&gt;
:+2084:00 [Megan goes inside.]&lt;br /&gt;
::Cueball: See anything?&lt;br /&gt;
:+2084:00&lt;br /&gt;
::Megan: Just some old furniture. Shelves, a broken bowl.&lt;br /&gt;
:+2094:00 [Megan climbs on something behind the bunker. A cougar appears, hidden by the bush to the left, behind them.]&lt;br /&gt;
::Megan: Oh, hey-&lt;br /&gt;
:+2095:00&lt;br /&gt;
::Megan: There's a stream back here.&lt;br /&gt;
:+2096:00&lt;br /&gt;
::Megan: And it almost looks like there's something on top of the mountain.&lt;br /&gt;
:+2097:00&lt;br /&gt;
::Cueball: Hmm...&lt;br /&gt;
:::Could be.&lt;br /&gt;
:+2100:00&lt;br /&gt;
::Cueball: I think whoever lived here liked building castles, too.&lt;br /&gt;
:+2103:00&lt;br /&gt;
::Cueball: Here.&lt;br /&gt;
:+2104:00&lt;br /&gt;
::Megan: Oh!&lt;br /&gt;
:::You brought a flag?&lt;br /&gt;
::Cueball: Yeah, I-&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 5 (The cougar attack)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+2105:00&lt;br /&gt;
::Cueball: -LOOK OUT!&lt;br /&gt;
:+2106:00 [Cueball pushes Megan out of the way as a cougar rushes at them.]&lt;br /&gt;
:+2107:00 [The cougar jumps on Cueball.]&lt;br /&gt;
:+2110:00 [Megan grabs a branch laying on the ground.]&lt;br /&gt;
::Megan: Hey!&lt;br /&gt;
:::''Hey!''&lt;br /&gt;
:::''Over here!''&lt;br /&gt;
:+2112:00 [Megan hits the cougar.]&lt;br /&gt;
::Meagn: THAWAP!&lt;br /&gt;
::Cougar: SNARL!&lt;br /&gt;
:+2113:00&lt;br /&gt;
::Cougar: HISS&lt;br /&gt;
:+2113:00 [Megan smacks the cougar on its head.]&lt;br /&gt;
:+2114:00 [The cougar runs away.]&lt;br /&gt;
:+2116:00&lt;br /&gt;
::Megan: Are you ok?&lt;br /&gt;
::Cueball: I, um...&lt;br /&gt;
:::I think so?&lt;br /&gt;
:+2117:00&lt;br /&gt;
::Megan: It didn't bite you?&lt;br /&gt;
::Cueball: It had claws. I saw them.&lt;br /&gt;
::Megan: But you're not bleeding?&lt;br /&gt;
:+2118:00&lt;br /&gt;
::Cueball: No?&lt;br /&gt;
:+2119:00&lt;br /&gt;
::Cueball: I think it grabbed my bag by mistake.&lt;br /&gt;
:+2120:00&lt;br /&gt;
::Megan: That was lucky.&lt;br /&gt;
::Cueball: I was lucky that...&lt;br /&gt;
:::...You chased it away. Did you ''hit'' it?&lt;br /&gt;
:::I couldn't really see.&lt;br /&gt;
:+2121:00&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:+2122:00&lt;br /&gt;
::Cueball: That was brave.&lt;br /&gt;
:+2123:00&lt;br /&gt;
::Megan: You grabbed me. If you hadn't pulled me down and-&lt;br /&gt;
::Cueball: Are '''''you''''' ok?&lt;br /&gt;
:+2124:00&lt;br /&gt;
::Megan: Yeah, I'm fine.&lt;br /&gt;
:+2125:00&lt;br /&gt;
::Cueball: No, you're not.&lt;br /&gt;
:+2126:00&lt;br /&gt;
::Megan: What?&lt;br /&gt;
::Cueball: You hurt your leg.&lt;br /&gt;
:+2127:00&lt;br /&gt;
::Megan: No, I just banged it on something when -&lt;br /&gt;
::Cueball: You're bleeding.&lt;br /&gt;
:+2128:00&lt;br /&gt;
::Megan: What? No I-&lt;br /&gt;
:::''Oh.''&lt;br /&gt;
:+2129:00&lt;br /&gt;
::Megan: Claw marks. I didn't see it hit me. &lt;br /&gt;
::Cueball: It moved fast.&lt;br /&gt;
:+2131:00 [Cueball searches through his bag and talks to himself quietly.]&lt;br /&gt;
::Cueball: Where is it...&lt;br /&gt;
:::I thought I had...&lt;br /&gt;
:+2132:00&lt;br /&gt;
::Megan: This is a surprising amount of blood.&lt;br /&gt;
:+2133:00&lt;br /&gt;
::Cueball: Keep your hand tight over where it's coming out.&lt;br /&gt;
:::I'm looking for something to wrap around it.&lt;br /&gt;
:+2134:00&lt;br /&gt;
::Cueball: I can just tear the bag.&lt;br /&gt;
:::It's torn already. Or-&lt;br /&gt;
::Megan: Oh, wait.&lt;br /&gt;
:+2135:00 [Megan pulls a strip of fabric out of her bag and gives it to Cueball.]&lt;br /&gt;
:+2145:00&lt;br /&gt;
::Megan: Sorry for ruining your flag.&lt;br /&gt;
:+2146:00&lt;br /&gt;
::Cueball: It's OK.&lt;br /&gt;
:::After all, I brought it for you.&lt;br /&gt;
:+2147:00&lt;br /&gt;
::Megan: Thank you.&lt;br /&gt;
:+2149:00&lt;br /&gt;
::Megan: I like it so much I'm coloring it a beautiful red.&lt;br /&gt;
:+2162:00&lt;br /&gt;
::Megan: It's going to be a long walk home.&lt;br /&gt;
:+2163:00&lt;br /&gt;
::Cueball: Can you even walk? How are you feeling?&lt;br /&gt;
:+2164:00&lt;br /&gt;
::Megan: Thirsty.&lt;br /&gt;
:+2169:00&lt;br /&gt;
::Cueball: Does it hurt?&lt;br /&gt;
:+2170:00&lt;br /&gt;
::Megan: It didn't at first.&lt;br /&gt;
:::Now it does.&lt;br /&gt;
:+2175:00&lt;br /&gt;
::Cueball: I think you're right.&lt;br /&gt;
:::There's some kind of structure on the mountain.&lt;br /&gt;
:+2179:00&lt;br /&gt;
::Megan: I think I can walk OK.&lt;br /&gt;
:+2180:00&lt;br /&gt;
::Megan: It hurts, but it doesn't really hurt '''''more''''' when I lean on it.&lt;br /&gt;
::Cueball: That's good, at least.&lt;br /&gt;
:+2181:00&lt;br /&gt;
::Cueball: But it's a pretty bad cut.&lt;br /&gt;
:::It could get a lot worse in the time it takes to walk home.&lt;br /&gt;
:+2182:00&lt;br /&gt;
::Cueball: We need help.&lt;br /&gt;
:+2183:00&lt;br /&gt;
::Megan: Do you think we should keep going up?&lt;br /&gt;
:+2184:00&lt;br /&gt;
::Cueball: We can't be more than a day or so from the top.&lt;br /&gt;
:::There may be people there.&lt;br /&gt;
:+2185:00&lt;br /&gt;
::Megan: Like the people in the hills?&lt;br /&gt;
::Cueball: We're a long way from there.&lt;br /&gt;
:+2186:00&lt;br /&gt;
::Cueball: We don't know what's past the mountains. If we go up a little more, we'll be able to see.&lt;br /&gt;
:::There could be villages.&lt;br /&gt;
:+2187:00&lt;br /&gt;
::Megan: And if there's no one there, we wont be much farther from home than we are now.&lt;br /&gt;
::Cueball: &amp;lt;small&amp;gt;Yeah.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2188:00&lt;br /&gt;
::Megan: OK.&lt;br /&gt;
:+2189:00&lt;br /&gt;
::Cueball: I'll carry everything in your bag. Mine's torn, anyway.&lt;br /&gt;
:+2192:00&lt;br /&gt;
::Cueball: You tell me if your leg starts hurting too much.&lt;br /&gt;
::Megan: &amp;lt;small&amp;gt;OK.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2194:00 [Both continue walking uphill...]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 6 (Starting to walk to the top of the mountain, the sun sets down)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
[[Media:1190TimeNight.gif|Animated gif with enhanced brightness]]&lt;br /&gt;
:+2204:00&lt;br /&gt;
::Cueball: I'll step in and help you over.&lt;br /&gt;
:+2205:00 [Megan jumps over the small stream without waiting for Cueballs help.]&lt;br /&gt;
:+2207:00&lt;br /&gt;
::Megan: &amp;lt;small&amp;gt;OW.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2218:00 [After walking uphill again an indistinguishable animal appears in front of them.]&lt;br /&gt;
:+2221:00 [The animal disappeared and the are walking again.]&lt;br /&gt;
:+2223:00&lt;br /&gt;
::Megan: It's definitely colder up here.&lt;br /&gt;
:+2233:00&lt;br /&gt;
::Cueball: How are you feeling?&lt;br /&gt;
::Megan: Not great.&lt;br /&gt;
:+2234:00&lt;br /&gt;
::Megan: That thing is still out there.&lt;br /&gt;
::Megan: Probably others, too.&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+2240:00 The beginning of a sunset.&lt;br /&gt;
:+2252:00 The sky gets darker.&lt;br /&gt;
::Megan: We need to sleep.&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+2253:00&lt;br /&gt;
::Megan: It didn't seem scary before&lt;br /&gt;
:::pausing to sleep wherever we were.&lt;br /&gt;
:+2255:00&lt;br /&gt;
::Cueball: I'll stay awake while you rest.&lt;br /&gt;
::Megan: I can stay awake.&lt;br /&gt;
:+2256:00&lt;br /&gt;
::Cueball: No, you need to rest. I'll wake you if I get tired.&lt;br /&gt;
:+2258:00&lt;br /&gt;
::Megan: Or if something is trying to eat you, and you need me to hit it.&lt;br /&gt;
:+2260:00 [Megan sleeps.]&lt;br /&gt;
:+2262:00 [It still gets darker and the sun settles down behind the mountain.]&lt;br /&gt;
:+2265:00 [The &amp;quot;Evening Star&amp;quot; (The planet Venus) appears on the sky and follows the path of the sun.]&lt;br /&gt;
:+2270:00 [More stars are viewable since it still gets darker.]&lt;br /&gt;
:+2319:20 until 2319:24 [A meteor appears in the sky.]&lt;br /&gt;
:+2333:00&lt;br /&gt;
::Cueball: Hey.&lt;br /&gt;
:+2334:00&lt;br /&gt;
::Cueball: Wake up.&lt;br /&gt;
::Megan: Yeah?&lt;br /&gt;
:+2335:00&lt;br /&gt;
::Cueball: I stayed awake as long as I could. Can you take over?&lt;br /&gt;
::Megan: Oh, sure.&lt;br /&gt;
:+2338:00&lt;br /&gt;
::Megan: All quiet?&lt;br /&gt;
:+2339:00&lt;br /&gt;
::Cueball: Yeah. How are you feeling?&lt;br /&gt;
::Megan: Still hurts.&lt;br /&gt;
:+2340:00&lt;br /&gt;
::Megan: But I got some rest. Your turn now.&lt;br /&gt;
:+2345:00 [A sound from above of them.]&lt;br /&gt;
::Chirp&lt;br /&gt;
:+2349:00 [Again that sound.]&lt;br /&gt;
::Chirp&lt;br /&gt;
:+2350:00&lt;br /&gt;
::Megan: Do you hear that?&lt;br /&gt;
:+2351:00&lt;br /&gt;
::Chirp&lt;br /&gt;
::Cueball: Yeah.&lt;br /&gt;
:+2352:00&lt;br /&gt;
::Cueball: I wonder what they're doing.&lt;br /&gt;
:+2386:00&lt;br /&gt;
::Cueball: I'm awake.&lt;br /&gt;
::Megan: Finally!&lt;br /&gt;
:+2387:00&lt;br /&gt;
::Cueball: Did I sleep too long?&lt;br /&gt;
::Megan: Not long enough, really. But it's getting late.&lt;br /&gt;
:::&amp;lt;small&amp;gt;And I was bored.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2388:00&lt;br /&gt;
::Cueball: How's your leg?&lt;br /&gt;
:+2390:00&lt;br /&gt;
::Megan: Looks OK.&lt;br /&gt;
:+2391:00&lt;br /&gt;
::Cueball: It does?&lt;br /&gt;
::Megan: Sure.&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 2 - Part 7 (After the night the final attempt to reach the top of the mountain)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+2419:00&lt;br /&gt;
::Megan: OK. We get to the top. We look for people.&lt;br /&gt;
:+2420:00&lt;br /&gt;
::Megan: If we don't see any, we start back home.&lt;br /&gt;
:+2421:00&lt;br /&gt;
::Cueball: Sounds good.&lt;br /&gt;
:+2432:00 [After walking uphill again they reach a cliff in front of them.]&lt;br /&gt;
::Megan: Neat.&lt;br /&gt;
:+2433:00 [Some unknown items are at that cliff.]&lt;br /&gt;
::Cueball: I wonder what it's for.&lt;br /&gt;
:+2437:00 [Cueball helps Megan up to reach that cliff.]&lt;br /&gt;
::Cueball: Careful.&lt;br /&gt;
:+2440:00 [Cueball stands at the bottom of the cliff.]&lt;br /&gt;
::Cueball: Huh.&lt;br /&gt;
:+2441:00 [Cueball climbs up the cliff, using some artificial steps.]&lt;br /&gt;
:+2451:00 [They reach a plateau and before them there is a wooden tower.]&lt;br /&gt;
:+2458:00&lt;br /&gt;
::Cueball: I guess the mountains don't go back down on the other side.&lt;br /&gt;
:+2461:00 [Megan climbs up the tower.]&lt;br /&gt;
:+2465:00&lt;br /&gt;
::Megan: I found people.&lt;br /&gt;
:+2466:00 [Cueball reaches also the top floor of the tower.]&lt;br /&gt;
::Cueball: Where!?&lt;br /&gt;
::Megan: Over there.&lt;br /&gt;
:+2467:00&lt;br /&gt;
::Megan: It's far away.&lt;br /&gt;
:::But do you see the dust?&lt;br /&gt;
:+2468:00&lt;br /&gt;
::Cueball: Yeah...&lt;br /&gt;
::Megan: And I saw flashes of light.&lt;br /&gt;
:::Something glinting.&lt;br /&gt;
:+2470:00&lt;br /&gt;
::Megan: It's not far.&lt;br /&gt;
:::We can reach them tonight.&lt;br /&gt;
:+2471:00&lt;br /&gt;
::Cueball: Good!&lt;br /&gt;
:::Is walking still not too painful?&lt;br /&gt;
:+2472:00&lt;br /&gt;
::Megan: Walking is OK. Climbing hurt.&lt;br /&gt;
:+2473:00&lt;br /&gt;
::Cueball: You could have asked me to climb up here for you.&lt;br /&gt;
::Megan: But I wanted to see.&lt;br /&gt;
:+2474:00&lt;br /&gt;
::Megan: Have you figured out what that ting is?&lt;br /&gt;
:+2475:00&lt;br /&gt;
::Cueball: It looks like it's supposed to hold something.&lt;br /&gt;
:+2476:00&lt;br /&gt;
::Cueball: You can point it at things. Maybe it's a weapon.&lt;br /&gt;
:+2477:00&lt;br /&gt;
::Megan: Maybe.&lt;br /&gt;
:+2478:00&lt;br /&gt;
::Megan: But why would there be a weapon way up here?&lt;br /&gt;
:::What's it aimed at?&lt;br /&gt;
:+2479:00&lt;br /&gt;
::Cueball: Right now you're pointing it at our home.&lt;br /&gt;
:::Haven't you launched enough things at our castle?&lt;br /&gt;
::Megan: &amp;lt;small&amp;gt;No.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2488:00&lt;br /&gt;
::Megan: Our poor castle.&lt;br /&gt;
:::I wonder what's left of it.&lt;br /&gt;
:+2490:00 [White panel.]&lt;br /&gt;
:+2491:00-2493:00 [Showing the location of the castle, but it's flooded and the castle is gone. Only a small piece is floating on the sea.]&lt;br /&gt;
:+2494:00 [White panel.]&lt;br /&gt;
:+2507:00&lt;br /&gt;
::Cueball: I think that's another tower.&lt;br /&gt;
:+2508:00&lt;br /&gt;
::Megan: I think so, too.&lt;br /&gt;
:+2511:00 [Megan looks back to Cueball.]&lt;br /&gt;
::Megan: Are you OK?&lt;br /&gt;
:+2512:00&lt;br /&gt;
::Cueball: Yeah. I just need to rest for a moment.&lt;br /&gt;
:+2513:00&lt;br /&gt;
::Cueball: I don't know why I'm so out of breath.&lt;br /&gt;
::Megan: I'm feeling it too.&lt;br /&gt;
:+2515:00&lt;br /&gt;
::Cueball: I wonder if the air up here is different.&lt;br /&gt;
:+2516:00&lt;br /&gt;
::Megan: Could be.&lt;br /&gt;
:::It's definitely cooler.&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
===Scene 3 (Finding an unknown tribe)===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
====Scene 3 - Part 1 (Finding other people)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+2525:00&lt;br /&gt;
::Cueball: I can see someone on that hill!&lt;br /&gt;
:+2526:00&lt;br /&gt;
::Megan: Oh, yeah!&lt;br /&gt;
::Megan: '''HEY! HELLOOO!!'''&lt;br /&gt;
:+2527:00&lt;br /&gt;
::Cueball: Still too far to hear.&lt;br /&gt;
:+2529:00 [Megan runs.]&lt;br /&gt;
::Megan: '''HEY!'''&lt;br /&gt;
:+2530:00 [Megan and Cueball walking fast toward the people.]&lt;br /&gt;
:+2531:00 &lt;br /&gt;
::Megan: Well, they've seen us.&lt;br /&gt;
:+2533:00 [One foreign man appears.]&lt;br /&gt;
:+2535:00 [Two more people appear and they look face to face at Megan and Cueball.]&lt;br /&gt;
:+2536:00 [Megan talks to the strangers.]&lt;br /&gt;
::Megan: Hi.&lt;br /&gt;
:::We're from far away, and my leg is hurt.&lt;br /&gt;
:::Can you help us?&lt;br /&gt;
:+2537:00&lt;br /&gt;
::Stranger 1: [[File:Dialog2537.png]]&lt;br /&gt;
:+2538:00&lt;br /&gt;
::Stranger 2: [[File:Dialog2538.png]]&lt;br /&gt;
:+2539:00&lt;br /&gt;
::Cueball: Huh.&lt;br /&gt;
::Megan: OK. Umm.&lt;br /&gt;
:+2540:00 [Megan shows the strangers her leg.]&lt;br /&gt;
:+2542:00 [Stranger 2 asks Stranger 3 to go back and get some medicine.]&lt;br /&gt;
::Stranger 2: [[File:Dialog2542.png]]&lt;br /&gt;
:+2545:00 [Stranger 1 look at Megans leg.]&lt;br /&gt;
::Stranger 1: [[File:Dialog2545.png]]&lt;br /&gt;
:+2548:00 [After Stranger 3 is back Megan sits on a stone.]&lt;br /&gt;
::Cueball: They seem to know what they're doing.&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:::I wonder what that is.&lt;br /&gt;
:+2549:00 [Megan talks to Stranger 3.]&lt;br /&gt;
::Megan: That.&lt;br /&gt;
:::What is that?&lt;br /&gt;
:+2550:00&lt;br /&gt;
::Stranger 3: [[File:Dialog2550.png]]&lt;br /&gt;
:+2551:00&lt;br /&gt;
::Cueball: It's some kind of paste.&lt;br /&gt;
:::Does it hurt?&lt;br /&gt;
::Megan: Not-&amp;lt;small&amp;gt;ow&amp;lt;/small&amp;gt;-not really.&lt;br /&gt;
:+2554:00&lt;br /&gt;
::Megan: Um, thank you.&lt;br /&gt;
:+2555:00 [The strangers are leaving and one invites Megan and Cueball to come with them.]&lt;br /&gt;
:+2564:00 [They approach the home of the strangers, a new tower appears, and they are trying to test the gifts.]&lt;br /&gt;
::Megan: It's just water.&lt;br /&gt;
:+2565:00&lt;br /&gt;
::Cueball: &amp;lt;small&amp;gt;Yawn&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2566:00&lt;br /&gt;
::Cueball: How do we talk to them? We can figure this out.&lt;br /&gt;
:+2567:00 [Megan points to the sea downwards.]&lt;br /&gt;
::Megan: We're from down there. The sea. We're from the...&lt;br /&gt;
:+2568:00&lt;br /&gt;
::Megan: &amp;lt;small&amp;gt;Yawn&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2569:00&lt;br /&gt;
::Megan: ..We're from the sea.&lt;br /&gt;
:::And we have to sleep.&lt;br /&gt;
:+2571:00&lt;br /&gt;
:Stranger: [[File:Dialog2571.png]]&lt;br /&gt;
:+2572:00 [Black panel.]&lt;br /&gt;
:+2573:00 [Stranger sitting on the tower, probably doing observations]&lt;br /&gt;
:+2575:00 [Cueball appears and fetches two cups. The stranger comes down the tower]&lt;br /&gt;
:+2576:00 [Cueball and the stranger fill water in their cups]&lt;br /&gt;
:+2580:00 [Cueball and a stranger sitting face to face, the stranger points at his cup.]&lt;br /&gt;
::Stranger: [[File:Dialog2580.png]]&lt;br /&gt;
:+2582:00 [Cueball does his his first try with the strange language.]&lt;br /&gt;
::Cueball: [[File:Dialog2582a.png]]&lt;br /&gt;
::Stranger: [[File:Dialog2582b.png]] [[File:Dialog2582c.png]]&lt;br /&gt;
:+2583:00 [Megan is awake again.]&lt;br /&gt;
::Megan: Yawn&lt;br /&gt;
:+2585:00 [Cueball approaches Megan, while the stranger keeps sitting.]&lt;br /&gt;
::Cueball: I learned a word. I think.&lt;br /&gt;
::Megan: Oh?&lt;br /&gt;
:+2586:00&lt;br /&gt;
::Cueball: [[File:Dialog2582a.png]] &amp;quot;Water&amp;quot;. Probably.&lt;br /&gt;
:+2587:00&lt;br /&gt;
::Stranger: [[File:Dialog2580.png]]&lt;br /&gt;
:+2588:00&lt;br /&gt;
::Cueball: Or &amp;quot;Drink!&amp;quot;&lt;br /&gt;
::Megan: Hmm.&lt;br /&gt;
:+2589:00&lt;br /&gt;
::Megan: There must be a faster way to...&lt;br /&gt;
:+2590:00 [Stranger looks through instrument on the left.]&lt;br /&gt;
::Cueball: —Hey!&lt;br /&gt;
:+2592:00 [Cueball gets a stick to draw on the ground.]&lt;br /&gt;
::Megan: It's ok!&lt;br /&gt;
:+2594:00 [Cueball draws Megan, himself, and three strangers on the ground.]&lt;br /&gt;
:+2596:00 [Stranger adds the tower to the drawing.]&lt;br /&gt;
:+2597:00 [Cueball draws smaller scaled picture of mountain with Megan and him at the bottom and the strangers and tower on top.]&lt;br /&gt;
:+2599:00 [Cueball erases him and Megan from the bottom and sketches their journey uphill.]&lt;br /&gt;
:+2601:00 [Cueball draws the sea on bottom of the hill.]&lt;br /&gt;
::Cueball: [[File:Dialog2582a.png]]&lt;br /&gt;
:+2602:00&lt;br /&gt;
::Stranger: [[File:Dialog2602.png]]&lt;br /&gt;
:+2604:00 [Cueball does not understand and hands over the stick to the Stranger.]&lt;br /&gt;
:+2606:00 [The Stranger draws a higher level on the sea.]&lt;br /&gt;
::Megan: Yes! The sea is rising!&lt;br /&gt;
::Cueball: Why is that happening?&lt;br /&gt;
:+2608:00 [A second Stranger appears behind the tower.]&lt;br /&gt;
::Stranger 2: [[File:Dialog2608.png]]&lt;br /&gt;
:+2610:00 [The Stranger with the stick erases some of Cueballs drawings behind the tower and adds a building at a slightly higher level.]&lt;br /&gt;
:+2611:00&lt;br /&gt;
::Megan: They're going somewhere...&lt;br /&gt;
::Cueball: ...and want us to come, too.&lt;br /&gt;
:+2613:00 [The Stranger with the stick draws a long haired woman behind that building.]&lt;br /&gt;
:+2614:00&lt;br /&gt;
::Cueball: Oh, speech! There's someone we can talk to?&lt;br /&gt;
:+2615:00 [The Stranger with the stick draws the way of the sun for an entire day and the trip, which is less in time.]&lt;br /&gt;
:+2616:00&lt;br /&gt;
::Megan: I get it-&lt;br /&gt;
:::it's less than a day away.&lt;br /&gt;
::Cueball: Then let's do it.&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 3 - Part 2 (Walking to the long haired woman)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+2618:00 [The Strangers pick up their devices and they start the next travel.]&lt;br /&gt;
:+2625:00 [Megan wears again a knapsack.]&lt;br /&gt;
:+2642:00 [They spot a rabbit. The rabbit runs away.]&lt;br /&gt;
:+2670:00 [The group rests beneath a tree to eat.]&lt;br /&gt;
::Cueball: It's good, whatever it is.&lt;br /&gt;
:+2671:00&lt;br /&gt;
::Stranger 1: [[File:Dialog2797.png]]&lt;br /&gt;
:+2672:00&lt;br /&gt;
::Megan: Huh, ok.&lt;br /&gt;
:::[[File:Dialog2797.png]]&lt;br /&gt;
:+2676:00 [The stranger shows more items (maybe food) to Megan and Cueball.]&lt;br /&gt;
::Stranger 1: [[File:Dialog2802.png]]&lt;br /&gt;
:+2677:00 [The text changes to a map with a triangular mesh.]&lt;br /&gt;
::[[File:Dialog2803.png]]&lt;br /&gt;
:+2678:00&lt;br /&gt;
::Megan: I heard &amp;quot;water&amp;quot;.&lt;br /&gt;
::Cueball: Is it some kind of map?&lt;br /&gt;
:+2679:00&lt;br /&gt;
::Megan: I guess. But it's just a jumble of lines.&lt;br /&gt;
::Cueball: Maybe those triangle things are rivers?&lt;br /&gt;
:+2680:00&lt;br /&gt;
::Stranger 2: [[File:Dialog2806a.png]]&lt;br /&gt;
:::[[File:Dialog2806b.png]] [[File:Dialog2806c.png]]&lt;br /&gt;
::Stranger 1: [[File:Dialog2806d.png]]&lt;br /&gt;
:+2692:00 [The group passes a flag.]&lt;br /&gt;
::Cueball: Wow. There's a whole ''city'' up there.&lt;br /&gt;
::Megan: Neat!&lt;br /&gt;
:+2695:00 [The group enters the city.]&lt;br /&gt;
::Stranger 3: [[File:Dialog2821.png]]&lt;br /&gt;
:+2697:00 [They approach a man wearing a slightly larger hat, sitting before a small house.]&lt;br /&gt;
::Stranger 3: [[File:Dialog2823.png]]&lt;br /&gt;
::Stranger with larger hat: [[File:Dialog2823.png]]&lt;br /&gt;
:+2701:00&lt;br /&gt;
::Cueball: I like these little houses.&lt;br /&gt;
:::They-&lt;br /&gt;
::Stranger 3: [[File:Dialog2827.png]]&lt;br /&gt;
::Megan: Oh.&lt;br /&gt;
:+2702:00&lt;br /&gt;
::Cueball: Oh.&lt;br /&gt;
::Megan: Oh wow.&lt;br /&gt;
:+2703:00 [The scene zooms out.]&lt;br /&gt;
:+2704:00 [The scene zooms out more, and a big castle, still under construction, appears in front of them.]&lt;br /&gt;
:+2705:00 [Zoom in back to the people.]&lt;br /&gt;
::Megan: A real castle. I never thought I'd see a real castle!&lt;br /&gt;
:+2706:00&lt;br /&gt;
::Cueball: I wasn't sure there ''were'' real castles.&lt;br /&gt;
::Megan: Look at it. It's breathtaking.&lt;br /&gt;
:+2709:00&lt;br /&gt;
::Megan: Our castle was too small.&lt;br /&gt;
:+2710:00&lt;br /&gt;
::Stranger 3: [[File:Dialog2836.png]]&lt;br /&gt;
:+2715:00 [They walk uphill towards the castle and meet a guy holding something under his arm.]&lt;br /&gt;
::Stranger 3: [[File:Dialog2841a.png]]&lt;br /&gt;
::Stranger 4: [[File:Dialog2841b.png]]&lt;br /&gt;
:+2716:00 [They keep walking.]&lt;br /&gt;
::Stranger 1: [[File:Dialog2842b.png]]&lt;br /&gt;
::Stranger 4: [[File:Dialog2842a.png]] [[File:Dialog2842b.png]]&lt;br /&gt;
:+2720:00 [They enter the castle.]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 3 - Part 3 (Inside the castle)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+2723:00 [They are inside the castle, walking down stairs.]&lt;br /&gt;
::Megan: Neat!&lt;br /&gt;
:+2725:00 [They walk through a large hall.]&lt;br /&gt;
:+2737:00 [After passing through a door and a curtain, they meet the translator.]&lt;br /&gt;
::Translator: [[File:Dialog2841a.png]]&lt;br /&gt;
:+2738:00&lt;br /&gt;
::Stranger 2: [[File:Dialog2841a.png]]&lt;br /&gt;
::Stranger 3: [[File:Dialog2841a.png]]&lt;br /&gt;
:+2739:00&lt;br /&gt;
::Translator: [[File:Dialog2865.png]]&lt;br /&gt;
:+2740:00 [Megan and Cueball step forward.]&lt;br /&gt;
::Stranger 1: [[File:Dialog2866a.png]]&lt;br /&gt;
::Stranger 3: [[File:Dialog2866b.png]]&lt;br /&gt;
:+2742:00&lt;br /&gt;
::Cueball: Hello!&lt;br /&gt;
::Megan: Do you understand us?&lt;br /&gt;
:+2744:00&lt;br /&gt;
::Translator [A long haired woman, multiple copies of text above each other indicating language difficulties]: Somewhat&lt;br /&gt;
:+2746:00&lt;br /&gt;
::Cueball: I think we understand you, too!&lt;br /&gt;
:+2747:00&lt;br /&gt;
::Translator [still blurry]: Whence have you traveled here&lt;br /&gt;
:+2748:00&lt;br /&gt;
::Cueball: We came here up the mountain.&lt;br /&gt;
::Megan: We're from the sea.&lt;br /&gt;
:+2749:00&lt;br /&gt;
::Translator [very blurry]: You arose here from the desert below.&lt;br /&gt;
:::Nobody [unintelligible; possibly &amp;quot;survives there&amp;quot;?]&lt;br /&gt;
:+2751:00&lt;br /&gt;
::Megan: We, um... We don't quite understand that.&lt;br /&gt;
:+2752:00&lt;br /&gt;
::Translator [very blurry]: '''I''' am sorry.&lt;br /&gt;
:::Your language is like those spoken by the ... difficult ... but I learned it.&lt;br /&gt;
:+2753:00&lt;br /&gt;
::Translator [very blurry]: Please [two phrases overlapping: &amp;quot;have patience&amp;quot; and &amp;quot;be patient&amp;quot;].&lt;br /&gt;
::Cueball: Of course.&lt;br /&gt;
:+2754:00&lt;br /&gt;
::Translator: [[File:Dialog2880a.png]]&lt;br /&gt;
::Stranger 3: [[File:Dialog2880b.png]]&lt;br /&gt;
:+2756:00&lt;br /&gt;
::Stranger 3: [[File:Dialog2841a.png]]&lt;br /&gt;
:+2757:00&lt;br /&gt;
::Translator [very blurry]: They understand nothing so they will tend to matters.&lt;br /&gt;
::Megan: Of course.&lt;br /&gt;
:+2758:00&lt;br /&gt;
::Translator: Your bags&lt;br /&gt;
:+2759:00&lt;br /&gt;
::Megan: What do you want our bags for?&lt;br /&gt;
::Translator: They are heavy.&lt;br /&gt;
::Megan: ''...Oh.'' Thank you!&lt;br /&gt;
:+2764:00&lt;br /&gt;
::Cueball: Thank you!&lt;br /&gt;
::Translator: You're welcome.&lt;br /&gt;
:+2765:00&lt;br /&gt;
::Translator: Tell me where your home is.&lt;br /&gt;
:+2766:00&lt;br /&gt;
::Megan: We live by the shore, near a river that flows down to the sea every year.&lt;br /&gt;
::Translator: What river? [ed. note: Translator's question mark is denoted by ring accent, as it is in their language]&lt;br /&gt;
:+2767:00&lt;br /&gt;
::Megan: It's a smaller river-not the one that flows from your land.&lt;br /&gt;
:::We collect things that float down it.&lt;br /&gt;
:+2768:00&lt;br /&gt;
::Cueball: There are people in the hills where our river comes from.&lt;br /&gt;
::Megan: &amp;lt;small&amp;gt;They don't like us.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2769:00&lt;br /&gt;
::Translator: How many people strong are yoů [ed. note: &amp;quot;you?&amp;quot;]&lt;br /&gt;
:+2770:00&lt;br /&gt;
::Cueball: There are about forty of us.&lt;br /&gt;
::Translator: ...is forty? [Possibly &amp;quot;How much is forty&amp;quot;] All my numbers are too small.&lt;br /&gt;
::Megan: Um. Four ten times. Five eight times.&lt;br /&gt;
::Translator: Yes! Good.&lt;br /&gt;
:+2771:00&lt;br /&gt;
::Translator [blurry]: Do you carry these people with yoů [ed. note: &amp;quot;you?&amp;quot;]&lt;br /&gt;
:+2772:00&lt;br /&gt;
::Megan: No. We came here alone.&lt;br /&gt;
::Translator [blurry]: Oh.&lt;br /&gt;
::Megan: We're here to find out why the sea is changing.&lt;br /&gt;
::Translator [blurry]: Um.&lt;br /&gt;
:+2773:00&lt;br /&gt;
::Translator [very blurry]: You do not know.&lt;br /&gt;
:::I [illegible]you see.&lt;br /&gt;
::Cueball: ...did you get that?&lt;br /&gt;
::Megan: No.&lt;br /&gt;
:+2774:00&lt;br /&gt;
::Translator [very blurry]: Your sea does not stand alone! There is another sea north [of yours] beyond the shore. It has become glued to yours [but their] levels differ and thus [water] flows. [Ed: exclamation points denoted by two lines above last letter in the sentence]&lt;br /&gt;
::Cueball: Wait, slow down.&lt;br /&gt;
:+2775:00&lt;br /&gt;
::Megan: No, I think I understood.&lt;br /&gt;
:::There's a second sea, a higher one, and its waters have started flowing into ours.&lt;br /&gt;
::Cueball: Why? What connected them?&lt;br /&gt;
::Megan: Yeah-what changed?&lt;br /&gt;
:+2776:00&lt;br /&gt;
::Translator [very blurry]: In time even the hills change. When people first walked and first built [their] cities the seas were joined. But there was a great [illegible] rocks and the passage was closed. Your sea [illegible] with too few rivers. Under the sun it shrank and the water fell. Now the sea has found a way back in.&lt;br /&gt;
:+2777:00&lt;br /&gt;
::Cueball: ...How different are the seas' heights?&lt;br /&gt;
:::How high will the water eventually rise? Should we move our home?&lt;br /&gt;
::Translator: Do you know where you are̊ [ed. note: &amp;quot;are?&amp;quot;]&lt;br /&gt;
:+2778:00&lt;br /&gt;
::Cueball: No.&lt;br /&gt;
::Translator: I will build you a map to understanding.&lt;br /&gt;
:+2780:00&lt;br /&gt;
::[A map is drawn on a tablet. A sea named [[File:Dialog2906.png]] in the middle is labeled [This sea is yours]. There is part of a sea to the bottom left, labeled [The sea joining yours]. Above the central sea there is a small patch labeled [The fortress is here].]&lt;br /&gt;
:+2781:00&lt;br /&gt;
::[Dashed lines are drawn on the map featuring the predicted future extent of sea. The shape of the predicted coastline matches the shape of the real-world western to central Mediterranean Sea from Gibraltar to Italy/Albania. Thus the &amp;quot;sea joining yours&amp;quot; corresponds to the Atlantic ocean and the &amp;quot;sea that is yours&amp;quot; corresponds to the remains of the Mediterranean. This matches the Latin phrase &amp;quot;mare nostrum&amp;quot; (= &amp;quot;our sea&amp;quot;) that the Romans used to call the Mediterranean. The location of the castle corresponds to the vicinity of Marseille in France.]&lt;br /&gt;
::Translator: And this. Our belief about the sea's new shore.&lt;br /&gt;
:+2782:00&lt;br /&gt;
::Megan: The sea can cover ''mountains''?&lt;br /&gt;
:+2783:00&lt;br /&gt;
::Translator: We learned.&lt;br /&gt;
:::It has happened before. When our parents were learning to walk upright the sea fled and returned.&lt;br /&gt;
:+2784:00&lt;br /&gt;
::Translator: [Now] it is happening again.&lt;br /&gt;
:+2786:00&lt;br /&gt;
::Megan: The shoreline goes right through where the castle is.&lt;br /&gt;
:::Where we are right now.&lt;br /&gt;
::Translator: Yes.&lt;br /&gt;
:+2787:00&lt;br /&gt;
::Translator: The castle [fortress] was once an island.&lt;br /&gt;
:::We found it and have tried to rebuild it.&lt;br /&gt;
:+2788:00&lt;br /&gt;
::Translator: I guess [imagine / suppose] it will be an island again.&lt;br /&gt;
:+2789:00&lt;br /&gt;
::Cueball: Who ''are'' you ?&lt;br /&gt;
::Translator: [very blurry] We are tea(che)rs/learners/scholars. This fortress s(wa)r(m)s with tea(ching)/sci(ence)/lea(rn). And I am their teacher/leader/ruler.&lt;br /&gt;
:+2790:00&lt;br /&gt;
::Megan: I still can't imagine it. ''Every'' place we've walked will someday be inside the sea.&lt;br /&gt;
:+2791:00&lt;br /&gt;
::Megan: We need to get back home.&lt;br /&gt;
:::We need to get started on plans to move.&lt;br /&gt;
:::Can we have one of your maps? That would help-&lt;br /&gt;
:::...Are you OK ?&lt;br /&gt;
:+2792:00&lt;br /&gt;
::Translator: [very blurry] I'm so sorry&lt;br /&gt;
::Cueball: What?&lt;br /&gt;
:+2793:00&lt;br /&gt;
::Translator: [very blurry] When we discovered the sea was rising under the bank, we tried to shore it up.&lt;br /&gt;
:::We '''failed.'''&lt;br /&gt;
:::We tried to re(mo)ve everybody from the basin but we do not '''know''' of your group/t(rib)e. &lt;br /&gt;
:+2794:00&lt;br /&gt;
::Megan: No, it's ok!&lt;br /&gt;
:::I've been thinking.&lt;br /&gt;
:::At the rate we saw the sea rising, it will take years to-&lt;br /&gt;
::Translator: '''No.'''&lt;br /&gt;
:+2795:00&lt;br /&gt;
::Translator: [very blurry] As the water flows, it widens the breach.&lt;br /&gt;
:::'''The berm is giving way.'''&lt;br /&gt;
:::The sea will rush through in a great torrent.&lt;br /&gt;
:::The planet's mightiest river will once again come thundering down the mountainside.&lt;br /&gt;
:::The sea will fill&lt;br /&gt;
:::not in years&lt;br /&gt;
:::but in '''days'''.&lt;br /&gt;
:+2796:00&lt;br /&gt;
::Translator: The journey to your land is much too long.&lt;br /&gt;
:::I will not send [illegible] only to see them encircled and drowned by the [rising / rushing] tide.&lt;br /&gt;
:+2797:00&lt;br /&gt;
::Translator: The world you know is ending,&lt;br /&gt;
:::But fortune has delivered you from the flood.&lt;br /&gt;
:::You did not intend to leave your home forever, but be [thankful / grateful] you left when you did.&lt;br /&gt;
::Cueball: But..&lt;br /&gt;
:+2798:00&lt;br /&gt;
::Translator: You must say your goodbyes from there. You cannot go back down into the abyss&lt;br /&gt;
:::For you have walked too far and now there is no more time to walk&lt;br /&gt;
:::The ocean ('''sea''') is coming ('''here''').&lt;br /&gt;
:+2801:00 [Megan and Cueball running out of the room.]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
===Scene 4 (Recovering the people at their home)===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
====Scene 4 - Part 1 (Megan and Cueball running home)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+2807:00 [Outside of the castle, two strangers sitting on the ground.]&lt;br /&gt;
::Stranger: [[File:Dialog2931.png]]&lt;br /&gt;
::Cueball: ...oh! Hi!&lt;br /&gt;
:+2808:00&lt;br /&gt;
::Cueball: I, uhh...&lt;br /&gt;
:::Thank you for-&lt;br /&gt;
::Megan: [[File:Dialog2932.png]]&lt;br /&gt;
::Cueball: Thank you.&lt;br /&gt;
:::We have to go.&lt;br /&gt;
:+2809:00&lt;br /&gt;
::Stranger: [[File:Dialog2933.png]]&lt;br /&gt;
::Megan: Goodbye!&lt;br /&gt;
:+2810:00&lt;br /&gt;
::Cueball: It's getting late.&lt;br /&gt;
::Megan: We can make it to the tower tonight&lt;br /&gt;
:+2811:00&lt;br /&gt;
::Cueball: We can't run the whole way&lt;br /&gt;
::Megan: Nope&lt;br /&gt;
:+2815:00 [At the village.]&lt;br /&gt;
::Man with large hat: [[File:Dialog2941.png]]&lt;br /&gt;
:+2816:00&lt;br /&gt;
::Cueball: Hi!&lt;br /&gt;
:::Probably.&lt;br /&gt;
:+2824:00&lt;br /&gt;
::Cueball: Not much further!&lt;br /&gt;
:+2830:00 [They enter a dark tunnel and do a rest for sleep.]&lt;br /&gt;
:+2832:00&lt;br /&gt;
::Cueball: I dreamed I woke up in the water.&lt;br /&gt;
:+2836:00&lt;br /&gt;
::Cueball: I hope they don't mind us taking some of the food and water here.&lt;br /&gt;
::Megan: &amp;lt;small&amp;gt;Mm.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2837:00&lt;br /&gt;
::Cueball: Maybe we should have stayed to ask.&lt;br /&gt;
:::But I was starting to get a little creeped out.&lt;br /&gt;
::Megan: &amp;lt;small&amp;gt;Yeah.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2841:00&lt;br /&gt;
::Cueball: Still, maybe they could have helped us find a faster way back.&lt;br /&gt;
:+2842:00&lt;br /&gt;
::Cueball: ...Are you OK?&lt;br /&gt;
::Megan: I did something that was wrong.&lt;br /&gt;
:+2843:00&lt;br /&gt;
::Cueball: !!!&lt;br /&gt;
:+2844:00&lt;br /&gt;
::Cueball: You stole the maps! &lt;br /&gt;
::Megan: I'll give them back some day! I hope.&lt;br /&gt;
::Cueball: This is great! There are so many!&lt;br /&gt;
:+2845:00&lt;br /&gt;
::Cueball: We must be here, right?&lt;br /&gt;
::Megan: Yeah.&lt;br /&gt;
:::So we can follow our old path back down the mountain, then cut across land through the hills.&lt;br /&gt;
:::I'm guessing they're empty. It sounds that everyone knew but us.&lt;br /&gt;
::Cuball: Yeah.&lt;br /&gt;
::Megan: OK. We can do this, probably.&lt;br /&gt;
:+2851:00&lt;br /&gt;
::Megan: That stuff they put on my leg worked great.&lt;br /&gt;
:::What do you think it was?&lt;br /&gt;
::Cueball: No idea.&lt;br /&gt;
:::I'm just glad they had it.&lt;br /&gt;
:+2852:00&lt;br /&gt;
::Megan: Along with the maps I should've stolen a guide to treating injuries.&lt;br /&gt;
:::Ooh, and one how they make those pointing devices in the towers... &lt;br /&gt;
::Cueball: Um...&lt;br /&gt;
:+2856:00 [The cougar appears again.]&lt;br /&gt;
:+2857:00 [The cougar flees and runs away.]&lt;br /&gt;
:+2865:00 [They reach again the hedgehog.]&lt;br /&gt;
::Cueball: &amp;lt;small&amp;gt;Just go uphill. Don't stop, don't get stuck. You can make it.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2868:00 [At the tree with the baby bird. It's preparing for its first flight.]&lt;br /&gt;
::Bird: Chirp!&lt;br /&gt;
::''Flap Flap Flap Flap''&lt;br /&gt;
:+2871:00 [They rest at the same location they did before.]&lt;br /&gt;
:+2874:00&lt;br /&gt;
::Cueball: I don't see anyone.&lt;br /&gt;
:::I think the hills are empty.&lt;br /&gt;
::Megan: I wish we had time to explore them.&lt;br /&gt;
:::I'd love to learn how they make all that stuff.&lt;br /&gt;
:+2877:00&lt;br /&gt;
::Cueball: Is that the sea?&lt;br /&gt;
::Megan ...Should it be in view already?&lt;br /&gt;
:+2880:00&lt;br /&gt;
::Cueball: I know this place.&lt;br /&gt;
:::There ''definitely'' shouldn't be water here.&lt;br /&gt;
::Megan: Uh oh.&lt;br /&gt;
::Cueball: The sea must be following up old riverbeds.&lt;br /&gt;
::Megan: If it's here, it must be close to joining the river. How high up do you think we are?&lt;br /&gt;
::Cueball: No idea. How do you even measure that?&lt;br /&gt;
::Megan: I don't know.&lt;br /&gt;
::&amp;lt;small&amp;gt;spush spush&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2881:00&lt;br /&gt;
::Cueball: Oh!&lt;br /&gt;
:::I used to come out&lt;br /&gt;
:::to this rock&lt;br /&gt;
:::when I was little.&lt;br /&gt;
:::''*breathe*''&lt;br /&gt;
:::...it's weird&lt;br /&gt;
:::being the last person&lt;br /&gt;
:::to see it.&lt;br /&gt;
:+2882:00&lt;br /&gt;
::Megan: Whoa, wait.&lt;br /&gt;
:+2883:00&lt;br /&gt;
::Megan: Look at the spot where we crossed the riverbed.&lt;br /&gt;
::Cueball: Oh. Oh no.&lt;br /&gt;
:+2885:00&lt;br /&gt;
::Megan: There they are!&lt;br /&gt;
:::I see people coming over the rise across the...&lt;br /&gt;
:::...water.&lt;br /&gt;
:+2886:00&lt;br /&gt;
::Cueball: I can't tell how deep it is.&lt;br /&gt;
:::These things seem to be snaking in from all along the coast. We should've come from more inland.&lt;br /&gt;
::Megan: I was ''trying'', but inland keeps moving!&lt;br /&gt;
:+2887:00&lt;br /&gt;
::Cueball: They're headed this way. They must be planning to cross here.&lt;br /&gt;
:::Do you think it's safe?&lt;br /&gt;
::Megan: It should be-&lt;br /&gt;
:::it's not actually a river; they can swim if they need.&lt;br /&gt;
:+2888:00&lt;br /&gt;
::Cueball: We should cross.&lt;br /&gt;
:::They're not here yet, and it's getting deeper. Better to get on their side while we can.&lt;br /&gt;
:::Then we can help them back over if it's safe.&lt;br /&gt;
::Megan: Good thinking.&lt;br /&gt;
:+2889:00 [Cueball is in the water.]&lt;br /&gt;
::Cueball: I can feel it flowing...&lt;br /&gt;
:::...but something seems wrong.&lt;br /&gt;
:::Hang on.&lt;br /&gt;
:+2890:00 [Cueball is falling into the water, keeping his backpack above the water level.]&lt;br /&gt;
::SPLASH&lt;br /&gt;
::Cueball: Augh!&lt;br /&gt;
::Megan: What??&lt;br /&gt;
:+2891:00&lt;br /&gt;
::Cueball: It's-&lt;br /&gt;
:::''*tphbtt*''&lt;br /&gt;
:::-it's ''fresh''!&lt;br /&gt;
:::Not as fresh as a river, but too fresh to float on-&lt;br /&gt;
:::definitely not while holding a bag.&lt;br /&gt;
::Megan: I guess the other sea is fresh water. I hope it's shallow enough to ford.&lt;br /&gt;
:+2892:00&lt;br /&gt;
::Cueball: I'll go first, since you have the maps.&lt;br /&gt;
::Megan: I think this bag will keep them pretty dry if it has to. It's a good bag.&lt;br /&gt;
:+2893:00 [Crossing the water.]&lt;br /&gt;
::Cueball: Whoa, careful-the current gets strong!&lt;br /&gt;
::Megan: Oof!&lt;br /&gt;
:::It's not even that deep, but...&lt;br /&gt;
:::...I can barely...&lt;br /&gt;
::Cueball: Almost there.&lt;br /&gt;
:+2894:00 [At the other side.]&lt;br /&gt;
::Cueball: That was a little too close.&lt;br /&gt;
:::Oh, they definitely see us!&lt;br /&gt;
:::&amp;lt;big&amp;gt;'''''Hey!'''''&amp;lt;/big&amp;gt;:::&lt;br /&gt;
::Other people: !!!!!&lt;br /&gt;
::Megan: I think I can actually ''see'' it rising, at the edge.&lt;br /&gt;
:+2895:00 [Some people from their tribe appear.]&lt;br /&gt;
::Friend: You're back!&lt;br /&gt;
::Megan: The sea is not going to stop rising! We have to get to the mountains!&lt;br /&gt;
::Cueball: ...hello!&lt;br /&gt;
:+2896:00&lt;br /&gt;
::Friend: Where did you go?&lt;br /&gt;
::Megan: To the mountains! We learned everything!&lt;br /&gt;
::Friend: ''Everything?''&lt;br /&gt;
::Megan: Most of it! Where's everyone else?&lt;br /&gt;
:+2897:00&lt;br /&gt;
::Friend: The hills are empty!&lt;br /&gt;
::Megan: We know!&lt;br /&gt;
::Friend: It's great! We don't have to wait for them to throw stuff away! A bunch of us are up there right now going through what they left behind!&lt;br /&gt;
::Megan: But, the flood!&lt;br /&gt;
::Cueball: Oh, no.&lt;br /&gt;
:+2898:00&lt;br /&gt;
::Friend 1: The kids told us about the sea a few days ago. I said we should move to the hills, but others wanted to keep clear in case the people return.&lt;br /&gt;
::Friend 2: When we saw it was coming up the riverbed, I left with this group. The others are getting ready to leave but wanted to see if the water-&lt;br /&gt;
::Megan: How many?&lt;br /&gt;
::Friend 2: There are twelve of us back at camp.&lt;br /&gt;
::Megan: ...we have to go back.&lt;br /&gt;
::Cueball: Huh...&lt;br /&gt;
:::I think there's stuff floating on the sea.&lt;br /&gt;
:+2899:00&lt;br /&gt;
::Megan: We might be able to cross here, but the next group won't.&lt;br /&gt;
:::The currents are strong and the water has changed. It's getting fresher, like a river. We can't float across, unless any of you can swim on fresh water.&lt;br /&gt;
::Friend 3: My cousin says she can swim across a river.&lt;br /&gt;
::Megan: Well, can she carry all of us?&lt;br /&gt;
::Friend 3: I'll ask her.&lt;br /&gt;
::Megan: There seem to be more of these channels. We shouldn't split the group up further just to get trapped among them.&lt;br /&gt;
::Friend 3 (cont.): Except I can't find her...&lt;br /&gt;
::Friend 2: OK, what &amp;lt;i&amp;gt;do &amp;lt;/i&amp;gt;we do?&lt;br /&gt;
::Cueball: I think there's something on the sea.&lt;br /&gt;
:+2900:00&lt;br /&gt;
::Megan: We have to get everyone together.&lt;br /&gt;
:::We have to find something to help us cross rivers and sea-channels.&lt;br /&gt;
:::We have to head the other way,&lt;br /&gt;
:::across the plain,&lt;br /&gt;
:::toward the mountains.&lt;br /&gt;
:::We need to run.&lt;br /&gt;
:+2901:00 [They run.]&lt;br /&gt;
: +2902:00 [Cut to black.]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 4 - Part 2 (The tribe gets ready to move on their raft)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
:+2903:00&lt;br /&gt;
::Megan: As you can tell, the sea is coming up the river.&lt;br /&gt;
:::These low channels are going to fill quickly,&lt;br /&gt;
:::We need to get away from them, move along them on high ground to join up with the group in the hills, and then escape across the plains to the mountains.&lt;br /&gt;
:::I have maps to show us the way.&lt;br /&gt;
:+2904:00&lt;br /&gt;
::Cueball: To avoid being trapped by these sea-rivers-or the regular rivers-we need a way to cross them.&lt;br /&gt;
::Megan: They're too fresh to swim over, so we'll have to bring things to float with. They need to be light enough to carry, so wood won't work.&lt;br /&gt;
:+2905:00&lt;br /&gt;
::Megan: Bags might work; some of them can hold air if they get wet.&lt;br /&gt;
:::But grab whatever you can, we may already be too late.&lt;br /&gt;
:::And the currents are strong, so we'll need rope.&lt;br /&gt;
:+2906:00&lt;br /&gt;
::Megan: And I-&lt;br /&gt;
::Friend 3: HEY!&lt;br /&gt;
:+2907:00&lt;br /&gt;
::Friend 3: I found my cousin!&lt;br /&gt;
:+2909:00 [A giant raft beaches in front of them. At its helm is Friend 4 a.k.a Beret Girl from scene 1.]&lt;br /&gt;
:+2911:00&lt;br /&gt;
::Beret Girl: Hi!&lt;br /&gt;
:::I saw the water was trying to cover your neat castle,&lt;br /&gt;
:::So I made it into a boat!&lt;br /&gt;
:::&amp;lt;small&amp;gt;Most of the sand parts fell down.&amp;lt;/small&amp;gt;&lt;br /&gt;
:::When it came loose I floated for a while.&lt;br /&gt;
:::And then the sea pushed me up here.&lt;br /&gt;
:+2912:00&lt;br /&gt;
::Beret Girl: I don't know how to stop!&lt;br /&gt;
::Friend 2: [Runs to get bags] Oh, um. Rope!&lt;br /&gt;
:+2913:00&lt;br /&gt;
::[Friend 2 tethers the raft to a flower. Nearly everyone jumps aboard.]&lt;br /&gt;
:+2914:00&lt;br /&gt;
::Megan: OK, everyone!&lt;br /&gt;
:::Forget everything I just said. New plan.&lt;br /&gt;
:::We're going to do something that may never have been done before:&lt;br /&gt;
:+2915:00&lt;br /&gt;
::Megan: We're going to ride a raft up a river.&lt;br /&gt;
:::But we have to work fast.&lt;br /&gt;
:+2916:00&lt;br /&gt;
:[Cut to black.]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
====Scene 4 - Part 3 (The tribe on their raft)====&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible&amp;quot;&amp;gt;&lt;br /&gt;
:+2917:00 [People are frantically setting up the raft.]&lt;br /&gt;
:+2918:00 [Friend 1 puts up a sail.]&lt;br /&gt;
:+2919:00 [Friend 1 finishes putting up the sail/curtain. Provisions are loaded.]&lt;br /&gt;
:+2920:00&lt;br /&gt;
::Megan: The water is coming over the banks!&lt;br /&gt;
:::This place is ending and it's time to go.&lt;br /&gt;
:+2921:00 [The rest of the people board the raft.]&lt;br /&gt;
:+2922:00 [They start rowing away from camp. Beret Girl, her cousin and Megan sit on top and watch the others row.]&lt;br /&gt;
:+2928:00 [The view switches to panoramic view. Trees float by in their wake.]&lt;br /&gt;
:+2929:00&lt;br /&gt;
::Friend 2: This is really hard.&lt;br /&gt;
:::If we drift into the shallows,&lt;br /&gt;
:::we can sort of push back into the main channel.&lt;br /&gt;
:::But only barely.&lt;br /&gt;
:+2930:00&lt;br /&gt;
::Megan: That's OK - you've done great. We're headed straight up the river channel!&lt;br /&gt;
:+2931:00&lt;br /&gt;
::Megan: And we seem to be speeding up.&lt;br /&gt;
:+2932:00 [Megan trips.]&lt;br /&gt;
:+2933:00&lt;br /&gt;
::Megan: Oof.&lt;br /&gt;
:+2934:00&lt;br /&gt;
::Megan: Is there any way to keep us pointing forward?&lt;br /&gt;
::Cueball: We could start calling this the front.&lt;br /&gt;
:+2935:00&lt;br /&gt;
::Megan: OK, we're coming into the hills. We need a way to-&lt;br /&gt;
::Friend 1: Look!&lt;br /&gt;
:+2936:00 [Cut to panoramic shot. The obligatory floating trees are present.]&lt;br /&gt;
::Friend A: &amp;lt;big&amp;gt;&amp;lt;b&amp;gt;HEY!&amp;lt;/b&amp;gt;&amp;lt;/big&amp;gt;&lt;br /&gt;
::Friend B: HELLOOO!&lt;br /&gt;
::Friend 2: It's them!&lt;br /&gt;
:+2937:00&lt;br /&gt;
::[Aboard the other raft.]&lt;br /&gt;
::Friend C: Careful! Don't tip!&lt;br /&gt;
::Friend B: You're safe!&lt;br /&gt;
::[Aboard the S.S. Sandcastle...which is out of screen...]&lt;br /&gt;
::Voice 1: What is that?&lt;br /&gt;
::Voice 2: Head toward them!&lt;br /&gt;
::Voice 1: How?&lt;br /&gt;
::Voice 2: Oh. Right.&lt;br /&gt;
:+2938:00&lt;br /&gt;
::[Aboard the other raft.]&lt;br /&gt;
::Friend A: They're going to float past us. Can we push out into the current?&lt;br /&gt;
::[Aboard the S.S. Sandcastle, coming into view again...]&lt;br /&gt;
::Cueball: Who has the rope?&lt;br /&gt;
::[Aboard the other raft.]&lt;br /&gt;
::Friend C: Trying.&lt;br /&gt;
:+2939:00 [The rest of the tribe drifts past the main raft in a smaller raft of their own. Cueball twirls a lasso to try and catch them...]&lt;br /&gt;
:+2940:00 [...which flies in the air...]&lt;br /&gt;
:+2941:00 [...and hooks to something at the shore. Everyone on board S.S. Sandcastle starts pulling.]&lt;br /&gt;
::Cueball: Careful! Slow and steady - don't break the rope!&lt;br /&gt;
:+2942:00 [They did move the S.S. Sandcastle backwards. Cueball throws the next lasso.]&lt;br /&gt;
:+2943:00 [...the rope flies...]&lt;br /&gt;
:+2944:00 [...the people on the other raft manage to catch the rope.]&lt;br /&gt;
:+2945:00 [They put their rafts close together.]&lt;br /&gt;
::Friend B: We saw from the hills that the route back was washed out. So we found a raft and tried to get to you by the river.&lt;br /&gt;
::Friend C: But then the river started going backward and we got stuck.&lt;br /&gt;
::Cueball: We can explain.&lt;br /&gt;
::From crowd: Why is everything flooding?&lt;br /&gt;
::From crowd: Why is the water full of trees?&lt;br /&gt;
::From crowd: Why do you have little tables covered in sand?&lt;br /&gt;
::Cueball: But first-&lt;br /&gt;
:+2946:00 &lt;br /&gt;
::Cueball: What's our plan? How much time do you think we have to get across the plain?&lt;br /&gt;
::Megan: None.&lt;br /&gt;
::Cueball: OK, we have to move fast- &lt;br /&gt;
::Megan: -No. ''None.'' I figured out some of the maps.&lt;br /&gt;
:::If the sea is here, we're already cut off. There's nowhere else to run to.&lt;br /&gt;
:::We're going to have to ride this out.&lt;br /&gt;
:+2949:00 [A tent is pulled aboard (or built on the second raft from what they already had on board).]&lt;br /&gt;
:+2950:00 [The two rafts actually &amp;quot;hit&amp;quot; and everyone falls over.]&lt;br /&gt;
:+2951:00 [They continue wrapping the new tent in preparation to turn it into a sleeping area. The area under the main canopy has been turned into a sort of storage area.]&lt;br /&gt;
:+2952:00 [Cut to a panaromic view of the scene.]&lt;br /&gt;
:+2954:00 [A flock of geese flies overhead.]&lt;br /&gt;
:+2955:00 [Night falls. This time the Milky Way cannot be seen.]&lt;br /&gt;
:+2956:00 [It is day. Megan stands at the front while an insect buzzes overhead.]&lt;br /&gt;
:+2957:00 [Megan has climbed on top of the platform. Cueball looks at her from below.]  &lt;br /&gt;
::Megan: &amp;lt;small&amp;gt;hey.&amp;lt;/small&amp;gt;&lt;br /&gt;
:+2958:00 &lt;br /&gt;
::Megan: Everyone still asleep?&lt;br /&gt;
::Cueball (while climbing onto top platform): Yeah.&lt;br /&gt;
:+2959:00 [They proceed to rebuild their sandcastle using whatever sand is left.]&lt;br /&gt;
:+2961:00 [Cueball and Megan finish building a single turret.]&lt;br /&gt;
::Cueball (glancing over shoulder): ...Land!&lt;br /&gt;
:+2962:00 [Cueball and Megan are staring at the approaching land mass while standing at the front of the boat.]&lt;br /&gt;
::Megan: We've been heading right toward it since sunrise.&lt;br /&gt;
:+2963:00 [S.S. Sandcastle runs aground. Cueball runs to the sleeping tent to wake everyone up. Megan runs after him.]&lt;br /&gt;
::Cueball: Land! Wake up, everybody!&lt;br /&gt;
::Front of boat: &amp;lt;small&amp;gt;SCRAAAAAPE. CRUNCH. &amp;lt;/small&amp;gt;&lt;br /&gt;
:+2964:00 [The tribe exit their raft.]&lt;br /&gt;
::Cueball: Wow.&lt;br /&gt;
:+2965:00&lt;br /&gt;
::Cueball: Where do you think we are?&lt;br /&gt;
::Megan: I don't know.&lt;br /&gt;
:+2966:00&lt;br /&gt;
::Megan: But I bet we can figure it out. C'mon, let's see what's through here!&lt;br /&gt;
:+2968:00 [The End]&lt;br /&gt;
:+2968:00 [No people, just the shore and some trees.]&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
==Frame by Frame Breakdown==&lt;br /&gt;
Below is the list of all the frames of the comic, in the order that they were revealed. The given times denote the time since the comic was initially released on midnight, March 25, 2013, Eastern Daylight Saving Time (UTC - 0400).&lt;br /&gt;
&lt;br /&gt;
===March 2013===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
{| class=&amp;quot;wikitable plainlinks table-padding&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time.png|00:00]]||01/00:00||[[Media:time38.png|18:30]]||01/18:30||[[Media:time75.png|37:00]]||02/13:00||[[Media:time112.png|55:30]]||03/07:30||[[Media:time149.png|74:00]]||04/02:00||[[Media:time186.png|92:30]]||04/20:30||[[Media:time223.png|111:00]]||05/15:00||[[Media:time258P.png|137:00]]||06/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2.png|00:30]]||01/00:30||[[Media:time39.png|19:00]]||01/19:00||[[Media:time76.png|37:30]]||02/13:30||[[Media:time113.png|56:00]]||03/08:00||[[Media:time150.png|74:30]]||04/02:30||[[Media:time187.png|93:00]]||04/21:00||[[Media:time224.png|111:30]]||05/15:30||[[Media:time258.png|137:00]]||06/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time3.png|01:00]]||01/01:00||[[Media:time40.png|19:30]]||01/19:30||[[Media:time77.png|38:00]]||02/14:00||[[Media:time114.png|56:30]]||03/08:30||[[Media:time151.png|75:00]]||04/03:00||[[Media:time188.png|93:30]]||04/21:30||[[Media:time225.png|112:00]]||05/16:00||[[Media:time259.png|138:00]]||06/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time4.png|01:30]]||01/01:30||[[Media:time41.png|20:00]]||01/20:00||[[Media:time78.png|38:30]]||02/14:30||[[Media:time115.png|57:00]]||03/09:00||[[Media:time152.png|75:30]]||04/03:30||[[Media:time189.png|94:00]]||04/22:00||[[Media:time226.png|112:30]]||05/16:30||[[Media:time260.png|139:00]]||06/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time5.png|02:00]]||01/02:00||[[Media:time42.png|20:30]]||01/20:30||[[Media:time79.png|39:00]]||02/15:00||[[Media:time116.png|57:30]]||03/09:30||[[Media:time153.png|76:00]]||04/04:00||[[Media:time190.png|94:30]]||04/22:30||[[Media:time227.png|113:00]]||05/17:00||[[Media:time261.png|140:00]]||06/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time6.png|02:30]]||01/02:30||[[Media:time43.png|21:00]]||01/21:00||[[Media:time80.png|39:30]]||02/15:30||[[Media:time117.png|58:00]]||03/10:00||[[Media:time154.png|76:30]]||04/04:30||[[Media:time191.png|95:00]]||04/23:00||[[Media:time228.png|113:30]]||05/17:30||[[Media:time262.png|141:00]]||06/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time7.png|03:00]]||01/03:00||[[Media:time44.png|21:30]]||01/21:30||[[Media:time81.png|40:00]]||02/16:00||[[Media:time118.png|58:30]]||03/10:30||[[Media:time155.png|77:00]]||04/05:00||[[Media:time192.png|95:30]]||04/23:30||[[Media:time229.png|114:00]]||05/18:00||[[Media:time263.png|142:00]]||06/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time8.png|03:30]]||01/03:30||[[Media:time45.png|22:00]]||01/22:00||[[Media:time82.png|40:30]]||02/16:30||[[Media:time119.png|59:00]]||03/11:00||[[Media:time156.png|77:30]]||04/05:30||[[Media:time193.png|96:00]]||05/00:00||[[Media:time230.png|114:30]]||05/18:30||[[Media:time264.png|143:00]]||06/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time9.png|04:00]]||01/04:00||[[Media:time46.png|22:30]]||01/22:30||[[Media:time83.png|41:00]]||02/17:00||[[Media:time120.png|59:30]]||03/11:30||[[Media:time157.png|78:00]]||04/06:00||[[Media:time194.png|96:30]]||05/00:30||[[Media:time231.png|115:00]]||05/19:00||[[Media:time265.png|144:00]]||07/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time10.png|04:30]]||01/04:30||[[Media:time47.png|23:00]]||01/23:00||[[Media:time84.png|41:30]]||02/17:30||[[Media:time121.png|60:00]]||03/12:00||[[Media:time158.png|78:30]]||04/06:30||[[Media:time195.png|97:00]]||05/01:00||[[Media:time232.png|115:30]]||05/19:30||[[Media:time266.png|145:00]]||07/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time11.png|05:00]]||01/05:00||[[Media:time48.png|23:30]]||01/23:30||[[Media:time85.png|42:00]]||02/18:00||[[Media:time122.png|60:30]]||03/12:30||[[Media:time159.png|79:00]]||04/07:00||[[Media:time196.png|97:30]]||05/01:30||[[Media:time233.png|116:00]]||05/20:00||[[Media:time267.png|146:00]]||07/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time12.png|05:30]]||01/05:30||[[Media:time49.png|24:00]]||02/00:00||[[Media:time86.png|42:30]]||02/18:30||[[Media:time123.png|61:00]]||03/13:00||[[Media:time160.png|79:30]]||04/07:30||[[Media:time197.png|98:00]]||05/02:00||[[Media:time234.png|116:30]]||05/20:30||[[Media:time268.png|147:00]]||07/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time13.png|06:00]]||01/06:00||[[Media:time50.png|24:30]]||02/00:30||[[Media:time87.png|43:00]]||02/19:00||[[Media:time124.png|61:30]]||03/13:30||[[Media:time161.png|80:00]]||04/08:00||[[Media:time198.png|98:30]]||05/02:30||[[Media:time235.png|117:00]]||05/21:00||[[Media:time269.png|148:00]]||07/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time14.png|06:30]]||01/06:30||[[Media:time51.png|25:00]]||02/01:00||[[Media:time88.png|43:30]]||02/19:30||[[Media:time125.png|62:00]]||03/14:00||[[Media:time162.png|80:30]]||04/08:30||[[Media:time199.png|99:00]]||05/03:00||[[Media:time236.png|117:30]]||05/21:30||[[Media:time270.png|149:00]]||07/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time15.png|07:00]]||01/07:00||[[Media:time52.png|25:30]]||02/01:30||[[Media:time89.png|44:00]]||02/20:00||[[Media:time126.png|62:30]]||03/14:30||[[Media:time163.png|81:00]]||04/09:00||[[Media:time200.png|99:30]]||05/03:30||[[Media:time237.png|118:00]]||05/22:00||[[Media:time271.png|150:00]]||07/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time16.png|07:30]]||01/07:30||[[Media:time53.png|26:00]]||02/02:00||[[Media:time90.png|44:30]]||02/20:30||[[Media:time127.png|63:00]]||03/15:00||[[Media:time164.png|81:30]]||04/09:30||[[Media:time201.png|100:00]]||05/04:00||[[Media:time238.png|118:30]]||05/22:30||[[Media:time272.png|151:00]]||07/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time17.png|08:00]]||01/08:00||[[Media:time54.png|26:30]]||02/02:30||[[Media:time91.png|45:00]]||02/21:00||[[Media:time128.png|63:30]]||03/15:30||[[Media:time165.png|82:00]]||04/10:00||[[Media:time202.png|100:30]]||05/04:30||[[Media:time239.png|119:00]]||05/23:00||[[Media:time273.png|152:00]]||07/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time18.png|08:30]]||01/08:30||[[Media:time55.png|27:00]]||02/03:00||[[Media:time92.png|45:30]]||02/21:30||[[Media:time129.png|64:00]]||03/16:00||[[Media:time166.png|82:30]]||04/10:30||[[Media:time203.png|101:00]]||05/05:00||[[Media:time240.png|119:30]]||05/23:30||[[Media:time274.png|153:00]]||07/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time19.png|09:00]]||01/09:00||[[Media:time56.png|27:30]]||02/03:30||[[Media:time93.png|46:00]]||02/22:00||[[Media:time130.png|64:30]]||03/16:30||[[Media:time167.png|83:00]]||04/11:00||[[Media:time204.png|101:30]]||05/05:30||[[Media:time241.png|120:00]]||06/00:00||[[Media:time275.png|154:00]]||07/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time20.png|09:30]]||01/09:30||[[Media:time57.png|28:00]]||02/04:00||[[Media:time94.png|46:30]]||02/22:30||[[Media:time131.png|65:00]]||03/17:00||[[Media:time168.png|83:30]]||04/11:30||[[Media:time205.png|102:00]]||05/06:00||[[Media:time242.png|121:00]]||06/01:00||[[Media:time276.png|155:00]]||07/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time21.png|10:00]]||01/10:00||[[Media:time58.png|28:30]]||02/04:30||[[Media:time95.png|47:00]]||02/23:00||[[Media:time132.png|65:30]]||03/17:30||[[Media:time169.png|84:00]]||04/12:00||[[Media:time206.png|102:30]]||05/06:30||[[Media:time243.png|122:00]]||06/02:00||[[Media:time277.png|156:00]]||07/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time22.png|10:30]]||01/10:30||[[Media:time59.png|29:00]]||02/05:00||[[Media:time96.png|47:30]]||02/23:30||[[Media:time133.png|66:00]]||03/18:00||[[Media:time170.png|84:30]]||04/12:30||[[Media:time207.png|103:00]]||05/07:00||[[Media:time244.png|123:00]]||06/03:00||[[Media:time278.png|157:00]]||07/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time23.png|11:00]]||01/11:00||[[Media:time60.png|29:30]]||02/05:30||[[Media:time97.png|48:00]]||03/00:00||[[Media:time134.png|66:30]]||03/18:30||[[Media:time171.png|85:00]]||04/13:00||[[Media:time208.png|103:30]]||05/07:30||[[Media:time245.png|124:00]]||06/04:00||[[Media:time279.png|158:00]]||07/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time24.png|11:30]]||01/11:30||[[Media:time61.png|30:00]]||02/06:00||[[Media:time98.png|48:30]]||03/00:30||[[Media:time135.png|67:00]]||03/19:00||[[Media:time172.png|85:30]]||04/13:30||[[Media:time209.png|104:00]]||05/08:00||[[Media:time246.png|125:00]]||06/05:00||[[Media:time280.png|159:00]]||07/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time25.png|12:00]]||01/12:00||[[Media:time62.png|30:30]]||02/06:30||[[Media:time99.png|49:00]]||03/01:00||[[Media:time136.png|67:30]]||03/19:30||[[Media:time173.png|86:00]]||04/14:00||[[Media:time210.png|104:30]]||05/08:30||[[Media:time247.png|126:00]]||06/06:00||[[Media:time281.png|160:00]]||07/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time26.png|12:30]]||01/12:30||[[Media:time63.png|31:00]]||02/07:00||[[Media:time100.png|49:30]]||03/01:30||[[Media:time137.png|68:00]]||03/20:00||[[Media:time174.png|86:30]]||04/14:30||[[Media:time211.png|105:00]]||05/09:00||[[Media:time248.png|127:00]]||06/07:00||[[Media:time282.png|161:00]]||07/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time27.png|13:00]]||01/13:00||[[Media:time64.png|31:30]]||02/07:30||[[Media:time101.png|50:00]]||03/02:00||[[Media:time138.png|68:30]]||03/20:30||[[Media:time175.png|87:00]]||04/15:00||[[Media:time212.png|105:30]]||05/09:30||[[Media:time249.png|128:00]]||06/08:00||[[Media:time283.png|162:00]]||07/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time28.png|13:30]]||01/13:30||[[Media:time65.png|32:00]]||02/08:00||[[Media:time102.png|50:30]]||03/02:30||[[Media:time139.png|69:00]]||03/21:00||[[Media:time176.png|87:30]]||04/15:30||[[Media:time213.png|106:00]]||05/10:00||[[Media:time250.png|129:00]]||06/09:00||[[Media:time284.png|163:00]]||07/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time29.png|14:00]]||01/14:00||[[Media:time66.png|32:30]]||02/08:30||[[Media:time103.png|51:00]]||03/03:00||[[Media:time140.png|69:30]]||03/21:30||[[Media:time177.png|88:00]]||04/16:00||[[Media:time214.png|106:30]]||05/10:30||[[Media:time251.png|130:00]]||06/10:00||[[Media:time285.png|164:00]]||07/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time30.png|14:30]]||01/14:30||[[Media:time67.png|33:00]]||02/09:00||[[Media:time104.png|51:30]]||03/03:30||[[Media:time141.png|70:00]]||03/22:00||[[Media:time178.png|88:30]]||04/16:30||[[Media:time215.png|107:00]]||05/11:00||[[Media:time252.png|131:00]]||06/11:00||[[Media:time286.png|165:00]]||07/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time31.png|15:00]]||01/15:00||[[Media:time68.png|33:30]]||02/09:30||[[Media:time105.png|52:00]]||03/04:00||[[Media:time142.png|70:30]]||03/22:30||[[Media:time179.png|89:00]]||04/17:00||[[Media:time216.png|107:30]]||05/11:30||[[Media:time253.png|132:00]]||06/12:00||[[Media:time287.png|166:00]]||07/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time32.png|15:30]]||01/15:30||[[Media:time69.png|34:00]]||02/10:00||[[Media:time106.png|52:30]]||03/04:30||[[Media:time143.png|71:00]]||03/23:00||[[Media:time180.png|89:30]]||04/17:30||[[Media:time217.png|108:00]]||05/12:00||[[Media:time254.png|133:00]]||06/13:00||[[Media:time288.png|167:00]]||07/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time33.png|16:00]]||01/16:00||[[Media:time70.png|34:30]]||02/10:30||[[Media:time107.png|53:00]]||03/05:00||[[Media:time144.png|71:30]]||03/23:30||[[Media:time181.png|90:00]]||04/18:00||[[Media:time218.png|108:30]]||05/12:30||[[Media:time255.png|134:00]]||06/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time34.png|16:30]]||01/16:30||[[Media:time71.png|35:00]]||02/11:00||[[Media:time108.png|53:30]]||03/05:30||[[Media:time145.png|72:00]]||04/00:00||[[Media:time182.png|90:30]]||04/18:30||[[Media:time219.png|109:00]]||05/13:00||[[Media:time256P.png|135:00]]||06/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time35.png|17:00]]||01/17:00||[[Media:time72.png|35:30]]||02/11:30||[[Media:time109.png|54:00]]||03/06:00||[[Media:time146.png|72:30]]||04/00:30||[[Media:time183.png|91:00]]||04/19:00||[[Media:time220.png|109:30]]||05/13:30||[[Media:time256.png|135:00]]||06/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time36.png|17:30]]||01/17:30||[[Media:time73.png|36:00]]||02/12:00||[[Media:time110.png|54:30]]||03/06:30||[[Media:time147.png|73:00]]||04/01:00||[[Media:time184.png|91:30]]||04/19:30||[[Media:time221.png|110:00]]||05/14:00||[[Media:time257P.png|136:00]]||06/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time37.png|18:00]]||01/18:00||[[Media:time74.png|36:30]]||02/12:30||[[Media:time111.png|55:00]]||03/07:00||[[Media:time148.png|73:30]]||04/01:30||[[Media:time185.png|92:00]]||04/20:00||[[Media:time222.png|110:30]]||05/14:30||[[Media:time257.png|136:00]]||06/16:00&lt;br /&gt;
|}&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
===April 2013===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
{| class=&amp;quot;wikitable plainlinks table-padding&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time289.png|168:00]]||08/00:00||[[Media:time379.png|258:00]]||11/18:00||[[Media:time469.png|348:00]]||15/12:00||[[Media:time559.png|438:00]]||19/06:00||[[Media:time649.png|528:00]]||23/00:00||[[Media:time739.png|618:00]]||26/18:00||[[Media:time829.png|708:00]]||30/12:00||[[Media:time919.png|798:00]]||34/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time290.png|169:00]]||08/01:00||[[Media:time380.png|259:00]]||11/19:00||[[Media:time470.png|349:00]]||15/13:00||[[Media:time560.png|439:00]]||19/07:00||[[Media:time650.png|529:00]]||23/01:00||[[Media:time740.png|619:00]]||26/19:00||[[Media:time830.png|709:00]]||30/13:00||[[Media:time920.png|799:00]]||34/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time291.png|170:00]]||08/02:00||[[Media:time381.png|260:00]]||11/20:00||[[Media:time471.png|350:00]]||15/14:00||[[Media:time561.png|440:00]]||19/08:00||[[Media:time651.png|530:00]]||23/02:00||[[Media:time741.png|620:00]]||26/20:00||[[Media:time831.png|710:00]]||30/14:00||[[Media:time921.png|800:00]]||34/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time292.png|171:00]]||08/03:00||[[Media:time382.png|261:00]]||11/21:00||[[Media:time472.png|351:00]]||15/15:00||[[Media:time562.png|441:00]]||19/09:00||[[Media:time652.png|531:00]]||23/03:00||[[Media:time742.png|621:00]]||26/21:00||[[Media:time832.png|711:00]]||30/15:00||[[Media:time922.png|801:00]]||34/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time293.png|172:00]]||08/04:00||[[Media:time383.png|262:00]]||11/22:00||[[Media:time473.png|352:00]]||15/16:00||[[Media:time563.png|442:00]]||19/10:00||[[Media:time653.png|532:00]]||23/04:00||[[Media:time743.png|622:00]]||26/22:00||[[Media:time833.png|712:00]]||30/16:00||[[Media:time923.png|802:00]]||34/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time294.png|173:00]]||08/05:00||[[Media:time384.png|263:00]]||11/23:00||[[Media:time474.png|353:00]]||15/17:00||[[Media:time564.png|443:00]]||19/11:00||[[Media:time654.png|533:00]]||23/05:00||[[Media:time744.png|623:00]]||26/23:00||[[Media:time834.png|713:00]]||30/17:00||[[Media:time924.png|803:00]]||34/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time295.png|174:00]]||08/06:00||[[Media:time385.png|264:00]]||12/00:00||[[Media:time475.png|354:00]]||15/18:00||[[Media:time565.png|444:00]]||19/12:00||[[Media:time655.png|534:00]]||23/06:00||[[Media:time745.png|624:00]]||27/00:00||[[Media:time835.png|714:00]]||30/18:00||[[Media:time925.png|804:00]]||34/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time296.png|175:00]]||08/07:00||[[Media:time386.png|265:00]]||12/01:00||[[Media:time476.png|355:00]]||15/19:00||[[Media:time566.png|445:00]]||19/13:00||[[Media:time656.png|535:00]]||23/07:00||[[Media:time746.png|625:00]]||27/01:00||[[Media:time836.png|715:00]]||30/19:00||[[Media:time926.png|805:00]]||34/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time297.png|176:00]]||08/08:00||[[Media:time387.png|266:00]]||12/02:00||[[Media:time477.png|356:00]]||15/20:00||[[Media:time567.png|446:00]]||19/14:00||[[Media:time657.png|536:00]]||23/08:00||[[Media:time747.png|626:00]]||27/02:00||[[Media:time837.png|716:00]]||30/20:00||[[Media:time927.png|806:00]]||34/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time298.png|177:00]]||08/09:00||[[Media:time388.png|267:00]]||12/03:00||[[Media:time478.png|357:00]]||15/21:00||[[Media:time568.png|447:00]]||19/15:00||[[Media:time658.png|537:00]]||23/09:00||[[Media:time748.png|627:00]]||27/03:00||[[Media:time838.png|717:00]]||30/21:00||[[Media:time928.png|807:00]]||34/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time299.png|178:00]]||08/10:00||[[Media:time389.png|268:00]]||12/04:00||[[Media:time479.png|358:00]]||15/22:00||[[Media:time569.png|448:00]]||19/16:00||[[Media:time659.png|538:00]]||23/10:00||[[Media:time749.png|628:00]]||27/04:00||[[Media:time839.png|718:00]]||30/22:00||[[Media:time929.png|808:00]]||34/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time300.png|179:00]]||08/11:00||[[Media:time390.png|269:00]]||12/05:00||[[Media:time480.png|359:00]]||15/23:00||[[Media:time570.png|449:00]]||19/17:00||[[Media:time660.png|539:00]]||23/11:00||[[Media:time750.png|629:00]]||27/05:00||[[Media:time840.png|719:00]]||30/23:00||[[Media:time930.png|809:00]]||34/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time301.png|180:00]]||08/12:00||[[Media:time391.png|270:00]]||12/06:00||[[Media:time481.png|360:00]]||16/00:00||[[Media:time571.png|450:00]]||19/18:00||[[Media:time661.png|540:00]]||23/12:00||[[Media:time751.png|630:00]]||27/06:00||[[Media:time841.png|720:00]]||31/00:00||[[Media:time931.png|810:00]]||34/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time302.png|181:00]]||08/13:00||[[Media:time392.png|271:00]]||12/07:00||[[Media:time482.png|361:00]]||16/01:00||[[Media:time572.png|451:00]]||19/19:00||[[Media:time662.png|541:00]]||23/13:00||[[Media:time752.png|631:00]]||27/07:00||[[Media:time842.png|721:00]]||31/01:00||[[Media:time932.png|811:00]]||34/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time303.png|182:00]]||08/14:00||[[Media:time393.png|272:00]]||12/08:00||[[Media:time483.png|362:00]]||16/02:00||[[Media:time573.png|452:00]]||19/20:00||[[Media:time663.png|542:00]]||23/14:00||[[Media:time753.png|632:00]]||27/08:00||[[Media:time843.png|722:00]]||31/02:00||[[Media:time933.png|812:00]]||34/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time304.png|183:00]]||08/15:00||[[Media:time394.png|273:00]]||12/09:00||[[Media:time484.png|363:00]]||16/03:00||[[Media:time574.png|453:00]]||19/21:00||[[Media:time664.png|543:00]]||23/15:00||[[Media:time754.png|633:00]]||27/09:00||[[Media:time844.png|723:00]]||31/03:00||[[Media:time934.png|813:00]]||34/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time305.png|184:00]]||08/16:00||[[Media:time395.png|274:00]]||12/10:00||[[Media:time485.png|364:00]]||16/04:00||[[Media:time575.png|454:00]]||19/22:00||[[Media:time665.png|544:00]]||23/16:00||[[Media:time755.png|634:00]]||27/10:00||[[Media:time845.png|724:00]]||31/04:00||[[Media:time935.png|814:00]]||34/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time306.png|185:00]]||08/17:00||[[Media:time396.png|275:00]]||12/11:00||[[Media:time486.png|365:00]]||16/05:00||[[Media:time576.png|455:00]]||19/23:00||[[Media:time666.png|545:00]]||23/17:00||[[Media:time756.png|635:00]]||27/11:00||[[Media:time846.png|725:00]]||31/05:00||[[Media:time936.png|815:00]]||34/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time307.png|186:00]]||08/18:00||[[Media:time397.png|276:00]]||12/12:00||[[Media:time487.png|366:00]]||16/06:00||[[Media:time577.png|456:00]]||20/00:00||[[Media:time667.png|546:00]]||23/18:00||[[Media:time757.png|636:00]]||27/12:00||[[Media:time847.png|726:00]]||31/06:00||[[Media:time937.png|816:00]]||35/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time308.png|187:00]]||08/19:00||[[Media:time398.png|277:00]]||12/13:00||[[Media:time488.png|367:00]]||16/07:00||[[Media:time578.png|457:00]]||20/01:00||[[Media:time668.png|547:00]]||23/19:00||[[Media:time758.png|637:00]]||27/13:00||[[Media:time848.png|727:00]]||31/07:00||[[Media:time938.png|817:00]]||35/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time309.png|188:00]]||08/20:00||[[Media:time399.png|278:00]]||12/14:00||[[Media:time489.png|368:00]]||16/08:00||[[Media:time579.png|458:00]]||20/02:00||[[Media:time669.png|548:00]]||23/20:00||[[Media:time759.png|638:00]]||27/14:00||[[Media:time849.png|728:00]]||31/08:00||[[Media:time939.png|818:00]]||35/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time310.png|189:00]]||08/21:00||[[Media:time400.png|279:00]]||12/15:00||[[Media:time490.png|369:00]]||16/09:00||[[Media:time580.png|459:00]]||20/03:00||[[Media:time670.png|549:00]]||23/21:00||[[Media:time760.png|639:00]]||27/15:00||[[Media:time850.png|729:00]]||31/09:00||[[Media:time940.png|819:00]]||35/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time311.png|190:00]]||08/22:00||[[Media:time401.png|280:00]]||12/16:00||[[Media:time491.png|370:00]]||16/10:00||[[Media:time581.png|460:00]]||20/04:00||[[Media:time671.png|550:00]]||23/22:00||[[Media:time761.png|640:00]]||27/16:00||[[Media:time851.png|730:00]]||31/10:00||[[Media:time941.png|820:00]]||35/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time312.png|191:00]]||08/23:00||[[Media:time402.png|281:00]]||12/17:00||[[Media:time492.png|371:00]]||16/11:00||[[Media:time582.png|461:00]]||20/05:00||[[Media:time672.png|551:00]]||23/23:00||[[Media:time762.png|641:00]]||27/17:00||[[Media:time852.png|731:00]]||31/11:00||[[Media:time942.png|821:00]]||35/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time313.png|192:00]]||09/00:00||[[Media:time403.png|282:00]]||12/18:00||[[Media:time493.png|372:00]]||16/12:00||[[Media:time583.png|462:00]]||20/06:00||[[Media:time673.png|552:00]]||24/00:00||[[Media:time763.png|642:00]]||27/18:00||[[Media:time853.png|732:00]]||31/12:00||[[Media:time943.png|822:00]]||35/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time314.png|193:00]]||09/01:00||[[Media:time404.png|283:00]]||12/19:00||[[Media:time494.png|373:00]]||16/13:00||[[Media:time584.png|463:00]]||20/07:00||[[Media:time674.png|553:00]]||24/01:00||[[Media:time764.png|643:00]]||27/19:00||[[Media:time854.png|733:00]]||31/13:00||[[Media:time944.png|823:00]]||35/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time315.png|194:00]]||09/02:00||[[Media:time405.png|284:00]]||12/20:00||[[Media:time495.png|374:00]]||16/14:00||[[Media:time585.png|464:00]]||20/08:00||[[Media:time675.png|554:00]]||24/02:00||[[Media:time765.png|644:00]]||27/20:00||[[Media:time855.png|734:00]]||31/14:00||[[Media:time945.png|824:00]]||35/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time316.png|195:00]]||09/03:00||[[Media:time406.png|285:00]]||12/21:00||[[Media:time496.png|375:00]]||16/15:00||[[Media:time586.png|465:00]]||20/09:00||[[Media:time676.png|555:00]]||24/03:00||[[Media:time766.png|645:00]]||27/21:00||[[Media:time856.png|735:00]]||31/15:00||[[Media:time946.png|825:00]]||35/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time317.png|196:00]]||09/04:00||[[Media:time407.png|286:00]]||12/22:00||[[Media:time497.png|376:00]]||16/16:00||[[Media:time587.png|466:00]]||20/10:00||[[Media:time677.png|556:00]]||24/04:00||[[Media:time767.png|646:00]]||27/22:00||[[Media:time857.png|736:00]]||31/16:00||[[Media:time947.png|826:00]]||35/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time318.png|197:00]]||09/05:00||[[Media:time408.png|287:00]]||12/23:00||[[Media:time498.png|377:00]]||16/17:00||[[Media:time588.png|467:00]]||20/11:00||[[Media:time678.png|557:00]]||24/05:00||[[Media:time768.png|647:00]]||27/23:00||[[Media:time858.png|737:00]]||31/17:00||[[Media:time948.png|827:00]]||35/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time319.png|198:00]]||09/06:00||[[Media:time409.png|288:00]]||13/00:00||[[Media:time499.png|378:00]]||16/18:00||[[Media:time589.png|468:00]]||20/12:00||[[Media:time679.png|558:00]]||24/06:00||[[Media:time769.png|648:00]]||28/00:00||[[Media:time859.png|738:00]]||31/18:00||[[Media:time949.png|828:00]]||35/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time320.png|199:00]]||09/07:00||[[Media:time410.png|289:00]]||13/01:00||[[Media:time500.png|379:00]]||16/19:00||[[Media:time590.png|469:00]]||20/13:00||[[Media:time680.png|559:00]]||24/07:00||[[Media:time770.png|649:00]]||28/01:00||[[Media:time860.png|739:00]]||31/19:00||[[Media:time950.png|829:00]]||35/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time321.png|200:00]]||09/08:00||[[Media:time411.png|290:00]]||13/02:00||[[Media:time501.png|380:00]]||16/20:00||[[Media:time591.png|470:00]]||20/14:00||[[Media:time681.png|560:00]]||24/08:00||[[Media:time771.png|650:00]]||28/02:00||[[Media:time861.png|740:00]]||31/20:00||[[Media:time951.png|830:00]]||35/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time322.png|201:00]]||09/09:00||[[Media:time412.png|291:00]]||13/03:00||[[Media:time502.png|381:00]]||16/21:00||[[Media:time592.png|471:00]]||20/15:00||[[Media:time682.png|561:00]]||24/10:40||[[Media:time772.png|651:00]]||28/03:00||[[Media:time862.png|741:00]]||31/21:00||[[Media:time952.png|831:00]]||35/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time323.png|202:00]]||09/10:00||[[Media:time413.png|292:00]]||13/04:00||[[Media:time503.png|382:00]]||16/22:00||[[Media:time593.png|472:00]]||20/16:00||[[Media:time683.png|562:00]]||24/10:50||[[Media:time773.png|652:00]]||28/04:00||[[Media:time863.png|742:00]]||31/22:00||[[Media:time953.png|832:00]]||35/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time324.png|203:00]]||09/11:00||[[Media:time414.png|293:00]]||13/05:00||[[Media:time504.png|383:00]]||16/23:00||[[Media:time594.png|473:00]]||20/17:00||[[Media:time684.png|563:00]]||24/11:00||[[Media:time774.png|653:00]]||28/05:00||[[Media:time864.png|743:00]]||31/23:00||[[Media:time954.png|833:00]]||35/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time325.png|204:00]]||09/12:00||[[Media:time415.png|294:00]]||13/06:00||[[Media:time505.png|384:00]]||17/00:00||[[Media:time595.png|474:00]]||20/18:00||[[Media:time685.png|564:00]]||24/12:00||[[Media:time775.png|654:00]]||28/06:00||[[Media:time865.png|744:00]]||32/00:00||[[Media:time955.png|834:00]]||35/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time326.png|205:00]]||09/13:00||[[Media:time416.png|295:00]]||13/07:00||[[Media:time506.png|385:00]]||17/01:00||[[Media:time596.png|475:00]]||20/19:00||[[Media:time686.png|565:00]]||24/13:00||[[Media:time776.png|655:00]]||28/07:00||[[Media:time866.png|745:00]]||32/01:00||[[Media:time956.png|835:00]]||35/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time327.png|206:00]]||09/14:00||[[Media:time417.png|296:00]]||13/08:00||[[Media:time507.png|386:00]]||17/02:00||[[Media:time597.png|476:00]]||20/20:00||[[Media:time687.png|566:00]]||24/14:00||[[Media:time777.png|656:00]]||28/08:00||[[Media:time867.png|746:00]]||32/02:00||[[Media:time957.png|836:00]]||35/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time328.png|207:00]]||09/15:00||[[Media:time418.png|297:00]]||13/09:00||[[Media:time508.png|387:00]]||17/03:00||[[Media:time598.png|477:00]]||20/21:00||[[Media:time688.png|567:00]]||24/15:00||[[Media:time778.png|657:00]]||28/09:00||[[Media:time868.png|747:00]]||32/03:00||[[Media:time958.png|837:00]]||35/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time329.png|208:00]]||09/16:00||[[Media:time419.png|298:00]]||13/10:00||[[Media:time509.png|388:00]]||17/04:00||[[Media:time599.png|478:00]]||20/22:00||[[Media:time689.png|568:00]]||24/16:00||[[Media:time779.png|658:00]]||28/10:00||[[Media:time869.png|748:00]]||32/04:00||[[Media:time959.png|838:00]]||35/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time330.png|209:00]]||09/17:00||[[Media:time420.png|299:00]]||13/11:00||[[Media:time510.png|389:00]]||17/05:00||[[Media:time600.png|479:00]]||20/23:00||[[Media:time690.png|569:00]]||24/17:00||[[Media:time780.png|659:00]]||28/11:00||[[Media:time870.png|749:00]]||32/05:00||[[Media:time960.png|839:00]]||35/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time331.png|210:00]]||09/18:00||[[Media:time421.png|300:00]]||13/12:00||[[Media:time511.png|390:00]]||17/06:00||[[Media:time601.png|480:00]]||21/00:00||[[Media:time691.png|570:00]]||24/18:00||[[Media:time781.png|660:00]]||28/12:00||[[Media:time871.png|750:00]]||32/06:00||[[Media:time961.png|840:00]]||36/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time332.png|211:00]]||09/19:00||[[Media:time422.png|301:00]]||13/13:00||[[Media:time512.png|391:00]]||17/07:00||[[Media:time602.png|481:00]]||21/01:00||[[Media:time692.png|571:00]]||24/19:00||[[Media:time782.png|661:00]]||28/13:00||[[Media:time872.png|751:00]]||32/07:00||[[Media:time962.png|841:00]]||36/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time333.png|212:00]]||09/20:00||[[Media:time423.png|302:00]]||13/14:00||[[Media:time513.png|392:00]]||17/08:00||[[Media:time603.png|482:00]]||21/02:00||[[Media:time693.png|572:00]]||24/20:00||[[Media:time783.png|662:00]]||28/14:00||[[Media:time873.png|752:00]]||32/08:00||[[Media:time963.png|842:00]]||36/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time334.png|213:00]]||09/21:00||[[Media:time424.png|303:00]]||13/15:00||[[Media:time514.png|393:00]]||17/09:00||[[Media:time604.png|483:00]]||21/03:00||[[Media:time694.png|573:00]]||24/21:00||[[Media:time784.png|663:00]]||28/15:00||[[Media:time874.png|753:00]]||32/09:00||[[Media:time964.png|843:00]]||36/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time335.png|214:00]]||09/22:00||[[Media:time425.png|304:00]]||13/16:00||[[Media:time515.png|394:00]]||17/10:00||[[Media:time605.png|484:00]]||21/04:00||[[Media:time695.png|574:00]]||24/22:00||[[Media:time785.png|664:00]]||28/16:00||[[Media:time875.png|754:00]]||32/10:00||[[Media:time965.png|844:00]]||36/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time336.png|215:00]]||09/23:00||[[Media:time426.png|305:00]]||13/17:00||[[Media:time516.png|395:00]]||17/11:00||[[Media:time606.png|485:00]]||21/05:00||[[Media:time696.png|575:00]]||24/23:00||[[Media:time786.png|665:00]]||28/17:00||[[Media:time876.png|755:00]]||32/11:00||[[Media:time966.png|845:00]]||36/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time337.png|216:00]]||10/00:00||[[Media:time427.png|306:00]]||13/18:00||[[Media:time517.png|396:00]]||17/12:00||[[Media:time607.png|486:00]]||21/06:00||[[Media:time697.png|576:00]]||25/00:00||[[Media:time787.png|666:00]]||28/18:00||[[Media:time877.png|756:00]]||32/12:00||[[Media:time967.png|846:00]]||36/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time338.png|217:00]]||10/01:00||[[Media:time428.png|307:00]]||13/19:00||[[Media:time518.png|397:00]]||17/13:00||[[Media:time608.png|487:00]]||21/07:00||[[Media:time698.png|577:00]]||25/01:00||[[Media:time788.png|667:00]]||28/19:00||[[Media:time878.png|757:00]]||32/13:00||[[Media:time968.png|847:00]]||36/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time339.png|218:00]]||10/02:00||[[Media:time429.png|308:00]]||13/20:00||[[Media:time519.png|398:00]]||17/14:00||[[Media:time609.png|488:00]]||21/08:00||[[Media:time699.png|578:00]]||25/02:00||[[Media:time789.png|668:00]]||28/20:00||[[Media:time879.png|758:00]]||32/14:00||[[Media:time969.png|848:00]]||36/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time340.png|219:00]]||10/03:00||[[Media:time430.png|309:00]]||13/21:00||[[Media:time520.png|399:00]]||17/15:00||[[Media:time610.png|489:00]]||21/09:00||[[Media:time700.png|579:00]]||25/03:00||[[Media:time790.png|669:00]]||28/21:00||[[Media:time880.png|759:00]]||32/15:00||[[Media:time970.png|849:00]]||36/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time341.png|220:00]]||10/04:00||[[Media:time431.png|310:00]]||13/22:00||[[Media:time521.png|400:00]]||17/16:00||[[Media:time611.png|490:00]]||21/10:00||[[Media:time701.png|580:00]]||25/04:00||[[Media:time791.png|670:00]]||28/22:00||[[Media:time881.png|760:00]]||32/16:00||[[Media:time971.png|850:00]]||36/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time342.png|221:00]]||10/05:00||[[Media:time432.png|311:00]]||13/23:00||[[Media:time522.png|401:00]]||17/17:00||[[Media:time612.png|491:00]]||21/11:00||[[Media:time702.png|581:00]]||25/05:00||[[Media:time792.png|671:00]]||28/23:00||[[Media:time882.png|761:00]]||32/17:00||[[Media:time972.png|851:00]]||36/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time343.png|222:00]]||10/06:00||[[Media:time433.png|312:00]]||14/00:00||[[Media:time523.png|402:00]]||17/18:00||[[Media:time613.png|492:00]]||21/12:00||[[Media:time703.png|582:00]]||25/06:00||[[Media:time793.png|672:00]]||29/00:00||[[Media:time883.png|762:00]]||32/18:00||[[Media:time973.png|852:00]]||36/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time344.png|223:00]]||10/07:00||[[Media:time434.png|313:00]]||14/01:00||[[Media:time524.png|403:00]]||17/19:00||[[Media:time614.png|493:00]]||21/13:00||[[Media:time704.png|583:00]]||25/07:00||[[Media:time794.png|673:00]]||29/01:00||[[Media:time884.png|763:00]]||32/19:00||[[Media:time974.png|853:00]]||36/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time345.png|224:00]]||10/08:00||[[Media:time435.png|314:00]]||14/02:00||[[Media:time525.png|404:00]]||17/20:00||[[Media:time615.png|494:00]]||21/14:00||[[Media:time705.png|584:00]]||25/08:00||[[Media:time795.png|674:00]]||29/02:00||[[Media:time885.png|764:00]]||32/20:00||[[Media:time975.png|854:00]]||36/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time346.png|225:00]]||10/09:00||[[Media:time436.png|315:00]]||14/03:00||[[Media:time526.png|405:00]]||17/21:00||[[Media:time616.png|495:00]]||21/15:00||[[Media:time706.png|585:00]]||25/09:00||[[Media:time796.png|675:00]]||29/03:00||[[Media:time886.png|765:00]]||32/21:00||[[Media:time976.png|855:00]]||36/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time347.png|226:00]]||10/10:00||[[Media:time437.png|316:00]]||14/04:00||[[Media:time527.png|406:00]]||17/22:00||[[Media:time617.png|496:00]]||21/16:00||[[Media:time707.png|586:00]]||25/10:00||[[Media:time797.png|676:00]]||29/04:00||[[Media:time887.png|766:00]]||32/22:00||[[Media:time977.png|856:00]]||36/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time348.png|227:00]]||10/11:00||[[Media:time438.png|317:00]]||14/05:00||[[Media:time528.png|407:00]]||17/23:00||[[Media:time618.png|497:00]]||21/17:00||[[Media:time708.png|587:00]]||25/11:00||[[Media:time798.png|677:00]]||29/05:00||[[Media:time888.png|767:00]]||32/23:00||[[Media:time978.png|857:00]]||36/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time349.png|228:00]]||10/12:00||[[Media:time439.png|318:00]]||14/06:00||[[Media:time529.png|408:00]]||18/00:00||[[Media:time619.png|498:00]]||21/18:00||[[Media:time709.png|588:00]]||25/12:00||[[Media:time799.png|678:00]]||29/06:00||[[Media:time889.png|768:00]]||33/00:00||[[Media:time979.png|858:00]]||36/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time350.png|229:00]]||10/13:00||[[Media:time440.png|319:00]]||14/07:00||[[Media:time530.png|409:00]]||18/01:00||[[Media:time620.png|499:00]]||21/19:00||[[Media:time710.png|589:00]]||25/13:00||[[Media:time800.png|679:00]]||29/07:00||[[Media:time890.png|769:00]]||33/01:00||[[Media:time980.png|859:00]]||36/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time351.png|230:00]]||10/14:00||[[Media:time441.png|320:00]]||14/08:00||[[Media:time531.png|410:00]]||18/02:00||[[Media:time621.png|500:00]]||21/20:00||[[Media:time711.png|590:00]]||25/14:00||[[Media:time801.png|680:00]]||29/08:00||[[Media:time891.png|770:00]]||33/02:00||[[Media:time981.png|860:00]]||36/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time352.png|231:00]]||10/15:00||[[Media:time442.png|321:00]]||14/09:00||[[Media:time532.png|411:00]]||18/03:00||[[Media:time622.png|501:00]]||21/21:00||[[Media:time712.png|591:00]]||25/15:00||[[Media:time802.png|681:00]]||29/09:00||[[Media:time892.png|771:00]]||33/03:00||[[Media:time982.png|861:00]]||36/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time353.png|232:00]]||10/16:00||[[Media:time443.png|322:00]]||14/10:00||[[Media:time533.png|412:00]]||18/04:00||[[Media:time623.png|502:00]]||21/22:00||[[Media:time713.png|592:00]]||25/16:00||[[Media:time803.png|682:00]]||29/10:00||[[Media:time893.png|772:00]]||33/04:00||[[Media:time983.png|862:00]]||36/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time354.png|233:00]]||10/17:00||[[Media:time444.png|323:00]]||14/11:00||[[Media:time534.png|413:00]]||18/05:00||[[Media:time624.png|503:00]]||21/23:00||[[Media:time714.png|593:00]]||25/17:00||[[Media:time804.png|683:00]]||29/11:00||[[Media:time894.png|773:00]]||33/05:00||[[Media:time984.png|863:00]]||36/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time355.png|234:00]]||10/18:00||[[Media:time445.png|324:00]]||14/12:00||[[Media:time535.png|414:00]]||18/06:00||[[Media:time625.png|504:00]]||22/00:00||[[Media:time715.png|594:00]]||25/18:00||[[Media:time805.png|684:00]]||29/12:00||[[Media:time895.png|774:00]]||33/06:00||[[Media:time985.png|864:00]]||37/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time356.png|235:00]]||10/19:00||[[Media:time446.png|325:00]]||14/13:00||[[Media:time536.png|415:00]]||18/07:00||[[Media:time626.png|505:00]]||22/01:00||[[Media:time716.png|595:00]]||25/19:00||[[Media:time806.png|685:00]]||29/13:00||[[Media:time896.png|775:00]]||33/07:00||[[Media:time986.png|865:00]]||37/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time357.png|236:00]]||10/20:00||[[Media:time447.png|326:00]]||14/14:00||[[Media:time537.png|416:00]]||18/08:00||[[Media:time627.png|506:00]]||22/02:00||[[Media:time717.png|596:00]]||25/20:00||[[Media:time807.png|686:00]]||29/14:00||[[Media:time897.png|776:00]]||33/08:00||[[Media:time987.png|866:00]]||37/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time358.png|237:00]]||10/21:00||[[Media:time448.png|327:00]]||14/15:00||[[Media:time538.png|417:00]]||18/09:00||[[Media:time628.png|507:00]]||22/03:00||[[Media:time718.png|597:00]]||25/21:00||[[Media:time808.png|687:00]]||29/15:00||[[Media:time898.png|777:00]]||33/09:00||[[Media:time988.png|867:00]]||37/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time359.png|238:00]]||10/22:00||[[Media:time449.png|328:00]]||14/16:00||[[Media:time539.png|418:00]]||18/10:00||[[Media:time629.png|508:00]]||22/04:00||[[Media:time719.png|598:00]]||25/22:00||[[Media:time809.png|688:00]]||29/16:00||[[Media:time899.png|778:00]]||33/10:00||[[Media:time989.png|868:00]]||37/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time360.png|239:00]]||10/23:00||[[Media:time450.png|329:00]]||14/17:00||[[Media:time540.png|419:00]]||18/11:00||[[Media:time630.png|509:00]]||22/05:00||[[Media:time720.png|599:00]]||25/23:00||[[Media:time810.png|689:00]]||29/17:00||[[Media:time900.png|779:00]]||33/11:00||[[Media:time990.png|869:00]]||37/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time361.png|240:00]]||11/00:00||[[Media:time451.png|330:00]]||14/18:00||[[Media:time541.png|420:00]]||18/12:00||[[Media:time631.png|510:00]]||22/06:00||[[Media:time721.png|600:00]]||26/00:00||[[Media:time811.png|690:00]]||29/18:00||[[Media:time901.png|780:00]]||33/12:00||[[Media:time991.png|870:00]]||37/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time362.png|241:00]]||11/01:00||[[Media:time452.png|331:00]]||14/19:00||[[Media:time542.png|421:00]]||18/13:00||[[Media:time632.png|511:00]]||22/07:00||[[Media:time722.png|601:00]]||26/01:00||[[Media:time812.png|691:00]]||29/19:00||[[Media:time902.png|781:00]]||33/13:00||[[Media:time992.png|871:00]]||37/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time363.png|242:00]]||11/02:00||[[Media:time453.png|332:00]]||14/20:00||[[Media:time543.png|422:00]]||18/14:00||[[Media:time633.png|512:00]]||22/08:00||[[Media:time723.png|602:00]]||26/02:00||[[Media:time813.png|692:00]]||29/20:00||[[Media:time903.png|782:00]]||33/14:00||[[Media:time993.png|872:00]]||37/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time364.png|243:00]]||11/03:00||[[Media:time454.png|333:00]]||14/21:00||[[Media:time544.png|423:00]]||18/15:00||[[Media:time634.png|513:00]]||22/09:00||[[Media:time724.png|603:00]]||26/03:00||[[Media:time814.png|693:00]]||29/21:00||[[Media:time904.png|783:00]]||33/15:00||[[Media:time994.png|873:00]]||37/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time365.png|244:00]]||11/04:00||[[Media:time455.png|334:00]]||14/22:00||[[Media:time545.png|424:00]]||18/16:00||[[Media:time635.png|514:00]]||22/10:00||[[Media:time725.png|604:00]]||26/04:00||[[Media:time815.png|694:00]]||29/22:00||[[Media:time905.png|784:00]]||33/16:00||[[Media:time995.png|874:00]]||37/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time366.png|245:00]]||11/05:00||[[Media:time456.png|335:00]]||14/23:00||[[Media:time546.png|425:00]]||18/17:00||[[Media:time636.png|515:00]]||22/11:00||[[Media:time726.png|605:00]]||26/05:00||[[Media:time816.png|695:00]]||29/23:00||[[Media:time906.png|785:00]]||33/17:00||[[Media:time996.png|875:00]]||37/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time367.png|246:00]]||11/06:00||[[Media:time457.png|336:00]]||15/00:00||[[Media:time547.png|426:00]]||18/18:00||[[Media:time637.png|516:00]]||22/12:00||[[Media:time727.png|606:00]]||26/06:00||[[Media:time817.png|696:00]]||30/00:00||[[Media:time907.png|786:00]]||33/18:00||[[Media:time997.png|876:00]]||37/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time368.png|247:00]]||11/07:00||[[Media:time458.png|337:00]]||15/01:00||[[Media:time548.png|427:00]]||18/19:00||[[Media:time638.png|517:00]]||22/13:00||[[Media:time728.png|607:00]]||26/07:00||[[Media:time818.png|697:00]]||30/01:00||[[Media:time908.png|787:00]]||33/19:00||[[Media:time998.png|877:00]]||37/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time369.png|248:00]]||11/08:00||[[Media:time459.png|338:00]]||15/02:00||[[Media:time549.png|428:00]]||18/20:00||[[Media:time639.png|518:00]]||22/14:00||[[Media:time729.png|608:00]]||26/08:00||[[Media:time819.png|698:00]]||30/02:00||[[Media:time909.png|788:00]]||33/20:00||[[Media:time999.png|878:00]]||37/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time370.png|249:00]]||11/09:00||[[Media:time460.png|339:00]]||15/03:00||[[Media:time550.png|429:00]]||18/21:00||[[Media:time640.png|519:00]]||22/15:00||[[Media:time730.png|609:00]]||26/09:00||[[Media:time820.png|699:00]]||30/03:00||[[Media:time910.png|789:00]]||33/21:00||[[Media:time1000.png|879:00]]||37/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time371.png|250:00]]||11/10:00||[[Media:time461.png|340:00]]||15/04:00||[[Media:time551.png|430:00]]||18/22:00||[[Media:time641.png|520:00]]||22/16:00||[[Media:time731.png|610:00]]||26/10:00||[[Media:time821.png|700:00]]||30/04:00||[[Media:time911.png|790:00]]||33/22:00||[[Media:time1001.png|880:00]]||37/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time372.png|251:00]]||11/11:00||[[Media:time462.png|341:00]]||15/05:00||[[Media:time552.png|431:00]]||18/23:00||[[Media:time642.png|521:00]]||22/17:00||[[Media:time732.png|611:00]]||26/11:00||[[Media:time822.png|701:00]]||30/05:00||[[Media:time912.png|791:00]]||33/23:00||[[Media:time1002.png|881:00]]||37/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time373.png|252:00]]||11/12:00||[[Media:time463.png|342:00]]||15/06:00||[[Media:time553.png|432:00]]||19/00:00||[[Media:time643.png|522:00]]||22/18:00||[[Media:time733.png|612:00]]||26/12:00||[[Media:time823.png|702:00]]||30/06:00||[[Media:time913.png|792:00]]||34/00:00||[[Media:time1003.png|882:00]]||37/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time374.png|253:00]]||11/13:00||[[Media:time464.png|343:00]]||15/07:00||[[Media:time554.png|433:00]]||19/01:00||[[Media:time644.png|523:00]]||22/19:00||[[Media:time734.png|613:00]]||26/13:00||[[Media:time824.png|703:00]]||30/07:00||[[Media:time914.png|793:00]]||34/01:00||[[Media:time1004.png|883:00]]||37/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time375.png|254:00]]||11/14:00||[[Media:time465.png|344:00]]||15/08:00||[[Media:time555.png|434:00]]||19/02:00||[[Media:time645.png|524:00]]||22/20:00||[[Media:time735.png|614:00]]||26/14:00||[[Media:time825.png|704:00]]||30/08:00||[[Media:time915.png|794:00]]||34/02:00||[[Media:time1005.png|884:00]]||37/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time376.png|255:00]]||11/15:00||[[Media:time466.png|345:00]]||15/09:00||[[Media:time556.png|435:00]]||19/03:00||[[Media:time646.png|525:00]]||22/21:00||[[Media:time736.png|615:00]]||26/15:00||[[Media:time826.png|705:00]]||30/09:00||[[Media:time916.png|795:00]]||34/03:00||[[Media:time1006.png|885:00]]||37/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time377.png|256:00]]||11/16:00||[[Media:time467.png|346:00]]||15/10:00||[[Media:time557.png|436:00]]||19/04:00||[[Media:time647.png|526:00]]||22/22:00||[[Media:time737.png|616:00]]||26/16:00||[[Media:time827.png|706:00]]||30/10:00||[[Media:time917.png|796:00]]||34/04:00||[[Media:time1007.png|886:00]]||37/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time378.png|257:00]]||11/17:00||[[Media:time468.png|347:00]]||15/11:00||[[Media:time558.png|437:00]]||19/05:00||[[Media:time648.png|527:00]]||22/23:00||[[Media:time738.png|617:00]]||26/17:00||[[Media:time828.png|707:00]]||30/11:00||[[Media:time918.png|797:00]]||34/05:00||[[Media:time1008.png|887:00]]||37/23:00&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=====Day 36, Monday, April 29, 2013, normalized=====&lt;br /&gt;
The following images show the faded images from day 36 with the fade removed.&lt;br /&gt;
{| class=&amp;quot;wikitable plainlinks table-padding mw-collapsible mw-collapsed&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!Normalized Image&lt;br /&gt;
!Time&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time961norm.png|840:00]]||36/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time962norm.png|841:00]]||36/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time963norm.png|842:00]]||36/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time964norm.png|843:00]]||36/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time965norm.png|844:00]]||36/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time966norm.png|845:00]]||36/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time967norm.png|846:00]]||36/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time968norm.png|847:00]]||36/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time969norm.png|848:00]]||36/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time970norm.png|849:00]]||36/09:00&lt;br /&gt;
|}&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
===May 2013===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
{| class=&amp;quot;wikitable plainlinks table-padding&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1009.png|888:00]]||38/00:00||[[Media:time1102.png|981:00]]||41/21:00||[[Media:time1195.png|1074:00]]||45/18:00||[[Media:time1288.png|1167:00]]||49/15:00||[[Media:time1381.png|1260:00]]||53/12:00||[[Media:time1474.png|1353:00]]||57/09:00||[[Media:time1567.png|1446:00]]||61/06:00||[[Media:time1660.png|1539:00]]||65/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1010.png|889:00]]||38/01:00||[[Media:time1103.png|982:00]]||41/22:00||[[Media:time1196.png|1075:00]]||45/19:00||[[Media:time1289.png|1168:00]]||49/16:00||[[Media:time1382.png|1261:00]]||53/13:00||[[Media:time1475.png|1354:00]]||57/10:00||[[Media:time1568.png|1447:00]]||61/07:00||[[Media:time1661.png|1540:00]]||65/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1011.png|890:00]]||38/02:00||[[Media:time1104.png|983:00]]||41/23:00||[[Media:time1197.png|1076:00]]||45/20:00||[[Media:time1290.png|1169:00]]||49/17:00||[[Media:time1383.png|1262:00]]||53/14:00||[[Media:time1476.png|1355:00]]||57/11:00||[[Media:time1569.png|1448:00]]||61/08:00||[[Media:time1662.png|1541:00]]||65/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1012.png|891:00]]||38/03:00||[[Media:time1105.png|984:00]]||42/00:00||[[Media:time1198.png|1077:00]]||45/21:00||[[Media:time1291.png|1170:00]]||49/18:00||[[Media:time1384.png|1263:00]]||53/15:00||[[Media:time1477.png|1356:00]]||57/12:00||[[Media:time1570.png|1449:00]]||61/09:00||[[Media:time1663.png|1542:00]]||65/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1013.png|892:00]]||38/04:00||[[Media:time1106.png|985:00]]||42/01:00||[[Media:time1199.png|1078:00]]||45/22:00||[[Media:time1292.png|1171:00]]||49/19:00||[[Media:time1385.png|1264:00]]||53/16:00||[[Media:time1478.png|1357:00]]||57/13:00||[[Media:time1571.png|1450:00]]||61/10:00||[[Media:time1664.png|1543:00]]||65/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1014.png|893:00]]||38/05:00||[[Media:time1107.png|986:00]]||42/02:00||[[Media:time1200.png|1079:00]]||45/23:00||[[Media:time1293.png|1172:00]]||49/20:00||[[Media:time1386.png|1265:00]]||53/17:00||[[Media:time1479.png|1358:00]]||57/14:00||[[Media:time1572.png|1451:00]]||61/11:00||[[Media:time1665.png|1544:00]]||65/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1015.png|894:00]]||38/06:00||[[Media:time1108.png|987:00]]||42/03:00||[[Media:time1201.png|1080:00]]||46/00:00||[[Media:time1294.png|1173:00]]||49/21:00||[[Media:time1387.png|1266:00]]||53/18:00||[[Media:time1480.png|1359:00]]||57/15:00||[[Media:time1573.png|1452:00]]||61/12:00||[[Media:time1666.png|1545:00]]||65/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1016.png|895:00]]||38/07:00||[[Media:time1109.png|988:00]]||42/04:00||[[Media:time1202.png|1081:00]]||46/01:00||[[Media:time1295.png|1174:00]]||49/22:00||[[Media:time1388.png|1267:00]]||53/19:00||[[Media:time1481.png|1360:00]]||57/16:00||[[Media:time1574.png|1453:00]]||61/13:00||[[Media:time1667.png|1546:00]]||65/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1017.png|896:00]]||38/08:00||[[Media:time1110.png|989:00]]||42/05:00||[[Media:time1203.png|1082:00]]||46/02:00||[[Media:time1296.png|1175:00]]||49/23:00||[[Media:time1389.png|1268:00]]||53/20:00||[[Media:time1482.png|1361:00]]||57/17:00||[[Media:time1575.png|1454:00]]||61/14:00||[[Media:time1668.png|1547:00]]||65/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1018.png|897:00]]||38/09:00||[[Media:time1111.png|990:00]]||42/06:00||[[Media:time1204.png|1083:00]]||46/03:00||[[Media:time1297.png|1176:00]]||50/00:00||[[Media:time1390.png|1269:00]]||53/21:00||[[Media:time1483.png|1362:00]]||57/18:00||[[Media:time1576.png|1455:00]]||61/15:00||[[Media:time1669.png|1548:00]]||65/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1019.png|898:00]]||38/10:00||[[Media:time1112.png|991:00]]||42/07:00||[[Media:time1205.png|1084:00]]||46/04:00||[[Media:time1298.png|1177:00]]||50/01:00||[[Media:time1391.png|1270:00]]||53/22:00||[[Media:time1484.png|1363:00]]||57/19:00||[[Media:time1577.png|1456:00]]||61/16:00||[[Media:time1670.png|1549:00]]||65/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1020.png|899:00]]||38/11:00||[[Media:time1113.png|992:00]]||42/08:00||[[Media:time1206.png|1085:00]]||46/05:00||[[Media:time1299.png|1178:00]]||50/02:00||[[Media:time1392.png|1271:00]]||53/23:00||[[Media:time1485.png|1364:00]]||57/20:00||[[Media:time1578.png|1457:00]]||61/17:00||[[Media:time1671.png|1550:00]]||65/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1021.png|900:00]]||38/12:00||[[Media:time1114.png|993:00]]||42/09:00||[[Media:time1207.png|1086:00]]||46/06:00||[[Media:time1300.png|1179:00]]||50/03:00||[[Media:time1393.png|1272:00]]||54/00:00||[[Media:time1486.png|1365:00]]||57/21:00||[[Media:time1579.png|1458:00]]||61/18:00||[[Media:time1672.png|1551:00]]||65/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1022.png|901:00]]||38/13:00||[[Media:time1115.png|994:00]]||42/10:00||[[Media:time1208.png|1087:00]]||46/07:00||[[Media:time1301.png|1180:00]]||50/04:00||[[Media:time1394.png|1273:00]]||54/01:00||[[Media:time1487.png|1366:00]]||57/22:00||[[Media:time1580.png|1459:00]]||61/19:00||[[Media:time1673.png|1552:00]]||65/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1023.png|902:00]]||38/14:00||[[Media:time1116.png|995:00]]||42/11:00||[[Media:time1209.png|1088:00]]||46/08:00||[[Media:time1302.png|1181:00]]||50/05:00||[[Media:time1395.png|1274:00]]||54/02:00||[[Media:time1488.png|1367:00]]||57/23:00||[[Media:time1581.png|1460:00]]||61/20:00||[[Media:time1674.png|1553:00]]||65/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1024.png|903:00]]||38/15:00||[[Media:time1117.png|996:00]]||42/12:00||[[Media:time1210.png|1089:00]]||46/09:00||[[Media:time1303.png|1182:00]]||50/06:00||[[Media:time1396.png|1275:00]]||54/03:00||[[Media:time1489.png|1368:00]]||58/00:00||[[Media:time1582.png|1461:00]]||61/21:00||[[Media:time1675.png|1554:00]]||65/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1025.png|904:00]]||38/16:00||[[Media:time1118.png|997:00]]||42/13:00||[[Media:time1211.png|1090:00]]||46/10:00||[[Media:time1304.png|1183:00]]||50/07:00||[[Media:time1397.png|1276:00]]||54/04:00||[[Media:time1490.png|1369:00]]||58/01:00||[[Media:time1583.png|1462:00]]||61/22:00||[[Media:time1676.png|1555:00]]||65/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1026.png|905:00]]||38/17:00||[[Media:time1119.png|998:00]]||42/14:00||[[Media:time1212.png|1091:00]]||46/11:00||[[Media:time1305.png|1184:00]]||50/08:00||[[Media:time1398.png|1277:00]]||54/05:00||[[Media:time1491.png|1370:00]]||58/02:00||[[Media:time1584.png|1463:00]]||61/23:00||[[Media:time1677.png|1556:00]]||65/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1027.png|906:00]]||38/18:00||[[Media:time1120.png|999:00]]||42/15:00||[[Media:time1213.png|1092:00]]||46/12:00||[[Media:time1306.png|1185:00]]||50/09:00||[[Media:time1399.png|1278:00]]||54/06:00||[[Media:time1492.png|1371:00]]||58/03:00||[[Media:time1585.png|1464:00]]||62/00:00||[[Media:time1678.png|1557:00]]||65/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1028.png|907:00]]||38/19:00||[[Media:time1121.png|1000:00]]||42/16:00||[[Media:time1214.png|1093:00]]||46/13:00||[[Media:time1307.png|1186:00]]||50/10:00||[[Media:time1400.png|1279:00]]||54/07:00||[[Media:time1493.png|1372:00]]||58/04:00||[[Media:time1586.png|1465:00]]||62/01:00||[[Media:time1679.png|1558:00]]||65/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1029.png|908:00]]||38/20:00||[[Media:time1122.png|1001:00]]||42/17:00||[[Media:time1215.png|1094:00]]||46/14:00||[[Media:time1308.png|1187:00]]||50/11:00||[[Media:time1401.png|1280:00]]||54/08:00||[[Media:time1494.png|1373:00]]||58/05:00||[[Media:time1587.png|1466:00]]||62/02:00||[[Media:time1680.png|1559:00]]||65/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1030.png|909:00]]||38/21:00||[[Media:time1123.png|1002:00]]||42/18:00||[[Media:time1216.png|1095:00]]||46/15:00||[[Media:time1309.png|1188:00]]||50/12:00||[[Media:time1402.png|1281:00]]||54/09:00||[[Media:time1495.png|1374:00]]||58/06:00||[[Media:time1588.png|1467:00]]||62/03:00||[[Media:time1681.png|1560:00]]||66/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1031.png|910:00]]||38/22:00||[[Media:time1124.png|1003:00]]||42/19:00||[[Media:time1217.png|1096:00]]||46/16:00||[[Media:time1310.png|1189:00]]||50/13:00||[[Media:time1403.png|1282:00]]||54/10:00||[[Media:time1496.png|1375:00]]||58/07:00||[[Media:time1589.png|1468:00]]||62/04:00||[[Media:time1682.png|1561:00]]||66/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1032.png|911:00]]||38/23:00||[[Media:time1125.png|1004:00]]||42/20:00||[[Media:time1218.png|1097:00]]||46/17:00||[[Media:time1311.png|1190:00]]||50/14:00||[[Media:time1404.png|1283:00]]||54/11:00||[[Media:time1497.png|1376:00]]||58/08:00||[[Media:time1590.png|1469:00]]||62/05:00||[[Media:time1683.png|1562:00]]||66/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1033.png|912:00]]||39/00:00||[[Media:time1126.png|1005:00]]||42/21:00||[[Media:time1219.png|1098:00]]||46/18:00||[[Media:time1312.png|1191:00]]||50/15:00||[[Media:time1405.png|1284:00]]||54/12:00||[[Media:time1498.png|1377:00]]||58/09:00||[[Media:time1591.png|1470:00]]||62/06:00||[[Media:time1684.png|1563:00]]||66/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1034.png|913:00]]||39/01:00||[[Media:time1127.png|1006:00]]||42/22:00||[[Media:time1220.png|1099:00]]||46/19:00||[[Media:time1313.png|1192:00]]||50/16:00||[[Media:time1406.png|1285:00]]||54/13:00||[[Media:time1499.png|1378:00]]||58/10:00||[[Media:time1592.png|1471:00]]||62/07:00||[[Media:time1685.png|1564:00]]||66/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1035.png|914:00]]||39/02:00||[[Media:time1128.png|1007:00]]||42/23:00||[[Media:time1221.png|1100:00]]||46/20:00||[[Media:time1314.png|1193:00]]||50/17:00||[[Media:time1407.png|1286:00]]||54/14:00||[[Media:time1500.png|1379:00]]||58/11:00||[[Media:time1593.png|1472:00]]||62/08:00||[[Media:time1686.png|1565:00]]||66/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1036.png|915:00]]||39/03:00||[[Media:time1129.png|1008:00]]||43/00:00||[[Media:time1222.png|1101:00]]||46/21:00||[[Media:time1315.png|1194:00]]||50/18:00||[[Media:time1408.png|1287:00]]||54/15:00||[[Media:time1501.png|1380:00]]||58/12:00||[[Media:time1594.png|1473:00]]||62/09:00||[[Media:time1687.png|1566:00]]||66/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1037.png|916:00]]||39/04:00||[[Media:time1130.png|1009:00]]||43/01:00||[[Media:time1223.png|1102:00]]||46/22:00||[[Media:time1316.png|1195:00]]||50/19:00||[[Media:time1409.png|1288:00]]||54/16:00||[[Media:time1502.png|1381:00]]||58/13:00||[[Media:time1595.png|1474:00]]||62/10:00||[[Media:time1688.png|1567:00]]||66/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1038.png|917:00]]||39/05:00||[[Media:time1131.png|1010:00]]||43/02:00||[[Media:time1224.png|1103:00]]||46/23:00||[[Media:time1317.png|1196:00]]||50/20:00||[[Media:time1410.png|1289:00]]||54/17:00||[[Media:time1503.png|1382:00]]||58/14:00||[[Media:time1596.png|1475:00]]||62/11:00||[[Media:time1689.png|1568:00]]||66/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1039.png|918:00]]||39/06:00||[[Media:time1132.png|1011:00]]||43/03:00||[[Media:time1225.png|1104:00]]||47/00:00||[[Media:time1318.png|1197:00]]||50/21:00||[[Media:time1411.png|1290:00]]||54/18:00||[[Media:time1504.png|1383:00]]||58/15:00||[[Media:time1597.png|1476:00]]||62/12:00||[[Media:time1690.png|1569:00]]||66/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1040.png|919:00]]||39/07:00||[[Media:time1133.png|1012:00]]||43/04:00||[[Media:time1226.png|1105:00]]||47/01:00||[[Media:time1319.png|1198:00]]||50/22:00||[[Media:time1412.png|1291:00]]||54/19:00||[[Media:time1505.png|1384:00]]||58/16:00||[[Media:time1598.png|1477:00]]||62/13:00||[[Media:time1691.png|1570:00]]||66/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1041.png|920:00]]||39/08:00||[[Media:time1134.png|1013:00]]||43/05:00||[[Media:time1227.png|1106:00]]||47/02:00||[[Media:time1320.png|1199:00]]||50/23:00||[[Media:time1413.png|1292:00]]||54/20:00||[[Media:time1506.png|1385:00]]||58/17:00||[[Media:time1599.png|1478:00]]||62/14:00||[[Media:time1692.png|1571:00]]||66/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1042.png|921:00]]||39/09:00||[[Media:time1135.png|1014:00]]||43/06:00||[[Media:time1228.png|1107:00]]||47/03:00||[[Media:time1321.png|1200:00]]||51/00:00||[[Media:time1414.png|1293:00]]||54/21:00||[[Media:time1507.png|1386:00]]||58/18:00||[[Media:time1600.png|1479:00]]||62/15:00||[[Media:time1693.png|1572:00]]||66/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1043.png|922:00]]||39/10:00||[[Media:time1136.png|1015:00]]||43/07:00||[[Media:time1229.png|1108:00]]||47/04:00||[[Media:time1322.png|1201:00]]||51/01:00||[[Media:time1415.png|1294:00]]||54/22:00||[[Media:time1508.png|1387:00]]||58/19:00||[[Media:time1601.png|1480:00]]||62/16:00||[[Media:time1694.png|1573:00]]||66/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1044.png|923:00]]||39/11:00||[[Media:time1137.png|1016:00]]||43/08:00||[[Media:time1230.png|1109:00]]||47/05:00||[[Media:time1323.png|1202:00]]||51/02:00||[[Media:time1416.png|1295:00]]||54/23:00||[[Media:time1509.png|1388:00]]||58/20:00||[[Media:time1602.png|1481:00]]||62/17:00||[[Media:time1695.png|1574:00]]||66/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1045.png|924:00]]||39/12:00||[[Media:time1138.png|1017:00]]||43/09:00||[[Media:time1231.png|1110:00]]||47/06:00||[[Media:time1324.png|1203:00]]||51/03:00||[[Media:time1417.png|1296:00]]||55/00:00||[[Media:time1510.png|1389:00]]||58/21:00||[[Media:time1603.png|1482:00]]||62/18:00||[[Media:time1696.png|1575:00]]||66/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1046.png|925:00]]||39/13:00||[[Media:time1139.png|1018:00]]||43/10:00||[[Media:time1232.png|1111:00]]||47/07:00||[[Media:time1325.png|1204:00]]||51/04:00||[[Media:time1418.png|1297:00]]||55/01:00||[[Media:time1511.png|1390:00]]||58/22:00||[[Media:time1604.png|1483:00]]||62/19:00||[[Media:time1697.png|1576:00]]||66/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1047.png|926:00]]||39/14:00||[[Media:time1140.png|1019:00]]||43/11:00||[[Media:time1233.png|1112:00]]||47/08:00||[[Media:time1326.png|1205:00]]||51/05:00||[[Media:time1419.png|1298:00]]||55/02:00||[[Media:time1512.png|1391:00]]||58/23:00||[[Media:time1605.png|1484:00]]||62/20:00||[[Media:time1698.png|1577:00]]||66/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1048.png|927:00]]||39/15:00||[[Media:time1141.png|1020:00]]||43/12:00||[[Media:time1234.png|1113:00]]||47/09:00||[[Media:time1327.png|1206:00]]||51/06:00||[[Media:time1420.png|1299:00]]||55/03:00||[[Media:time1513.png|1392:00]]||59/00:00||[[Media:time1606.png|1485:00]]||62/21:00||[[Media:time1699.png|1578:00]]||66/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1049.png|928:00]]||39/16:00||[[Media:time1142.png|1021:00]]||43/13:00||[[Media:time1235.png|1114:00]]||47/10:00||[[Media:time1328.png|1207:00]]||51/07:00||[[Media:time1421.png|1300:00]]||55/04:00||[[Media:time1514.png|1393:00]]||59/01:00||[[Media:time1607.png|1486:00]]||62/22:00||[[Media:time1700.png|1579:00]]||66/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1050.png|929:00]]||39/17:00||[[Media:time1143.png|1022:00]]||43/14:00||[[Media:time1236.png|1115:00]]||47/11:00||[[Media:time1329.png|1208:00]]||51/08:00||[[Media:time1422.png|1301:00]]||55/05:00||[[Media:time1515.png|1394:00]]||59/02:00||[[Media:time1608.png|1487:00]]||62/23:00||[[Media:time1701.png|1580:00]]||66/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1051.png|930:00]]||39/18:00||[[Media:time1144.png|1023:00]]||43/15:00||[[Media:time1237.png|1116:00]]||47/12:00||[[Media:time1330.png|1209:00]]||51/09:00||[[Media:time1423.png|1302:00]]||55/06:00||[[Media:time1516.png|1395:00]]||59/03:00||[[Media:time1609.png|1488:00]]||63/00:00||[[Media:time1702.png|1581:00]]||66/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1052.png|931:00]]||39/19:00||[[Media:time1145.png|1024:00]]||43/16:00||[[Media:time1238.png|1117:00]]||47/13:00||[[Media:time1331.png|1210:00]]||51/10:00||[[Media:time1424.png|1303:00]]||55/07:00||[[Media:time1517.png|1396:00]]||59/04:00||[[Media:time1610.png|1489:00]]||63/01:00||[[Media:time1703.png|1582:00]]||66/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1053.png|932:00]]||39/20:00||[[Media:time1146.png|1025:00]]||43/17:00||[[Media:time1239.png|1118:00]]||47/14:00||[[Media:time1332.png|1211:00]]||51/11:00||[[Media:time1425.png|1304:00]]||55/08:00||[[Media:time1518.png|1397:00]]||59/05:00||[[Media:time1611.png|1490:00]]||63/02:00||[[Media:time1704.png|1583:00]]||66/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1054.png|933:00]]||39/21:00||[[Media:time1147.png|1026:00]]||43/18:00||[[Media:time1240.png|1119:00]]||47/15:00||[[Media:time1333.png|1212:00]]||51/12:00||[[Media:time1426.png|1305:00]]||55/09:00||[[Media:time1519.png|1398:00]]||59/06:00||[[Media:time1612.png|1491:00]]||63/03:00||[[Media:time1705.png|1584:00]]||67/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1055.png|934:00]]||39/22:00||[[Media:time1148.png|1027:00]]||43/19:00||[[Media:time1241.png|1120:00]]||47/16:00||[[Media:time1334.png|1213:00]]||51/13:00||[[Media:time1427.png|1306:00]]||55/10:00||[[Media:time1520.png|1399:00]]||59/07:00||[[Media:time1613.png|1492:00]]||63/04:00||[[Media:time1706.png|1585:00]]||67/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1056.png|935:00]]||39/23:00||[[Media:time1149.png|1028:00]]||43/20:00||[[Media:time1242.png|1121:00]]||47/17:00||[[Media:time1335.png|1214:00]]||51/14:00||[[Media:time1428.png|1307:00]]||55/11:00||[[Media:time1521.png|1400:00]]||59/08:00||[[Media:time1614.png|1493:00]]||63/05:00||[[Media:time1707.png|1586:00]]||67/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1057.png|936:00]]||40/00:00||[[Media:time1150.png|1029:00]]||43/21:00||[[Media:time1243.png|1122:00]]||47/18:00||[[Media:time1336.png|1215:00]]||51/15:00||[[Media:time1429.png|1308:00]]||55/12:00||[[Media:time1522.png|1401:00]]||59/09:00||[[Media:time1615.png|1494:00]]||63/06:00||[[Media:time1708.png|1587:00]]||67/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1058.png|937:00]]||40/01:00||[[Media:time1151.png|1030:00]]||43/22:00||[[Media:time1244.png|1123:00]]||47/19:00||[[Media:time1337.png|1216:00]]||51/16:00||[[Media:time1430.png|1309:00]]||55/13:00||[[Media:time1523.png|1402:00]]||59/10:00||[[Media:time1616.png|1495:00]]||63/07:00||[[Media:time1709.png|1588:00]]||67/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1059.png|938:00]]||40/02:00||[[Media:time1152.png|1031:00]]||43/23:00||[[Media:time1245.png|1124:00]]||47/20:00||[[Media:time1338.png|1217:00]]||51/17:00||[[Media:time1431.png|1310:00]]||55/14:00||[[Media:time1524.png|1403:00]]||59/11:00||[[Media:time1617.png|1496:00]]||63/08:00||[[Media:time1710.png|1589:00]]||67/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1060.png|939:00]]||40/03:00||[[Media:time1153.png|1032:00]]||44/00:00||[[Media:time1246.png|1125:00]]||47/21:00||[[Media:time1339.png|1218:00]]||51/18:00||[[Media:time1432.png|1311:00]]||55/15:00||[[Media:time1525.png|1404:00]]||59/12:00||[[Media:time1618.png|1497:00]]||63/09:00||[[Media:time1711.png|1590:00]]||67/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1061.png|940:00]]||40/04:00||[[Media:time1154.png|1033:00]]||44/01:00||[[Media:time1247.png|1126:00]]||47/22:00||[[Media:time1340.png|1219:00]]||51/19:00||[[Media:time1433.png|1312:00]]||55/16:00||[[Media:time1526.png|1405:00]]||59/13:00||[[Media:time1619.png|1498:00]]||63/10:00||[[Media:time1712.png|1591:00]]||67/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1062.png|941:00]]||40/05:00||[[Media:time1155.png|1034:00]]||44/02:00||[[Media:time1248.png|1127:00]]||47/23:00||[[Media:time1341.png|1220:00]]||51/20:00||[[Media:time1434.png|1313:00]]||55/17:00||[[Media:time1527.png|1406:00]]||59/14:00||[[Media:time1620.png|1499:00]]||63/11:00||[[Media:time1713.png|1592:00]]||67/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1063.png|942:00]]||40/06:00||[[Media:time1156.png|1035:00]]||44/03:00||[[Media:time1249.png|1128:00]]||48/00:00||[[Media:time1342.png|1221:00]]||51/21:00||[[Media:time1435.png|1314:00]]||55/18:00||[[Media:time1528.png|1407:00]]||59/15:00||[[Media:time1621.png|1500:00]]||63/12:00||[[Media:time1714.png|1593:00]]||67/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1064.png|943:00]]||40/07:00||[[Media:time1157.png|1036:00]]||44/04:00||[[Media:time1250.png|1129:00]]||48/01:00||[[Media:time1343.png|1222:00]]||51/22:00||[[Media:time1436.png|1315:00]]||55/19:00||[[Media:time1529.png|1408:00]]||59/16:00||[[Media:time1622.png|1501:00]]||63/13:00||[[Media:time1715.png|1594:00]]||67/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1065.png|944:00]]||40/08:00||[[Media:time1158.png|1037:00]]||44/05:00||[[Media:time1251.png|1130:00]]||48/02:00||[[Media:time1344.png|1223:00]]||51/23:00||[[Media:time1437.png|1316:00]]||55/20:00||[[Media:time1530.png|1409:00]]||59/17:00||[[Media:time1623.png|1502:00]]||63/14:00||[[Media:time1716.png|1595:00]]||67/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1066.png|945:00]]||40/09:00||[[Media:time1159.png|1038:00]]||44/06:00||[[Media:time1252.png|1131:00]]||48/03:00||[[Media:time1345.png|1224:00]]||52/00:00||[[Media:time1438.png|1317:00]]||55/21:00||[[Media:time1531.png|1410:00]]||59/18:00||[[Media:time1624.png|1503:00]]||63/15:00||[[Media:time1717.png|1596:00]]||67/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1067.png|946:00]]||40/10:00||[[Media:time1160.png|1039:00]]||44/07:00||[[Media:time1253.png|1132:00]]||48/04:00||[[Media:time1346.png|1225:00]]||52/01:00||[[Media:time1439.png|1318:00]]||55/22:00||[[Media:time1532.png|1411:00]]||59/19:00||[[Media:time1625.png|1504:00]]||63/16:00||[[Media:time1718.png|1597:00]]||67/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1068.png|947:00]]||40/11:00||[[Media:time1161.png|1040:00]]||44/08:00||[[Media:time1254.png|1133:00]]||48/05:00||[[Media:time1347.png|1226:00]]||52/02:00||[[Media:time1440.png|1319:00]]||55/23:00||[[Media:time1533.png|1412:00]]||59/20:00||[[Media:time1626.png|1505:00]]||63/17:00||[[Media:time1719.png|1598:00]]||67/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1069.png|948:00]]||40/12:00||[[Media:time1162.png|1041:00]]||44/09:00||[[Media:time1255.png|1134:00]]||48/06:00||[[Media:time1348.png|1227:00]]||52/03:00||[[Media:time1441.png|1320:00]]||56/00:00||[[Media:time1534.png|1413:00]]||59/21:00||[[Media:time1627.png|1506:00]]||63/18:00||[[Media:time1720.png|1599:00]]||67/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1070.png|949:00]]||40/13:00||[[Media:time1163.png|1042:00]]||44/10:00||[[Media:time1256.png|1135:00]]||48/07:00||[[Media:time1349.png|1228:00]]||52/04:00||[[Media:time1442.png|1321:00]]||56/01:00||[[Media:time1535.png|1414:00]]||59/22:00||[[Media:time1628.png|1507:00]]||63/19:00||[[Media:time1721.png|1600:00]]||67/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1071.png|950:00]]||40/14:00||[[Media:time1164.png|1043:00]]||44/11:00||[[Media:time1257.png|1136:00]]||48/08:00||[[Media:time1350.png|1229:00]]||52/05:00||[[Media:time1443.png|1322:00]]||56/02:00||[[Media:time1536.png|1415:00]]||59/23:00||[[Media:time1629.png|1508:00]]||63/20:00||[[Media:time1722.png|1601:00]]||67/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1072.png|951:00]]||40/15:00||[[Media:time1165.png|1044:00]]||44/12:00||[[Media:time1258.png|1137:00]]||48/09:00||[[Media:time1351.png|1230:00]]||52/06:00||[[Media:time1444.png|1323:00]]||56/03:00||[[Media:time1537.png|1416:00]]||60/00:00||[[Media:time1630.png|1509:00]]||63/21:00||[[Media:time1723.png|1602:00]]||67/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1073.png|952:00]]||40/16:00||[[Media:time1166.png|1045:00]]||44/13:00||[[Media:time1259.png|1138:00]]||48/10:00||[[Media:time1352.png|1231:00]]||52/07:00||[[Media:time1445.png|1324:00]]||56/04:00||[[Media:time1538.png|1417:00]]||60/01:00||[[Media:time1631.png|1510:00]]||63/22:00||[[Media:time1724.png|1603:00]]||67/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1074.png|953:00]]||40/17:00||[[Media:time1167.png|1046:00]]||44/14:00||[[Media:time1260.png|1139:00]]||48/11:00||[[Media:time1353.png|1232:00]]||52/08:00||[[Media:time1446.png|1325:00]]||56/05:00||[[Media:time1539.png|1418:00]]||60/02:00||[[Media:time1632.png|1511:00]]||63/23:00||[[Media:time1725.png|1604:00]]||67/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1075.png|954:00]]||40/18:00||[[Media:time1168.png|1047:00]]||44/15:00||[[Media:time1261.png|1140:00]]||48/12:00||[[Media:time1354.png|1233:00]]||52/09:00||[[Media:time1447.png|1326:00]]||56/06:00||[[Media:time1540.png|1419:00]]||60/03:00||[[Media:time1633.png|1512:00]]||64/00:00||[[Media:time1726.png|1605:00]]||67/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1076.png|955:00]]||40/19:00||[[Media:time1169.png|1048:00]]||44/16:00||[[Media:time1262.png|1141:00]]||48/13:00||[[Media:time1355.png|1234:00]]||52/10:00||[[Media:time1448.png|1327:00]]||56/07:00||[[Media:time1541.png|1420:00]]||60/04:00||[[Media:time1634.png|1513:00]]||64/01:00||[[Media:time1727.png|1606:00]]||67/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1077.png|956:00]]||40/20:00||[[Media:time1170.png|1049:00]]||44/17:00||[[Media:time1263.png|1142:00]]||48/14:00||[[Media:time1356.png|1235:00]]||52/11:00||[[Media:time1449.png|1328:00]]||56/08:00||[[Media:time1542.png|1421:00]]||60/05:00||[[Media:time1635.png|1514:00]]||64/02:00||[[Media:time1728.png|1607:00]]||67/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1078.png|957:00]]||40/21:00||[[Media:time1171.png|1050:00]]||44/18:00||[[Media:time1264.png|1143:00]]||48/15:00||[[Media:time1357.png|1236:00]]||52/12:00||[[Media:time1450.png|1329:00]]||56/09:00||[[Media:time1543.png|1422:00]]||60/06:00||[[Media:time1636.png|1515:00]]||64/03:00||[[Media:time1729.png|1608:00]]||68/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1079.png|958:00]]||40/22:00||[[Media:time1172.png|1051:00]]||44/19:00||[[Media:time1265.png|1144:00]]||48/16:00||[[Media:time1358.png|1237:00]]||52/13:00||[[Media:time1451.png|1330:00]]||56/10:00||[[Media:time1544.png|1423:00]]||60/07:00||[[Media:time1637.png|1516:00]]||64/04:00||[[Media:time1730.png|1609:00]]||68/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1080.png|959:00]]||40/23:00||[[Media:time1173.png|1052:00]]||44/20:00||[[Media:time1266.png|1145:00]]||48/17:00||[[Media:time1359.png|1238:00]]||52/14:00||[[Media:time1452.png|1331:00]]||56/11:00||[[Media:time1545.png|1424:00]]||60/08:00||[[Media:time1638.png|1517:00]]||64/05:00||[[Media:time1731.png|1610:00]]||68/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1081.png|960:00]]||41/00:00||[[Media:time1174.png|1053:00]]||44/21:00||[[Media:time1267.png|1146:00]]||48/18:00||[[Media:time1360.png|1239:00]]||52/15:00||[[Media:time1453.png|1332:00]]||56/12:00||[[Media:time1546.png|1425:00]]||60/09:00||[[Media:time1639.png|1518:00]]||64/06:00||[[Media:time1732.png|1611:00]]||68/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1082.png|961:00]]||41/01:00||[[Media:time1175.png|1054:00]]||44/22:00||[[Media:time1268.png|1147:00]]||48/19:00||[[Media:time1361.png|1240:00]]||52/16:00||[[Media:time1454.png|1333:00]]||56/13:00||[[Media:time1547.png|1426:00]]||60/10:00||[[Media:time1640.png|1519:00]]||64/07:00||[[Media:time1733.png|1612:00]]||68/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1083.png|962:00]]||41/02:00||[[Media:time1176.png|1055:00]]||44/23:00||[[Media:time1269.png|1148:00]]||48/20:00||[[Media:time1362.png|1241:00]]||52/17:00||[[Media:time1455.png|1334:00]]||56/14:00||[[Media:time1548.png|1427:00]]||60/11:00||[[Media:time1641.png|1520:00]]||64/08:00||[[Media:time1734.png|1613:00]]||68/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1084.png|963:00]]||41/03:00||[[Media:time1177.png|1056:00]]||45/00:00||[[Media:time1270.png|1149:00]]||48/21:00||[[Media:time1363.png|1242:00]]||52/18:00||[[Media:time1456.png|1335:00]]||56/15:00||[[Media:time1549.png|1428:00]]||60/12:00||[[Media:time1642.png|1521:00]]||64/09:00||[[Media:time1735.png|1614:00]]||68/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1085.png|964:00]]||41/04:00||[[Media:time1178.png|1057:00]]||45/01:00||[[Media:time1271.png|1150:00]]||48/22:00||[[Media:time1364.png|1243:00]]||52/19:00||[[Media:time1457.png|1336:00]]||56/16:00||[[Media:time1550.png|1429:00]]||60/13:00||[[Media:time1643.png|1522:00]]||64/10:00||[[Media:time1736.png|1615:00]]||68/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1086.png|965:00]]||41/05:00||[[Media:time1179.png|1058:00]]||45/02:00||[[Media:time1272.png|1151:00]]||48/23:00||[[Media:time1365.png|1244:00]]||52/20:00||[[Media:time1458.png|1337:00]]||56/17:00||[[Media:time1551.png|1430:00]]||60/14:00||[[Media:time1644.png|1523:00]]||64/11:00||[[Media:time1737.png|1616:00]]||68/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1087.png|966:00]]||41/06:00||[[Media:time1180.png|1059:00]]||45/03:00||[[Media:time1273.png|1152:00]]||49/00:00||[[Media:time1366.png|1245:00]]||52/21:00||[[Media:time1459.png|1338:00]]||56/18:00||[[Media:time1552.png|1431:00]]||60/15:00||[[Media:time1645.png|1524:00]]||64/12:00||[[Media:time1738.png|1617:00]]||68/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1088.png|967:00]]||41/07:00||[[Media:time1181.png|1060:00]]||45/04:00||[[Media:time1274.png|1153:00]]||49/01:00||[[Media:time1367.png|1246:00]]||52/22:00||[[Media:time1460.png|1339:00]]||56/19:00||[[Media:time1553.png|1432:00]]||60/16:00||[[Media:time1646.png|1525:00]]||64/13:00||[[Media:time1739.png|1618:00]]||68/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1089.png|968:00]]||41/08:00||[[Media:time1182.png|1061:00]]||45/05:00||[[Media:time1275.png|1154:00]]||49/02:00||[[Media:time1368.png|1247:00]]||52/23:00||[[Media:time1461.png|1340:00]]||56/20:00||[[Media:time1554.png|1433:00]]||60/17:00||[[Media:time1647.png|1526:00]]||64/14:00||[[Media:time1740.png|1619:00]]||68/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1090.png|969:00]]||41/09:00||[[Media:time1183.png|1062:00]]||45/06:00||[[Media:time1276.png|1155:00]]||49/03:00||[[Media:time1369.png|1248:00]]||53/00:00||[[Media:time1462.png|1341:00]]||56/21:00||[[Media:time1555.png|1434:00]]||60/18:00||[[Media:time1648.png|1527:00]]||64/15:00||[[Media:time1741.png|1620:00]]||68/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1091.png|970:00]]||41/10:00||[[Media:time1184.png|1063:00]]||45/07:00||[[Media:time1277.png|1156:00]]||49/04:00||[[Media:time1370.png|1249:00]]||53/01:00||[[Media:time1463.png|1342:00]]||56/22:00||[[Media:time1556.png|1435:00]]||60/19:00||[[Media:time1649.png|1528:00]]||64/16:00||[[Media:time1742.png|1621:00]]||68/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1092.png|971:00]]||41/11:00||[[Media:time1185.png|1064:00]]||45/08:00||[[Media:time1278.png|1157:00]]||49/05:00||[[Media:time1371.png|1250:00]]||53/02:00||[[Media:time1464.png|1343:00]]||56/23:00||[[Media:time1557.png|1436:00]]||60/20:00||[[Media:time1650.png|1529:00]]||64/17:00||[[Media:time1743.png|1622:00]]||68/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1093.png|972:00]]||41/12:00||[[Media:time1186.png|1065:00]]||45/09:00||[[Media:time1279.png|1158:00]]||49/06:00||[[Media:time1372.png|1251:00]]||53/03:00||[[Media:time1465.png|1344:00]]||57/00:00||[[Media:time1558.png|1437:00]]||60/21:00||[[Media:time1651.png|1530:00]]||64/18:00||[[Media:time1744.png|1623:00]]||68/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1094.png|973:00]]||41/13:00||[[Media:time1187.png|1066:00]]||45/10:00||[[Media:time1280.png|1159:00]]||49/07:00||[[Media:time1373.png|1252:00]]||53/04:00||[[Media:time1466.png|1345:00]]||57/01:00||[[Media:time1559.png|1438:00]]||60/22:00||[[Media:time1652.png|1531:00]]||64/19:00||[[Media:time1745.png|1624:00]]||68/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1095.png|974:00]]||41/14:00||[[Media:time1188.png|1067:00]]||45/11:00||[[Media:time1281.png|1160:00]]||49/08:00||[[Media:time1374.png|1253:00]]||53/05:00||[[Media:time1467.png|1346:00]]||57/02:00||[[Media:time1560.png|1439:00]]||60/23:00||[[Media:time1653.png|1532:00]]||64/20:00||[[Media:time1746.png|1625:00]]||68/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1096.png|975:00]]||41/15:00||[[Media:time1189.png|1068:00]]||45/12:00||[[Media:time1282.png|1161:00]]||49/09:00||[[Media:time1375.png|1254:00]]||53/06:00||[[Media:time1468.png|1347:00]]||57/03:00||[[Media:time1561.png|1440:00]]||61/00:00||[[Media:time1654.png|1533:00]]||64/21:00||[[Media:time1747.png|1626:00]]||68/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1097.png|976:00]]||41/16:00||[[Media:time1190.png|1069:00]]||45/13:00||[[Media:time1283.png|1162:00]]||49/10:00||[[Media:time1376.png|1255:00]]||53/07:00||[[Media:time1469.png|1348:00]]||57/04:00||[[Media:time1562.png|1441:00]]||61/01:00||[[Media:time1655.png|1534:00]]||64/22:00||[[Media:time1748.png|1627:00]]||68/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1098.png|977:00]]||41/17:00||[[Media:time1191.png|1070:00]]||45/14:00||[[Media:time1284.png|1163:00]]||49/11:00||[[Media:time1377.png|1256:00]]||53/08:00||[[Media:time1470.png|1349:00]]||57/05:00||[[Media:time1563.png|1442:00]]||61/02:00||[[Media:time1656.png|1535:00]]||64/23:00||[[Media:time1749.png|1628:00]]||68/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1099.png|978:00]]||41/18:00||[[Media:time1192.png|1071:00]]||45/15:00||[[Media:time1285.png|1164:00]]||49/12:00||[[Media:time1378.png|1257:00]]||53/09:00||[[Media:time1471.png|1350:00]]||57/06:00||[[Media:time1564.png|1443:00]]||61/03:00||[[Media:time1657.png|1536:00]]||65/00:00||[[Media:time1750.png|1629:00]]||68/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1100.png|979:00]]||41/19:00||[[Media:time1193.png|1072:00]]||45/16:00||[[Media:time1286.png|1165:00]]||49/13:00||[[Media:time1379.png|1258:00]]||53/10:00||[[Media:time1472.png|1351:00]]||57/07:00||[[Media:time1565.png|1444:00]]||61/04:00||[[Media:time1658.png|1537:00]]||65/01:00||[[Media:time1751.png|1630:00]]||68/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1101.png|980:00]]||41/20:00||[[Media:time1194.png|1073:00]]||45/17:00||[[Media:time1287.png|1166:00]]||49/14:00||[[Media:time1380.png|1259:00]]||53/11:00||[[Media:time1473.png|1352:00]]||57/08:00||[[Media:time1566.png|1445:00]]||61/05:00||[[Media:time1659.png|1538:00]]||65/02:00||[[Media:time1752.png|1631:00]]||68/23:00&lt;br /&gt;
|}&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
===June 2013===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
{| class=&amp;quot;wikitable plainlinks table-padding&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1753.png|1632:00]]||69/00:00||[[Media:time1844.png|1723:00]]||72/19:00||[[Media:time1935.png|1814:00]]||76/14:00||[[Media:time2026.png|1905:00]]||80/09:00||[[Media:time2117.png|1996:00]]||84/04:00||[[Media:time2208.png|2087:00]]||87/23:00||[[Media:time2299.png|2178:00]]||91/18:00||[[Media:time2390.png|2269:00]]||95/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1754.png|1633:00]]||69/01:00||[[Media:time1845.png|1724:00]]||72/20:00||[[Media:time1936.png|1815:00]]||76/15:00||[[Media:time2027.png|1906:00]]||80/10:00||[[Media:time2118.png|1997:00]]||84/05:00||[[Media:time2209.png|2088:00]]||88/00:00||[[Media:time2300.png|2179:00]]||91/19:00||[[Media:time2391.png|2270:00]]||95/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1755.png|1634:00]]||69/02:00||[[Media:time1846.png|1725:00]]||72/21:00||[[Media:time1937.png|1816:00]]||76/16:00||[[Media:time2028.png|1907:00]]||80/11:00||[[Media:time2119.png|1998:00]]||84/06:00||[[Media:time2210.png|2089:00]]||88/01:00||[[Media:time2301.png|2180:00]]||91/20:00||[[Media:time2392.png|2271:00]]||95/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1756.png|1635:00]]||69/03:00||[[Media:time1847.png|1726:00]]||72/22:00||[[Media:time1938.png|1817:00]]||76/17:00||[[Media:time2029.png|1908:00]]||80/12:00||[[Media:time2120.png|1999:00]]||84/07:00||[[Media:time2211.png|2090:00]]||88/02:00||[[Media:time2302.png|2181:00]]||91/21:00||[[Media:time2393.png|2272:00]]||95/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1757.png|1636:00]]||69/04:00||[[Media:time1848.png|1727:00]]||72/23:00||[[Media:time1939.png|1818:00]]||76/18:00||[[Media:time2030.png|1909:00]]||80/13:00||[[Media:time2121.png|2000:00]]||84/08:00||[[Media:time2212.png|2091:00]]||88/03:00||[[Media:time2303.png|2182:00]]||91/22:00||[[Media:time2394.png|2273:00]]||95/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1758.png|1637:00]]||69/05:00||[[Media:time1849.png|1728:00]]||73/00:00||[[Media:time1940.png|1819:00]]||76/19:00||[[Media:time2031.png|1910:00]]||80/14:00||[[Media:time2122.png|2001:00]]||84/09:00||[[Media:time2213.png|2092:00]]||88/04:00||[[Media:time2304.png|2183:00]]||91/23:00||[[Media:time2395.png|2274:00]]||95/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1759.png|1638:00]]||69/06:00||[[Media:time1850.png|1729:00]]||73/01:00||[[Media:time1941.png|1820:00]]||76/20:00||[[Media:time2032.png|1911:00]]||80/15:00||[[Media:time2123.png|2002:00]]||84/10:00||[[Media:time2214.png|2093:00]]||88/05:00||[[Media:time2305.png|2184:00]]||92/00:00||[[Media:time2396.png|2275:00]]||95/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1760.png|1639:00]]||69/07:00||[[Media:time1851.png|1730:00]]||73/02:00||[[Media:time1942.png|1821:00]]||76/21:00||[[Media:time2033.png|1912:00]]||80/16:00||[[Media:time2124.png|2003:00]]||84/11:00||[[Media:time2215.png|2094:00]]||88/06:00||[[Media:time2306.png|2185:00]]||92/01:00||[[Media:time2397.png|2276:00]]||95/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1761.png|1640:00]]||69/08:00||[[Media:time1852.png|1731:00]]||73/03:00||[[Media:time1943.png|1822:00]]||76/22:00||[[Media:time2034.png|1913:00]]||80/17:00||[[Media:time2125.png|2004:00]]||84/12:00||[[Media:time2216.png|2095:00]]||88/07:00||[[Media:time2307.png|2186:00]]||92/02:00||[[Media:time2398.png|2277:00]]||95/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1762.png|1641:00]]||69/09:00||[[Media:time1853.png|1732:00]]||73/04:00||[[Media:time1944.png|1823:00]]||76/23:00||[[Media:time2035.png|1914:00]]||80/18:00||[[Media:time2126.png|2005:00]]||84/13:00||[[Media:time2217.png|2096:00]]||88/08:00||[[Media:time2308.png|2187:00]]||92/03:00||[[Media:time2399.png|2278:00]]||95/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1763.png|1642:00]]||69/10:00||[[Media:time1854.png|1733:00]]||73/05:00||[[Media:time1945.png|1824:00]]||77/00:00||[[Media:time2036.png|1915:00]]||80/19:00||[[Media:time2127.png|2006:00]]||84/14:00||[[Media:time2218.png|2097:00]]||88/09:00||[[Media:time2309.png|2188:00]]||92/04:00||[[Media:time2400.png|2279:00]]||95/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1764.png|1643:00]]||69/11:00||[[Media:time1855.png|1734:00]]||73/06:00||[[Media:time1946.png|1825:00]]||77/01:00||[[Media:time2037.png|1916:00]]||80/20:00||[[Media:time2128.png|2007:00]]||84/15:00||[[Media:time2219.png|2098:00]]||88/10:00||[[Media:time2310.png|2189:00]]||92/05:00||[[Media:time2401.png|2280:00]]||96/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1765.png|1644:00]]||69/12:00||[[Media:time1856.png|1735:00]]||73/07:00||[[Media:time1947.png|1826:00]]||77/02:00||[[Media:time2038.png|1917:00]]||80/21:00||[[Media:time2129.png|2008:00]]||84/16:00||[[Media:time2220.png|2099:00]]||88/11:00||[[Media:time2311.png|2190:00]]||92/06:00||[[Media:time2402.png|2281:00]]||96/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1766.png|1645:00]]||69/13:00||[[Media:time1857.png|1736:00]]||73/08:00||[[Media:time1948.png|1827:00]]||77/03:00||[[Media:time2039.png|1918:00]]||80/22:00||[[Media:time2130.png|2009:00]]||84/17:00||[[Media:time2221.png|2100:00]]||88/12:00||[[Media:time2312.png|2191:00]]||92/07:00||[[Media:time2403.png|2282:00]]||96/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1767.png|1646:00]]||69/14:00||[[Media:time1858.png|1737:00]]||73/09:00||[[Media:time1949.png|1828:00]]||77/04:00||[[Media:time2040.png|1919:00]]||80/23:00||[[Media:time2131.png|2010:00]]||84/18:00||[[Media:time2222.png|2101:00]]||88/13:00||[[Media:time2313.png|2192:00]]||92/08:00||[[Media:time2404.png|2283:00]]||96/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1768.png|1647:00]]||69/15:00||[[Media:time1859.png|1738:00]]||73/10:00||[[Media:time1950.png|1829:00]]||77/05:00||[[Media:time2041.png|1920:00]]||81/00:00||[[Media:time2132.png|2011:00]]||84/19:00||[[Media:time2223.png|2102:00]]||88/14:00||[[Media:time2314.png|2193:00]]||92/09:00||[[Media:time2405.png|2284:00]]||96/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1769.png|1648:00]]||69/16:00||[[Media:time1860.png|1739:00]]||73/11:00||[[Media:time1951.png|1830:00]]||77/06:00||[[Media:time2042.png|1921:00]]||81/01:00||[[Media:time2133.png|2012:00]]||84/20:00||[[Media:time2224.png|2103:00]]||88/15:00||[[Media:time2315.png|2194:00]]||92/10:00||[[Media:time2406.png|2285:00]]||96/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1770.png|1649:00]]||69/17:00||[[Media:time1861.png|1740:00]]||73/12:00||[[Media:time1952.png|1831:00]]||77/07:00||[[Media:time2043.png|1922:00]]||81/02:00||[[Media:time2134.png|2013:00]]||84/21:00||[[Media:time2225.png|2104:00]]||88/16:00||[[Media:time2316.png|2195:00]]||92/11:00||[[Media:time2407.png|2286:00]]||96/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1771.png|1650:00]]||69/18:00||[[Media:time1862.png|1741:00]]||73/13:00||[[Media:time1953.png|1832:00]]||77/08:00||[[Media:time2044.png|1923:00]]||81/03:00||[[Media:time2135.png|2014:00]]||84/22:00||[[Media:time2226.png|2105:00]]||88/17:00||[[Media:time2317.png|2196:00]]||92/12:00||[[Media:time2408.png|2287:00]]||96/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1772.png|1651:00]]||69/19:00||[[Media:time1863.png|1742:00]]||73/14:00||[[Media:time1954.png|1833:00]]||77/09:00||[[Media:time2045.png|1924:00]]||81/04:00||[[Media:time2136.png|2015:00]]||84/23:00||[[Media:time2227.png|2106:00]]||88/18:00||[[Media:time2318.png|2197:00]]||92/13:00||[[Media:time2409.png|2288:00]]||96/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1773.png|1652:00]]||69/20:00||[[Media:time1864.png|1743:00]]||73/15:00||[[Media:time1955.png|1834:00]]||77/10:00||[[Media:time2046.png|1925:00]]||81/05:00||[[Media:time2137.png|2016:00]]||85/00:00||[[Media:time2228.png|2107:00]]||88/19:00||[[Media:time2319.png|2198:00]]||92/14:00||[[Media:time2410.png|2289:00]]||96/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1774.png|1653:00]]||69/21:00||[[Media:time1865.png|1744:00]]||73/16:00||[[Media:time1956.png|1835:00]]||77/11:00||[[Media:time2047.png|1926:00]]||81/06:00||[[Media:time2138.png|2017:00]]||85/01:00||[[Media:time2229.png|2108:00]]||88/20:00||[[Media:time2320.png|2199:00]]||92/15:00||[[Media:time2411.png|2290:00]]||96/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1775.png|1654:00]]||69/22:00||[[Media:time1866.png|1745:00]]||73/17:00||[[Media:time1957.png|1836:00]]||77/12:00||[[Media:time2048.png|1927:00]]||81/07:00||[[Media:time2139.png|2018:00]]||85/02:00||[[Media:time2230.png|2109:00]]||88/21:00||[[Media:time2321.png|2200:00]]||92/16:00||[[Media:time2412.png|2291:00]]||96/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1776.png|1655:00]]||69/23:00||[[Media:time1867.png|1746:00]]||73/18:00||[[Media:time1958.png|1837:00]]||77/13:00||[[Media:time2049.png|1928:00]]||81/08:00||[[Media:time2140.png|2019:00]]||85/03:00||[[Media:time2231.png|2110:00]]||88/22:00||[[Media:time2322.png|2201:00]]||92/17:00||[[Media:time2413.png|2292:00]]||96/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1777.png|1656:00]]||70/00:00||[[Media:time1868.png|1747:00]]||73/19:00||[[Media:time1959.png|1838:00]]||77/14:00||[[Media:time2050.png|1929:00]]||81/09:00||[[Media:time2141.png|2020:00]]||85/04:00||[[Media:time2232.png|2111:00]]||88/23:00||[[Media:time2323.png|2202:00]]||92/18:00||[[Media:time2414.png|2293:00]]||96/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1778.png|1657:00]]||70/01:00||[[Media:time1869.png|1748:00]]||73/20:00||[[Media:time1960.png|1839:00]]||77/15:00||[[Media:time2051.png|1930:00]]||81/10:00||[[Media:time2142.png|2021:00]]||85/05:00||[[Media:time2233.png|2112:00]]||89/00:00||[[Media:time2324.png|2203:00]]||92/19:00||[[Media:time2415.png|2294:00]]||96/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1779.png|1658:00]]||70/02:00||[[Media:time1870.png|1749:00]]||73/21:00||[[Media:time1961.png|1840:00]]||77/16:00||[[Media:time2052.png|1931:00]]||81/11:00||[[Media:time2143.png|2022:00]]||85/06:00||[[Media:time2234.png|2113:00]]||89/01:00||[[Media:time2325.png|2204:00]]||92/20:00||[[Media:time2416.png|2295:00]]||96/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1780.png|1659:00]]||70/03:00||[[Media:time1871.png|1750:00]]||73/22:00||[[Media:time1962.png|1841:00]]||77/17:00||[[Media:time2053.png|1932:00]]||81/12:00||[[Media:time2144.png|2023:00]]||85/07:00||[[Media:time2235.png|2114:00]]||89/02:00||[[Media:time2326.png|2205:00]]||92/21:00||[[Media:time2417.png|2296:00]]||96/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1781.png|1660:00]]||70/04:00||[[Media:time1872.png|1751:00]]||73/23:00||[[Media:time1963.png|1842:00]]||77/18:00||[[Media:time2054.png|1933:00]]||81/13:00||[[Media:time2145.png|2024:00]]||85/08:00||[[Media:time2236.png|2115:00]]||89/03:00||[[Media:time2327.png|2206:00]]||92/22:00||[[Media:time2418.png|2297:00]]||96/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1782.png|1661:00]]||70/05:00||[[Media:time1873.png|1752:00]]||74/00:00||[[Media:time1964.png|1843:00]]||77/19:00||[[Media:time2055.png|1934:00]]||81/14:00||[[Media:time2146.png|2025:00]]||85/09:00||[[Media:time2237.png|2116:00]]||89/04:00||[[Media:time2328.png|2207:00]]||92/23:00||[[Media:time2419.png|2298:00]]||96/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1783.png|1662:00]]||70/06:00||[[Media:time1874.png|1753:00]]||74/01:00||[[Media:time1965.png|1844:00]]||77/20:00||[[Media:time2056.png|1935:00]]||81/15:00||[[Media:time2147.png|2026:00]]||85/10:00||[[Media:time2238.png|2117:00]]||89/05:00||[[Media:time2329.png|2208:00]]||93/00:00||[[Media:time2420.png|2299:00]]||96/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1784.png|1663:00]]||70/07:00||[[Media:time1875.png|1754:00]]||74/02:00||[[Media:time1966.png|1845:00]]||77/21:00||[[Media:time2057.png|1936:00]]||81/16:00||[[Media:time2148.png|2027:00]]||85/11:00||[[Media:time2239.png|2118:00]]||89/06:00||[[Media:time2330.png|2209:00]]||93/01:00||[[Media:time2421.png|2300:00]]||96/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1785.png|1664:00]]||70/08:00||[[Media:time1876.png|1755:00]]||74/03:00||[[Media:time1967.png|1846:00]]||77/22:00||[[Media:time2058.png|1937:00]]||81/17:00||[[Media:time2149.png|2028:00]]||85/12:00||[[Media:time2240.png|2119:00]]||89/07:00||[[Media:time2331.png|2210:00]]||93/02:00||[[Media:time2422.png|2301:00]]||96/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1786.png|1665:00]]||70/09:00||[[Media:time1877.png|1756:00]]||74/04:00||[[Media:time1968.png|1847:00]]||77/23:00||[[Media:time2059.png|1938:00]]||81/18:00||[[Media:time2150.png|2029:00]]||85/13:00||[[Media:time2241.png|2120:00]]||89/08:00||[[Media:time2332.png|2211:00]]||93/03:00||[[Media:time2423.png|2302:00]]||96/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1787.png|1666:00]]||70/10:00||[[Media:time1878.png|1757:00]]||74/05:00||[[Media:time1969.png|1848:00]]||78/00:00||[[Media:time2060.png|1939:00]]||81/19:00||[[Media:time2151.png|2030:00]]||85/14:00||[[Media:time2242.png|2121:00]]||89/09:00||[[Media:time2333.png|2212:00]]||93/04:00||[[Media:time2424.png|2303:00]]||96/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1788.png|1667:00]]||70/11:00||[[Media:time1879.png|1758:00]]||74/06:00||[[Media:time1970.png|1849:00]]||78/01:00||[[Media:time2061.png|1940:00]]||81/20:00||[[Media:time2152.png|2031:00]]||85/15:00||[[Media:time2243.png|2122:00]]||89/10:00||[[Media:time2334.png|2213:00]]||93/05:00||[[Media:time2425.png|2304:00]]||97/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1789.png|1668:00]]||70/12:00||[[Media:time1880.png|1759:00]]||74/07:00||[[Media:time1971.png|1850:00]]||78/02:00||[[Media:time2062.png|1941:00]]||81/21:00||[[Media:time2153.png|2032:00]]||85/16:00||[[Media:time2244.png|2123:00]]||89/11:00||[[Media:time2335.png|2214:00]]||93/06:00||[[Media:time2426.png|2305:00]]||97/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1790.png|1669:00]]||70/13:00||[[Media:time1881.png|1760:00]]||74/08:00||[[Media:time1972.png|1851:00]]||78/03:00||[[Media:time2063.png|1942:00]]||81/22:00||[[Media:time2154.png|2033:00]]||85/17:00||[[Media:time2245.png|2124:00]]||89/12:00||[[Media:time2336.png|2215:00]]||93/07:00||[[Media:time2427.png|2306:00]]||97/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1791.png|1670:00]]||70/14:00||[[Media:time1882.png|1761:00]]||74/09:00||[[Media:time1973.png|1852:00]]||78/04:00||[[Media:time2064.png|1943:00]]||81/23:00||[[Media:time2155.png|2034:00]]||85/18:00||[[Media:time2246.png|2125:00]]||89/13:00||[[Media:time2337.png|2216:00]]||93/08:00||[[Media:time2428.png|2307:00]]||97/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1792.png|1671:00]]||70/15:00||[[Media:time1883.png|1762:00]]||74/10:00||[[Media:time1974.png|1853:00]]||78/05:00||[[Media:time2065.png|1944:00]]||82/00:00||[[Media:time2156.png|2035:00]]||85/19:00||[[Media:time2247.png|2126:00]]||89/14:00||[[Media:time2338.png|2217:00]]||93/09:00||[[Media:time2429.png|2308:00]]||97/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1793.png|1672:00]]||70/16:00||[[Media:time1884.png|1763:00]]||74/11:00||[[Media:time1975.png|1854:00]]||78/06:00||[[Media:time2066.png|1945:00]]||82/01:00||[[Media:time2157.png|2036:00]]||85/20:00||[[Media:time2248.png|2127:00]]||89/15:00||[[Media:time2339.png|2218:00]]||93/10:00||[[Media:time2430.png|2309:00]]||97/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1794.png|1673:00]]||70/17:00||[[Media:time1885.png|1764:00]]||74/12:00||[[Media:time1976.png|1855:00]]||78/07:00||[[Media:time2067.png|1946:00]]||82/02:00||[[Media:time2158.png|2037:00]]||85/21:00||[[Media:time2249.png|2128:00]]||89/16:00||[[Media:time2340.png|2219:00]]||93/11:00||[[Media:time2431.png|2310:00]]||97/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1795.png|1674:00]]||70/18:00||[[Media:time1886.png|1765:00]]||74/13:00||[[Media:time1977.png|1856:00]]||78/08:00||[[Media:time2068.png|1947:00]]||82/03:00||[[Media:time2159.png|2038:00]]||85/22:00||[[Media:time2250.png|2129:00]]||89/17:00||[[Media:time2341.png|2220:00]]||93/12:00||[[Media:time2432.png|2311:00]]||97/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1796.png|1675:00]]||70/19:00||[[Media:time1887.png|1766:00]]||74/14:00||[[Media:time1978.png|1857:00]]||78/09:00||[[Media:time2069.png|1948:00]]||82/04:00||[[Media:time2160.png|2039:00]]||85/23:00||[[Media:time2251.png|2130:00]]||89/18:00||[[Media:time2342.png|2221:00]]||93/13:00||[[Media:time2433.png|2312:00]]||97/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1797.png|1676:00]]||70/20:00||[[Media:time1888.png|1767:00]]||74/15:00||[[Media:time1979.png|1858:00]]||78/10:00||[[Media:time2070.png|1949:00]]||82/05:00||[[Media:time2161.png|2040:00]]||86/00:00||[[Media:time2252.png|2131:00]]||89/19:00||[[Media:time2343.png|2222:00]]||93/14:00||[[Media:time2434.png|2313:00]]||97/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1798.png|1677:00]]||70/21:00||[[Media:time1889.png|1768:00]]||74/16:00||[[Media:time1980.png|1859:00]]||78/11:00||[[Media:time2071.png|1950:00]]||82/06:00||[[Media:time2162.png|2041:00]]||86/01:00||[[Media:time2253.png|2132:00]]||89/20:00||[[Media:time2344.png|2223:00]]||93/15:00||[[Media:time2435.png|2314:00]]||97/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1799.png|1678:00]]||70/22:00||[[Media:time1890.png|1769:00]]||74/17:00||[[Media:time1981.png|1860:00]]||78/12:00||[[Media:time2072.png|1951:00]]||82/07:00||[[Media:time2163.png|2042:00]]||86/02:00||[[Media:time2254.png|2133:00]]||89/21:00||[[Media:time2345.png|2224:00]]||93/16:00||[[Media:time2436.png|2315:00]]||97/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1800.png|1679:00]]||70/23:00||[[Media:time1891.png|1770:00]]||74/18:00||[[Media:time1982.png|1861:00]]||78/13:00||[[Media:time2073.png|1952:00]]||82/08:00||[[Media:time2164.png|2043:00]]||86/03:00||[[Media:time2255.png|2134:00]]||89/22:00||[[Media:time2346.png|2225:00]]||93/17:00||[[Media:time2437.png|2316:00]]||97/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1801.png|1680:00]]||71/00:00||[[Media:time1892.png|1771:00]]||74/19:00||[[Media:time1983.png|1862:00]]||78/14:00||[[Media:time2074.png|1953:00]]||82/09:00||[[Media:time2165.png|2044:00]]||86/04:00||[[Media:time2256.png|2135:00]]||89/23:00||[[Media:time2347.png|2226:00]]||93/18:00||[[Media:time2438.png|2317:00]]||97/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1802.png|1681:00]]||71/01:00||[[Media:time1893.png|1772:00]]||74/20:00||[[Media:time1984.png|1863:00]]||78/15:00||[[Media:time2075.png|1954:00]]||82/10:00||[[Media:time2166.png|2045:00]]||86/05:00||[[Media:time2257.png|2136:00]]||90/00:00||[[Media:time2348.png|2227:00]]||93/19:00||[[Media:time2439.png|2318:00]]||97/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1803.png|1682:00]]||71/02:00||[[Media:time1894.png|1773:00]]||74/21:00||[[Media:time1985.png|1864:00]]||78/16:00||[[Media:time2076.png|1955:00]]||82/11:00||[[Media:time2167.png|2046:00]]||86/06:00||[[Media:time2258.png|2137:00]]||90/01:00||[[Media:time2349.png|2228:00]]||93/20:00||[[Media:time2440.png|2319:00]]||97/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1804.png|1683:00]]||71/03:00||[[Media:time1895.png|1774:00]]||74/22:00||[[Media:time1986.png|1865:00]]||78/17:00||[[Media:time2077.png|1956:00]]||82/12:00||[[Media:time2168.png|2047:00]]||86/07:00||[[Media:time2259.png|2138:00]]||90/02:00||[[Media:time2350.png|2229:00]]||93/21:00||[[Media:time2441.png|2319:20]]||97/15:20&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1805.png|1684:00]]||71/04:00||[[Media:time1896.png|1775:00]]||74/23:00||[[Media:time1987.png|1866:00]]||78/18:00||[[Media:time2078.png|1957:00]]||82/13:00||[[Media:time2169.png|2048:00]]||86/08:00||[[Media:time2260.png|2139:00]]||90/03:00||[[Media:time2351.png|2230:00]]||93/22:00||[[Media:time2442.png|2319:21]]||97/15:21&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1806.png|1685:00]]||71/05:00||[[Media:time1897.png|1776:00]]||75/00:00||[[Media:time1988.png|1867:00]]||78/19:00||[[Media:time2079.png|1958:00]]||82/14:00||[[Media:time2170.png|2049:00]]||86/09:00||[[Media:time2261.png|2140:00]]||90/04:00||[[Media:time2352.png|2231:00]]||93/23:00||[[Media:time2443.png|2319:22]]||97/15:22&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1807.png|1686:00]]||71/06:00||[[Media:time1898.png|1777:00]]||75/01:00||[[Media:time1989.png|1868:00]]||78/20:00||[[Media:time2080.png|1959:00]]||82/15:00||[[Media:time2171.png|2050:00]]||86/10:00||[[Media:time2262.png|2141:00]]||90/05:00||[[Media:time2353.png|2232:00]]||94/00:00||[[Media:time2444.png|2319:23]]||97/15:23&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1808.png|1687:00]]||71/07:00||[[Media:time1899.png|1778:00]]||75/02:00||[[Media:time1990.png|1869:00]]||78/21:00||[[Media:time2081.png|1960:00]]||82/16:00||[[Media:time2172.png|2051:00]]||86/11:00||[[Media:time2263.png|2142:00]]||90/06:00||[[Media:time2354.png|2233:00]]||94/01:00||[[Media:time2445.png|2319:24]]||97/15:24&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1809.png|1688:00]]||71/08:00||[[Media:time1900.png|1779:00]]||75/03:00||[[Media:time1991.png|1870:00]]||78/22:00||[[Media:time2082.png|1961:00]]||82/17:00||[[Media:time2173.png|2052:00]]||86/12:00||[[Media:time2264.png|2143:00]]||90/07:00||[[Media:time2355.png|2234:00]]||94/02:00||[[Media:time2446.png|2320:00]]||97/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1810.png|1689:00]]||71/09:00||[[Media:time1901.png|1780:00]]||75/04:00||[[Media:time1992.png|1871:00]]||78/23:00||[[Media:time2083.png|1962:00]]||82/18:00||[[Media:time2174.png|2053:00]]||86/13:00||[[Media:time2265.png|2144:00]]||90/08:00||[[Media:time2356.png|2235:00]]||94/03:00||[[Media:time2447.png|2321:00]]||97/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1811.png|1690:00]]||71/10:00||[[Media:time1902.png|1781:00]]||75/05:00||[[Media:time1993.png|1872:00]]||79/00:00||[[Media:time2084.png|1963:00]]||82/19:00||[[Media:time2175.png|2054:00]]||86/14:00||[[Media:time2266.png|2145:00]]||90/09:00||[[Media:time2357.png|2236:00]]||94/04:00||[[Media:time2448.png|2322:00]]||97/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1812.png|1691:00]]||71/11:00||[[Media:time1903.png|1782:00]]||75/06:00||[[Media:time1994.png|1873:00]]||79/01:00||[[Media:time2085.png|1964:00]]||82/20:00||[[Media:time2176.png|2055:00]]||86/15:00||[[Media:time2267.png|2146:00]]||90/10:00||[[Media:time2358.png|2237:00]]||94/05:00||[[Media:time2449.png|2323:00]]||97/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1813.png|1692:00]]||71/12:00||[[Media:time1904.png|1783:00]]||75/07:00||[[Media:time1995.png|1874:00]]||79/02:00||[[Media:time2086.png|1965:00]]||82/21:00||[[Media:time2177.png|2056:00]]||86/16:00||[[Media:time2268.png|2147:00]]||90/11:00||[[Media:time2359.png|2238:00]]||94/06:00||[[Media:time2450.png|2324:00]]||97/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1814.png|1693:00]]||71/13:00||[[Media:time1905.png|1784:00]]||75/08:00||[[Media:time1996.png|1875:00]]||79/03:00||[[Media:time2087.png|1966:00]]||82/22:00||[[Media:time2178.png|2057:00]]||86/17:00||[[Media:time2269.png|2148:00]]||90/12:00||[[Media:time2360.png|2239:00]]||94/07:00||[[Media:time2451.png|2325:00]]||97/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1815.png|1694:00]]||71/14:00||[[Media:time1906.png|1785:00]]||75/09:00||[[Media:time1997.png|1876:00]]||79/04:00||[[Media:time2088.png|1967:00]]||82/23:00||[[Media:time2179.png|2058:00]]||86/18:00||[[Media:time2270.png|2149:00]]||90/13:00||[[Media:time2361.png|2240:00]]||94/08:00||[[Media:time2452.png|2326:00]]||97/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1816.png|1695:00]]||71/15:00||[[Media:time1907.png|1786:00]]||75/10:00||[[Media:time1998.png|1877:00]]||79/05:00||[[Media:time2089.png|1968:00]]||83/00:00||[[Media:time2180.png|2059:00]]||86/19:00||[[Media:time2271.png|2150:00]]||90/14:00||[[Media:time2362.png|2241:00]]||94/09:00||[[Media:time2453.png|2327:00]]||97/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1817.png|1696:00]]||71/16:00||[[Media:time1908.png|1787:00]]||75/11:00||[[Media:time1999.png|1878:00]]||79/06:00||[[Media:time2090.png|1969:00]]||83/01:00||[[Media:time2181.png|2060:00]]||86/20:00||[[Media:time2272.png|2151:00]]||90/15:00||[[Media:time2363.png|2242:00]]||94/10:00||[[Media:time2454.png|2328:00]]||98/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1818.png|1697:00]]||71/17:00||[[Media:time1909.png|1788:00]]||75/12:00||[[Media:time2000.png|1879:00]]||79/07:00||[[Media:time2091.png|1970:00]]||83/02:00||[[Media:time2182.png|2061:00]]||86/21:00||[[Media:time2273.png|2152:00]]||90/16:00||[[Media:time2364.png|2243:00]]||94/11:00||[[Media:time2455.png|2329:00]]||98/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1819.png|1698:00]]||71/18:00||[[Media:time1910.png|1789:00]]||75/13:00||[[Media:time2001.png|1880:00]]||79/08:00||[[Media:time2092.png|1971:00]]||83/03:00||[[Media:time2183.png|2062:00]]||86/22:00||[[Media:time2274.png|2153:00]]||90/17:00||[[Media:time2365.png|2244:00]]||94/12:00||[[Media:time2456.png|2330:00]]||98/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1820.png|1699:00]]||71/19:00||[[Media:time1911.png|1790:00]]||75/14:00||[[Media:time2002.png|1881:00]]||79/09:00||[[Media:time2093.png|1972:00]]||83/04:00||[[Media:time2184.png|2063:00]]||86/23:00||[[Media:time2275.png|2154:00]]||90/18:00||[[Media:time2366.png|2245:00]]||94/13:00||[[Media:time2457.png|2331:00]]||98/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1821.png|1700:00]]||71/20:00||[[Media:time1912.png|1791:00]]||75/15:00||[[Media:time2003.png|1882:00]]||79/10:00||[[Media:time2094.png|1973:00]]||83/05:00||[[Media:time2185.png|2064:00]]||87/00:00||[[Media:time2276.png|2155:00]]||90/19:00||[[Media:time2367.png|2246:00]]||94/14:00||[[Media:time2458.png|2332:00]]||98/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1822.png|1701:00]]||71/21:00||[[Media:time1913.png|1792:00]]||75/16:00||[[Media:time2004.png|1883:00]]||79/11:00||[[Media:time2095.png|1974:00]]||83/06:00||[[Media:time2186.png|2065:00]]||87/01:00||[[Media:time2277.png|2156:00]]||90/20:00||[[Media:time2368.png|2247:00]]||94/15:00||[[Media:time2459.png|2333:00]]||98/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1823.png|1702:00]]||71/22:00||[[Media:time1914.png|1793:00]]||75/17:00||[[Media:time2005.png|1884:00]]||79/12:00||[[Media:time2096.png|1975:00]]||83/07:00||[[Media:time2187.png|2066:00]]||87/02:00||[[Media:time2278.png|2157:00]]||90/21:00||[[Media:time2369.png|2248:00]]||94/16:00||[[Media:time2460.png|2334:00]]||98/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1824.png|1703:00]]||71/23:00||[[Media:time1915.png|1794:00]]||75/18:00||[[Media:time2006.png|1885:00]]||79/13:00||[[Media:time2097.png|1976:00]]||83/08:00||[[Media:time2188.png|2067:00]]||87/03:00||[[Media:time2279.png|2158:00]]||90/22:00||[[Media:time2370.png|2249:00]]||94/17:00||[[Media:time2461.png|2335:00]]||98/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1825.png|1704:00]]||72/00:00||[[Media:time1916.png|1795:00]]||75/19:00||[[Media:time2007.png|1886:00]]||79/14:00||[[Media:time2098.png|1977:00]]||83/09:00||[[Media:time2189.png|2068:00]]||87/04:00||[[Media:time2280.png|2159:00]]||90/23:00||[[Media:time2371.png|2250:00]]||94/18:00||[[Media:time2462.png|2336:00]]||98/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1826.png|1705:00]]||72/01:00||[[Media:time1917.png|1796:00]]||75/20:00||[[Media:time2008.png|1887:00]]||79/15:00||[[Media:time2099.png|1978:00]]||83/10:00||[[Media:time2190.png|2069:00]]||87/05:00||[[Media:time2281.png|2160:00]]||91/00:00||[[Media:time2372.png|2251:00]]||94/19:00||[[Media:time2463.png|2337:00]]||98/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1827.png|1706:00]]||72/02:00||[[Media:time1918.png|1797:00]]||75/21:00||[[Media:time2009.png|1888:00]]||79/16:00||[[Media:time2100.png|1979:00]]||83/11:00||[[Media:time2191.png|2070:00]]||87/06:00||[[Media:time2282.png|2161:00]]||91/01:00||[[Media:time2373.png|2252:00]]||94/20:00||[[Media:time2464.png|2338:00]]||98/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1828.png|1707:00]]||72/03:00||[[Media:time1919.png|1798:00]]||75/22:00||[[Media:time2010.png|1889:00]]||79/17:00||[[Media:time2101.png|1980:00]]||83/12:00||[[Media:time2192.png|2071:00]]||87/07:00||[[Media:time2283.png|2162:00]]||91/02:00||[[Media:time2374.png|2253:00]]||94/21:00||[[Media:time2465.png|2339:00]]||98/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1829.png|1708:00]]||72/04:00||[[Media:time1920.png|1799:00]]||75/23:00||[[Media:time2011.png|1890:00]]||79/18:00||[[Media:time2102.png|1981:00]]||83/13:00||[[Media:time2193.png|2072:00]]||87/08:00||[[Media:time2284.png|2163:00]]||91/03:00||[[Media:time2375.png|2254:00]]||94/22:00||[[Media:time2466.png|2340:00]]||98/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1830.png|1709:00]]||72/05:00||[[Media:time1921.png|1800:00]]||76/00:00||[[Media:time2012.png|1891:00]]||79/19:00||[[Media:time2103.png|1982:00]]||83/14:00||[[Media:time2194.png|2073:00]]||87/09:00||[[Media:time2285.png|2164:00]]||91/04:00||[[Media:time2376.png|2255:00]]||94/23:00||[[Media:time2467.png|2341:00]]||98/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1831.png|1710:00]]||72/06:00||[[Media:time1922.png|1801:00]]||76/01:00||[[Media:time2013.png|1892:00]]||79/20:00||[[Media:time2104.png|1983:00]]||83/15:00||[[Media:time2195.png|2074:00]]||87/10:00||[[Media:time2286.png|2165:00]]||91/05:00||[[Media:time2377.png|2256:00]]||95/00:00||[[Media:time2468.png|2342:00]]||98/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1832.png|1711:00]]||72/07:00||[[Media:time1923.png|1802:00]]||76/02:00||[[Media:time2014.png|1893:00]]||79/21:00||[[Media:time2105.png|1984:00]]||83/16:00||[[Media:time2196.png|2075:00]]||87/11:00||[[Media:time2287.png|2166:00]]||91/06:00||[[Media:time2378.png|2257:00]]||95/01:00||[[Media:time2469.png|2343:00]]||98/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1833.png|1712:00]]||72/08:00||[[Media:time1924.png|1803:00]]||76/03:00||[[Media:time2015.png|1894:00]]||79/22:00||[[Media:time2106.png|1985:00]]||83/17:00||[[Media:time2197.png|2076:00]]||87/12:00||[[Media:time2288.png|2167:00]]||91/07:00||[[Media:time2379.png|2258:00]]||95/02:00||[[Media:time2470.png|2344:00]]||98/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1834.png|1713:00]]||72/09:00||[[Media:time1925.png|1804:00]]||76/04:00||[[Media:time2016.png|1895:00]]||79/23:00||[[Media:time2107.png|1986:00]]||83/18:00||[[Media:time2198.png|2077:00]]||87/13:00||[[Media:time2289.png|2168:00]]||91/08:00||[[Media:time2380.png|2259:00]]||95/03:00||[[Media:time2471.png|2345:00]]||98/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1835.png|1714:00]]||72/10:00||[[Media:time1926.png|1805:00]]||76/05:00||[[Media:time2017.png|1896:00]]||80/00:00||[[Media:time2108.png|1987:00]]||83/19:00||[[Media:time2199.png|2078:00]]||87/14:00||[[Media:time2290.png|2169:00]]||91/09:00||[[Media:time2381.png|2260:00]]||95/04:00||[[Media:time2472.png|2346:00]]||98/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1836.png|1715:00]]||72/11:00||[[Media:time1927.png|1806:00]]||76/06:00||[[Media:time2018.png|1897:00]]||80/01:00||[[Media:time2109.png|1988:00]]||83/20:00||[[Media:time2200.png|2079:00]]||87/15:00||[[Media:time2291.png|2170:00]]||91/10:00||[[Media:time2382.png|2261:00]]||95/05:00||[[Media:time2473.png|2347:00]]||98/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1837.png|1716:00]]||72/12:00||[[Media:time1928.png|1807:00]]||76/07:00||[[Media:time2019.png|1898:00]]||80/02:00||[[Media:time2110.png|1989:00]]||83/21:00||[[Media:time2201.png|2080:00]]||87/16:00||[[Media:time2292.png|2171:00]]||91/11:00||[[Media:time2383.png|2262:00]]||95/06:00||[[Media:time2474.png|2348:00]]||98/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1838.png|1717:00]]||72/13:00||[[Media:time1929.png|1808:00]]||76/08:00||[[Media:time2020.png|1899:00]]||80/03:00||[[Media:time2111.png|1990:00]]||83/22:00||[[Media:time2202.png|2081:00]]||87/17:00||[[Media:time2293.png|2172:00]]||91/12:00||[[Media:time2384.png|2263:00]]||95/07:00||[[Media:time2475.png|2349:00]]||98/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1839.png|1718:00]]||72/14:00||[[Media:time1930.png|1809:00]]||76/09:00||[[Media:time2021.png|1900:00]]||80/04:00||[[Media:time2112.png|1991:00]]||83/23:00||[[Media:time2203.png|2082:00]]||87/18:00||[[Media:time2294.png|2173:00]]||91/13:00||[[Media:time2385.png|2264:00]]||95/08:00||[[Media:time2476.png|2350:00]]||98/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1840.png|1719:00]]||72/15:00||[[Media:time1931.png|1810:00]]||76/10:00||[[Media:time2022.png|1901:00]]||80/05:00||[[Media:time2113.png|1992:00]]||84/00:00||[[Media:time2204.png|2083:00]]||87/19:00||[[Media:time2295.png|2174:00]]||91/14:00||[[Media:time2386.png|2265:00]]||95/09:00||[[Media:time2477.png|2351:00]]||98/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1841.png|1720:00]]||72/16:00||[[Media:time1932.png|1811:00]]||76/11:00||[[Media:time2023.png|1902:00]]||80/06:00||[[Media:time2114.png|1993:00]]||84/01:00||[[Media:time2205.png|2084:00]]||87/20:00||[[Media:time2296.png|2175:00]]||91/15:00||[[Media:time2387.png|2266:00]]||95/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1842.png|1721:00]]||72/17:00||[[Media:time1933.png|1812:00]]||76/12:00||[[Media:time2024.png|1903:00]]||80/07:00||[[Media:time2115.png|1994:00]]||84/02:00||[[Media:time2206.png|2085:00]]||87/21:00||[[Media:time2297.png|2176:00]]||91/16:00||[[Media:time2388.png|2267:00]]||95/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time1843.png|1722:00]]||72/18:00||[[Media:time1934.png|1813:00]]||76/13:00||[[Media:time2025.png|1904:00]]||80/08:00||[[Media:time2116.png|1995:00]]||84/03:00||[[Media:time2207.png|2086:00]]||87/22:00||[[Media:time2298.png|2177:00]]||91/17:00||[[Media:time2389.png|2268:00]]||95/12:00&lt;br /&gt;
|}&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
===July 2013===&lt;br /&gt;
&amp;lt;div class=&amp;quot;mw-collapsible mw-collapsed&amp;quot;&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
{| class=&amp;quot;wikitable plainlinks table-padding&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
!Image&lt;br /&gt;
!Day/Time&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2478.png|2352:00]]||99/00:00||[[Media:time2556.png|2430:00]]||102/06:00||[[Media:time2634.png|2508:00]]||105/12:00||[[Media:time2712.png|2586:00]]||108/18:00||[[Media:time2790.png|2664:00]]||112/00:00||[[Media:time2868.png|2742:00]]||115/06:00||[[Media:time2946.png|2820:00]]||118/12:00||[[Media:time3024.png|2898:00]]||121/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2479.png|2353:00]]||99/01:00||[[Media:time2557.png|2431:00]]||102/07:00||[[Media:time2635.png|2509:00]]||105/13:00||[[Media:time2713.png|2587:00]]||108/19:00||[[Media:time2791.png|2665:00]]||112/01:00||[[Media:time2869.png|2743:00]]||115/07:00||[[Media:time2947.png|2821:00]]||118/13:00||[[Media:time3025.png|2899:00]]||121/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2480.png|2354:00]]||99/02:00||[[Media:time2558.png|2432:00]]||102/08:00||[[Media:time2636.png|2510:00]]||105/14:00||[[Media:time2714.png|2588:00]]||108/20:00||[[Media:time2792.png|2666:00]]||112/02:00||[[Media:time2870.png|2744:00]]||115/08:00||[[Media:time2948.png|2822:00]]||118/14:00||[[Media:time3026.png|2900:00]]||121/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2481.png|2355:00]]||99/03:00||[[Media:time2559.png|2433:00]]||102/09:00||[[Media:time2637.png|2511:00]]||105/15:00||[[Media:time2715.png|2589:00]]||108/21:00||[[Media:time2793.png|2667:00]]||112/03:00||[[Media:time2871.png|2745:00]]||115/09:00||[[Media:time2949.png|2823:00]]||118/15:00||[[Media:time3027.png|2901:00]]||121/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2482.png|2356:00]]||99/04:00||[[Media:time2560.png|2434:00]]||102/10:00||[[Media:time2638.png|2512:00]]||105/16:00||[[Media:time2716.png|2590:00]]||108/22:00||[[Media:time2794.png|2668:00]]||112/04:00||[[Media:time2872.png|2746:00]]||115/10:00||[[Media:time2950.png|2824:00]]||118/16:00||[[Media:time3028.png|2902:00]]||121/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2483.png|2357:00]]||99/05:00||[[Media:time2561.png|2435:00]]||102/11:00||[[Media:time2639.png|2513:00]]||105/17:00||[[Media:time2717.png|2591:00]]||108/23:00||[[Media:time2795.png|2669:00]]||112/05:00||[[Media:time2873.png|2747:00]]||115/11:00||[[Media:time2951.png|2825:00]]||118/17:00||[[Media:time3029.png|2903:00]]||121/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2484.png|2358:00]]||99/06:00||[[Media:time2562.png|2436:00]]||102/12:00||[[Media:time2640.png|2514:00]]||105/18:00||[[Media:time2718.png|2592:00]]||109/00:00||[[Media:time2796.png|2670:00]]||112/06:00||[[Media:time2874.png|2748:00]]||115/12:00||[[Media:time2952.png|2826:00]]||118/18:00||[[Media:time3030.png|2904:00]]||122/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2485.png|2359:00]]||99/07:00||[[Media:time2563.png|2437:00]]||102/13:00||[[Media:time2641.png|2515:00]]||105/19:00||[[Media:time2719.png|2593:00]]||109/01:00||[[Media:time2797.png|2671:00]]||112/07:00||[[Media:time2875.png|2749:00]]||115/13:00||[[Media:time2953.png|2827:00]]||118/19:00||[[Media:time3031.png|2905:00]]||122/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2486.png|2360:00]]||99/08:00||[[Media:time2564.png|2438:00]]||102/14:00||[[Media:time2642.png|2516:00]]||105/20:00||[[Media:time2720.png|2594:00]]||109/02:00||[[Media:time2798.png|2672:00]]||112/08:00||[[Media:time2876.png|2750:00]]||115/14:00||[[Media:time2954.png|2828:00]]||118/20:00||[[Media:time3032.png|2906:00]]||122/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2487.png|2361:00]]||99/09:00||[[Media:time2565.png|2439:00]]||102/15:00||[[Media:time2643.png|2517:00]]||105/21:00||[[Media:time2721.png|2595:00]]||109/03:00||[[Media:time2799.png|2673:00]]||112/09:00||[[Media:time2877.png|2751:00]]||115/15:00||[[Media:time2955.png|2829:00]]||118/21:00||[[Media:time3033.png|2907:00]]||122/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2488.png|2362:00]]||99/10:00||[[Media:time2566.png|2440:00]]||102/16:00||[[Media:time2644.png|2518:00]]||105/22:00||[[Media:time2722.png|2596:00]]||109/04:00||[[Media:time2800.png|2674:00]]||112/10:00||[[Media:time2878.png|2752:00]]||115/16:00||[[Media:time2956.png|2830:00]]||118/22:00||[[Media:time3034.png|2908:00]]||122/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2489.png|2363:00]]||99/11:00||[[Media:time2567.png|2441:00]]||102/17:00||[[Media:time2645.png|2519:00]]||105/23:00||[[Media:time2723.png|2597:00]]||109/05:00||[[Media:time2801.png|2675:00]]||112/11:00||[[Media:time2879.png|2753:00]]||115/17:00||[[Media:time2957.png|2831:00]]||118/23:00||[[Media:time3035.png|2909:00]]||122/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2490.png|2364:00]]||99/12:00||[[Media:time2568.png|2442:00]]||102/18:00||[[Media:time2646.png|2520:00]]||106/00:00||[[Media:time2724.png|2598:00]]||109/06:00||[[Media:time2802.png|2676:00]]||112/12:00||[[Media:time2880.png|2754:00]]||115/18:00||[[Media:time2958.png|2832:00]]||119/00:00||[[Media:time3036.png|2910:00]]||122/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2491.png|2365:00]]||99/13:00||[[Media:time2569.png|2443:00]]||102/19:00||[[Media:time2647.png|2521:00]]||106/01:00||[[Media:time2725.png|2599:00]]||109/07:00||[[Media:time2803.png|2677:00]]||112/13:00||[[Media:time2881.png|2755:00]]||115/19:00||[[Media:time2959.png|2833:00]]||119/01:00||[[Media:time3037.png|2911:00]]||122/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2492.png|2366:00]]||99/14:00||[[Media:time2570.png|2444:00]]||102/20:00||[[Media:time2648.png|2522:00]]||106/02:00||[[Media:time2726.png|2600:00]]||109/08:00||[[Media:time2804.png|2678:00]]||112/14:00||[[Media:time2882.png|2756:00]]||115/20:00||[[Media:time2960.png|2834:00]]||119/02:00||[[Media:time3038.png|2912:00]]||122/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2493.png|2367:00]]||99/15:00||[[Media:time2571.png|2445:00]]||102/21:00||[[Media:time2649.png|2523:00]]||106/03:00||[[Media:time2727.png|2601:00]]||109/09:00||[[Media:time2805.png|2679:00]]||112/15:00||[[Media:time2883.png|2757:00]]||115/21:00||[[Media:time2961.png|2835:00]]||119/03:00||[[Media:time3039.png|2913:00]]||122/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2494.png|2368:00]]||99/16:00||[[Media:time2572.png|2446:00]]||102/22:00||[[Media:time2650.png|2524:00]]||106/04:00||[[Media:time2728.png|2602:00]]||109/10:00||[[Media:time2806.png|2680:00]]||112/16:00||[[Media:time2884.png|2758:00]]||115/22:00||[[Media:time2962.png|2836:00]]||119/04:00||[[Media:time3040.png|2914:00]]||122/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2495.png|2369:00]]||99/17:00||[[Media:time2573.png|2447:00]]||102/23:00||[[Media:time2651.png|2525:00]]||106/05:00||[[Media:time2729.png|2603:00]]||109/11:00||[[Media:time2807.png|2681:00]]||112/17:00||[[Media:time2885.png|2759:00]]||115/23:00||[[Media:time2963.png|2837:00]]||119/05:00||[[Media:time3041.png|2915:00]]||122/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2496.png|2370:00]]||99/18:00||[[Media:time2574.png|2448:00]]||103/00:00||[[Media:time2652.png|2526:00]]||106/06:00||[[Media:time2730.png|2604:00]]||109/12:00||[[Media:time2808.png|2682:00]]||112/18:00||[[Media:time2886.png|2760:00]]||116/00:00||[[Media:time2964.png|2838:00]]||119/06:00||[[Media:time3042.png|2916:00]]||122/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2497.png|2371:00]]||99/19:00||[[Media:time2575.png|2449:00]]||103/01:00||[[Media:time2653.png|2527:00]]||106/07:00||[[Media:time2731.png|2605:00]]||109/13:00||[[Media:time2809.png|2683:00]]||112/19:00||[[Media:time2887.png|2761:00]]||116/01:00||[[Media:time2965.png|2839:00]]||119/07:00||[[Media:time3043.png|2917:00]]||122/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2498.png|2372:00]]||99/20:00||[[Media:time2576.png|2450:00]]||103/02:00||[[Media:time2654.png|2528:00]]||106/08:00||[[Media:time2732.png|2606:00]]||109/14:00||[[Media:time2810.png|2684:00]]||112/20:00||[[Media:time2888.png|2762:00]]||116/02:00||[[Media:time2966.png|2840:00]]||119/08:00||[[Media:time3044.png|2918:00]]||122/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2499.png|2373:00]]||99/21:00||[[Media:time2577.png|2451:00]]||103/03:00||[[Media:time2655.png|2529:00]]||106/09:00||[[Media:time2733.png|2607:00]]||109/15:00||[[Media:time2811.png|2685:00]]||112/21:00||[[Media:time2889.png|2763:00]]||116/03:00||[[Media:time2967.png|2841:00]]||119/09:00||[[Media:time3045.png|2919:00]]||122/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2500.png|2374:00]]||99/22:00||[[Media:time2578.png|2452:00]]||103/04:00||[[Media:time2656.png|2530:00]]||106/10:00||[[Media:time2734.png|2608:00]]||109/16:00||[[Media:time2812.png|2686:00]]||112/22:00||[[Media:time2890.png|2764:00]]||116/04:00||[[Media:time2968.png|2842:00]]||119/10:00||[[Media:time3046.png|2920:00]]||122/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2501.png|2375:00]]||99/23:00||[[Media:time2579.png|2453:00]]||103/05:00||[[Media:time2657.png|2531:00]]||106/11:00||[[Media:time2735.png|2609:00]]||109/17:00||[[Media:time2813.png|2687:00]]||112/23:00||[[Media:time2891.png|2765:00]]||116/05:00||[[Media:time2969.png|2843:00]]||119/11:00||[[Media:time3047.png|2921:00]]||122/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2502.png|2376:00]]||100/00:00||[[Media:time2580.png|2454:00]]||103/06:00||[[Media:time2658.png|2532:00]]||106/12:00||[[Media:time2736.png|2610:00]]||109/18:00||[[Media:time2814.png|2688:00]]||113/00:00||[[Media:time2892.png|2766:00]]||116/06:00||[[Media:time2970.png|2844:00]]||119/12:00||[[Media:time3048.png|2922:00]]||122/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2503.png|2377:00]]||100/01:00||[[Media:time2581.png|2455:00]]||103/07:00||[[Media:time2659.png|2533:00]]||106/13:00||[[Media:time2737.png|2611:00]]||109/19:00||[[Media:time2815.png|2689:00]]||113/01:00||[[Media:time2893.png|2767:00]]||116/07:00||[[Media:time2971.png|2845:00]]||119/13:00||[[Media:time3049.png|2923:00]]||122/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2504.png|2378:00]]||100/02:00||[[Media:time2582.png|2456:00]]||103/08:00||[[Media:time2660.png|2534:00]]||106/14:00||[[Media:time2738.png|2612:00]]||109/20:00||[[Media:time2816.png|2690:00]]||113/02:00||[[Media:time2894.png|2768:00]]||116/08:00||[[Media:time2972.png|2846:00]]||119/14:00||[[Media:time3050.png|2924:00]]||122/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2505.png|2379:00]]||100/03:00||[[Media:time2583.png|2457:00]]||103/09:00||[[Media:time2661.png|2535:00]]||106/15:00||[[Media:time2739.png|2613:00]]||109/21:00||[[Media:time2817.png|2691:00]]||113/03:00||[[Media:time2895.png|2769:00]]||116/09:00||[[Media:time2973.png|2847:00]]||119/15:00||[[Media:time3051.png|2925:00]]||122/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2506.png|2380:00]]||100/04:00||[[Media:time2584.png|2458:00]]||103/10:00||[[Media:time2662.png|2536:00]]||106/16:00||[[Media:time2740.png|2614:00]]||109/22:00||[[Media:time2818.png|2692:00]]||113/04:00||[[Media:time2896.png|2770:00]]||116/10:00||[[Media:time2974.png|2848:00]]||119/16:00||[[Media:time3052.png|2926:00]]||122/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2507.png|2381:00]]||100/05:00||[[Media:time2585.png|2459:00]]||103/11:00||[[Media:time2663.png|2537:00]]||106/17:00||[[Media:time2741.png|2615:00]]||109/23:00||[[Media:time2819.png|2693:00]]||113/05:00||[[Media:time2897.png|2771:00]]||116/11:00||[[Media:time2975.png|2849:00]]||119/17:00||[[Media:time3053.png|2927:00]]||122/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2508.png|2382:00]]||100/06:00||[[Media:time2586.png|2460:00]]||103/12:00||[[Media:time2664.png|2538:00]]||106/18:00||[[Media:time2742.png|2616:00]]||110/00:00||[[Media:time2820.png|2694:00]]||113/06:00||[[Media:time2898.png|2772:00]]||116/12:00||[[Media:time2976.png|2850:00]]||119/18:00||[[Media:time3054.png|2928:00]]||123/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2509.png|2383:00]]||100/07:00||[[Media:time2587.png|2461:00]]||103/13:00||[[Media:time2665.png|2539:00]]||106/19:00||[[Media:time2743.png|2617:00]]||110/01:00||[[Media:time2821.png|2695:00]]||113/07:00||[[Media:time2899.png|2773:00]]||116/13:00||[[Media:time2977.png|2851:00]]||119/19:00||[[Media:time3055.png|2929:00]]||123/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2510.png|2384:00]]||100/08:00||[[Media:time2588.png|2462:00]]||103/14:00||[[Media:time2666.png|2540:00]]||106/20:00||[[Media:time2744.png|2618:00]]||110/02:00||[[Media:time2822.png|2696:00]]||113/08:00||[[Media:time2900.png|2774:00]]||116/14:00||[[Media:time2978.png|2852:00]]||119/20:00||[[Media:time3056.png|2930:00]]||123/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2511.png|2385:00]]||100/09:00||[[Media:time2589.png|2463:00]]||103/15:00||[[Media:time2667.png|2541:00]]||106/21:00||[[Media:time2745.png|2619:00]]||110/03:00||[[Media:time2823.png|2697:00]]||113/09:00||[[Media:time2901.png|2775:00]]||116/15:00||[[Media:time2979.png|2853:00]]||119/21:00||[[Media:time3057.png|2931:00]]||123/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2512.png|2386:00]]||100/10:00||[[Media:time2590.png|2464:00]]||103/16:00||[[Media:time2668.png|2542:00]]||106/22:00||[[Media:time2746.png|2620:00]]||110/04:00||[[Media:time2824.png|2698:00]]||113/10:00||[[Media:time2902.png|2776:00]]||116/16:00||[[Media:time2980.png|2854:00]]||119/22:00||[[Media:time3058.png|2932:00]]||123/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2513.png|2387:00]]||100/11:00||[[Media:time2591.png|2465:00]]||103/17:00||[[Media:time2669.png|2543:00]]||106/23:00||[[Media:time2747.png|2621:00]]||110/05:00||[[Media:time2825.png|2699:00]]||113/11:00||[[Media:time2903.png|2777:00]]||116/17:00||[[Media:time2981.png|2855:00]]||119/23:00||[[Media:time3059.png|2933:00]]||123/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2514.png|2388:00]]||100/12:00||[[Media:time2592.png|2466:00]]||103/18:00||[[Media:time2670.png|2544:00]]||107/00:00||[[Media:time2748.png|2622:00]]||110/06:00||[[Media:time2826.png|2700:00]]||113/12:00||[[Media:time2904.png|2778:00]]||116/18:00||[[Media:time2982.png|2856:00]]||120/00:00||[[Media:time3060.png|2934:00]]||123/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2515.png|2389:00]]||100/13:00||[[Media:time2593.png|2467:00]]||103/19:00||[[Media:time2671.png|2545:00]]||107/01:00||[[Media:time2749.png|2623:00]]||110/07:00||[[Media:time2827.png|2701:00]]||113/13:00||[[Media:time2905.png|2779:00]]||116/19:00||[[Media:time2983.png|2857:00]]||120/01:00||[[Media:time3061.png|2935:00]]||123/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2516.png|2390:00]]||100/14:00||[[Media:time2594.png|2468:00]]||103/20:00||[[Media:time2672.png|2546:00]]||107/02:00||[[Media:time2750.png|2624:00]]||110/08:00||[[Media:time2828.png|2702:00]]||113/14:00||[[Media:time2906.png|2780:00]]||116/20:00||[[Media:time2984.png|2858:00]]||120/02:00||[[Media:time3062.png|2936:00]]||123/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2517.png|2391:00]]||100/15:00||[[Media:time2595.png|2469:00]]||103/21:00||[[Media:time2673.png|2547:00]]||107/03:00||[[Media:time2751.png|2625:00]]||110/09:00||[[Media:time2829.png|2703:00]]||113/15:00||[[Media:time2907.png|2781:00]]||116/21:00||[[Media:time2985.png|2859:00]]||120/03:00||[[Media:time3063.png|2937:00]]||123/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2518.png|2392:00]]||100/16:00||[[Media:time2596.png|2470:00]]||103/22:00||[[Media:time2674.png|2548:00]]||107/04:00||[[Media:time2752.png|2626:00]]||110/10:00||[[Media:time2830.png|2704:00]]||113/16:00||[[Media:time2908.png|2782:00]]||116/22:00||[[Media:time2986.png|2860:00]]||120/04:00||[[Media:time3064.png|2938:00]]||123/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2519.png|2393:00]]||100/17:00||[[Media:time2597.png|2471:00]]||103/23:00||[[Media:time2675.png|2549:00]]||107/05:00||[[Media:time2753.png|2627:00]]||110/11:00||[[Media:time2831.png|2705:00]]||113/17:00||[[Media:time2909.png|2783:00]]||116/23:00||[[Media:time2987.png|2861:00]]||120/05:00||[[Media:time3065.png|2939:00]]||123/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2520.png|2394:00]]||100/18:00||[[Media:time2598.png|2472:00]]||104/00:00||[[Media:time2676.png|2550:00]]||107/06:00||[[Media:time2754.png|2628:00]]||110/12:00||[[Media:time2832.png|2706:00]]||113/18:00||[[Media:time2910.png|2784:00]]||117/00:00||[[Media:time2988.png|2862:00]]||120/06:00||[[Media:time3066.png|2940:00]]||123/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2521.png|2395:00]]||100/19:00||[[Media:time2599.png|2473:00]]||104/01:00||[[Media:time2677.png|2551:00]]||107/07:00||[[Media:time2755.png|2629:00]]||110/13:00||[[Media:time2833.png|2707:00]]||113/19:00||[[Media:time2911.png|2785:00]]||117/01:00||[[Media:time2989.png|2863:00]]||120/07:00||[[Media:time3067.png|2941:00]]||123/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2522.png|2396:00]]||100/20:00||[[Media:time2600.png|2474:00]]||104/02:00||[[Media:time2678.png|2552:00]]||107/08:00||[[Media:time2756.png|2630:00]]||110/14:00||[[Media:time2834.png|2708:00]]||113/20:00||[[Media:time2912.png|2786:00]]||117/02:00||[[Media:time2990.png|2864:00]]||120/08:00||[[Media:time3068.png|2942:00]]||123/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2523.png|2397:00]]||100/21:00||[[Media:time2601.png|2475:00]]||104/03:00||[[Media:time2679.png|2553:00]]||107/09:00||[[Media:time2757.png|2631:00]]||110/15:00||[[Media:time2835.png|2709:00]]||113/21:00||[[Media:time2913.png|2787:00]]||117/03:00||[[Media:time2991.png|2865:00]]||120/09:00||[[Media:time3069.png|2943:00]]||123/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2524.png|2398:00]]||100/22:00||[[Media:time2602.png|2476:00]]||104/04:00||[[Media:time2680.png|2554:00]]||107/10:00||[[Media:time2758.png|2632:00]]||110/16:00||[[Media:time2836.png|2710:00]]||113/22:00||[[Media:time2914.png|2788:00]]||117/04:00||[[Media:time2992.png|2866:00]]||120/10:00||[[Media:time3070.png|2944:00]]||123/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2525.png|2399:00]]||100/23:00||[[Media:time2603.png|2477:00]]||104/05:00||[[Media:time2681.png|2555:00]]||107/11:00||[[Media:time2759.png|2633:00]]||110/17:00||[[Media:time2837.png|2711:00]]||113/23:00||[[Media:time2915.png|2789:00]]||117/05:00||[[Media:time2993.png|2867:00]]||120/11:00||[[Media:time3071.png|2945:00]]||123/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2526.png|2400:00]]||101/00:00||[[Media:time2604.png|2478:00]]||104/06:00||[[Media:time2682.png|2556:00]]||107/12:00||[[Media:time2760.png|2634:00]]||110/18:00||[[Media:time2838.png|2712:00]]||114/00:00||[[Media:time2916.png|2790:00]]||117/06:00||[[Media:time2994.png|2868:00]]||120/12:00||[[Media:time3072.png|2946:00]]||123/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2527.png|2401:00]]||101/01:00||[[Media:time2605.png|2479:00]]||104/07:00||[[Media:time2683.png|2557:00]]||107/13:00||[[Media:time2761.png|2635:00]]||110/19:00||[[Media:time2839.png|2713:00]]||114/01:00||[[Media:time2917.png|2791:00]]||117/07:00||[[Media:time2995.png|2869:00]]||120/13:00||[[Media:time3073.png|2947:00]]||123/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2528.png|2402:00]]||101/02:00||[[Media:time2606.png|2480:00]]||104/08:00||[[Media:time2684.png|2558:00]]||107/14:00||[[Media:time2762.png|2636:00]]||110/20:00||[[Media:time2840.png|2714:00]]||114/02:00||[[Media:time2918.png|2792:00]]||117/08:00||[[Media:time2996.png|2870:00]]||120/14:00||[[Media:time3074.png|2948:00]]||123/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2529.png|2403:00]]||101/03:00||[[Media:time2607.png|2481:00]]||104/09:00||[[Media:time2685.png|2559:00]]||107/15:00||[[Media:time2763.png|2637:00]]||110/21:00||[[Media:time2841.png|2715:00]]||114/03:00||[[Media:time2919.png|2793:00]]||117/09:00||[[Media:time2997.png|2871:00]]||120/15:00||[[Media:time3075.png|2949:00]]||123/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2530.png|2404:00]]||101/04:00||[[Media:time2608.png|2482:00]]||104/10:00||[[Media:time2686.png|2560:00]]||107/16:00||[[Media:time2764.png|2638:00]]||110/22:00||[[Media:time2842.png|2716:00]]||114/04:00||[[Media:time2920.png|2794:00]]||117/10:00||[[Media:time2998.png|2872:00]]||120/16:00||[[Media:time3076.png|2950:00]]||123/22:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2531.png|2405:00]]||101/05:00||[[Media:time2609.png|2483:00]]||104/11:00||[[Media:time2687.png|2561:00]]||107/17:00||[[Media:time2765.png|2639:00]]||110/23:00||[[Media:time2843.png|2717:00]]||114/05:00||[[Media:time2921.png|2795:00]]||117/11:00||[[Media:time2999.png|2873:00]]||120/17:00||[[Media:time3077.png|2951:00]]||123/23:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2532.png|2406:00]]||101/06:00||[[Media:time2610.png|2484:00]]||104/12:00||[[Media:time2688.png|2562:00]]||107/18:00||[[Media:time2766.png|2640:00]]||111/00:00||[[Media:time2844.png|2718:00]]||114/06:00||[[Media:time2922.png|2796:00]]||117/12:00||[[Media:time3000.png|2874:00]]||120/18:00||[[Media:time3078.png|2952:00]]||124/00:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2533.png|2407:00]]||101/07:00||[[Media:time2611.png|2485:00]]||104/13:00||[[Media:time2689.png|2563:00]]||107/19:00||[[Media:time2767.png|2641:00]]||111/01:00||[[Media:time2845.png|2719:00]]||114/07:00||[[Media:time2923.png|2797:00]]||117/13:00||[[Media:time3001.png|2875:00]]||120/19:00||[[Media:time3079.png|2953:00]]||124/01:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2534.png|2408:00]]||101/08:00||[[Media:time2612.png|2486:00]]||104/14:00||[[Media:time2690.png|2564:00]]||107/20:00||[[Media:time2768.png|2642:00]]||111/02:00||[[Media:time2846.png|2720:00]]||114/08:00||[[Media:time2924.png|2798:00]]||117/14:00||[[Media:time3002.png|2876:00]]||120/20:00||[[Media:time3080.png|2954:00]]||124/02:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2535.png|2409:00]]||101/09:00||[[Media:time2613.png|2487:00]]||104/15:00||[[Media:time2691.png|2565:00]]||107/21:00||[[Media:time2769.png|2643:00]]||111/03:00||[[Media:time2847.png|2721:00]]||114/09:00||[[Media:time2925.png|2799:00]]||117/15:00||[[Media:time3003.png|2877:00]]||120/21:00||[[Media:time3081.png|2955:00]]||124/03:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2536.png|2410:00]]||101/10:00||[[Media:time2614.png|2488:00]]||104/16:00||[[Media:time2692.png|2566:00]]||107/22:00||[[Media:time2770.png|2644:00]]||111/04:00||[[Media:time2848.png|2722:00]]||114/10:00||[[Media:time2926.png|2800:00]]||117/16:00||[[Media:time3004.png|2878:00]]||120/22:00||[[Media:time3082.png|2956:00]]||124/04:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2537.png|2411:00]]||101/11:00||[[Media:time2615.png|2489:00]]||104/17:00||[[Media:time2693.png|2567:00]]||107/23:00||[[Media:time2771.png|2645:00]]||111/05:00||[[Media:time2849.png|2723:00]]||114/11:00||[[Media:time2927.png|2801:00]]||117/17:00||[[Media:time3005.png|2879:00]]||120/23:00||[[Media:time3083.png|2957:00]]||124/05:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2538.png|2412:00]]||101/12:00||[[Media:time2616.png|2490:00]]||104/18:00||[[Media:time2694.png|2568:00]]||108/00:00||[[Media:time2772.png|2646:00]]||111/06:00||[[Media:time2850.png|2724:00]]||114/12:00||[[Media:time2928.png|2802:00]]||117/18:00||[[Media:time3006.png|2880:00]]||121/00:00||[[Media:time3084.png|2958:00]]||124/06:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2539.png|2413:00]]||101/13:00||[[Media:time2617.png|2491:00]]||104/19:00||[[Media:time2695.png|2569:00]]||108/01:00||[[Media:time2773.png|2647:00]]||111/07:00||[[Media:time2851.png|2725:00]]||114/13:00||[[Media:time2929.png|2803:00]]||117/19:00||[[Media:time3007.png|2881:00]]||121/01:00||[[Media:time3085.png|2959:00]]||124/07:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2540.png|2414:00]]||101/14:00||[[Media:time2618.png|2492:00]]||104/20:00||[[Media:time2696.png|2570:00]]||108/02:00||[[Media:time2774.png|2648:00]]||111/08:00||[[Media:time2852.png|2726:00]]||114/14:00||[[Media:time2930.png|2804:00]]||117/20:00||[[Media:time3008.png|2882:00]]||121/02:00||[[Media:time3086.png|2960:00]]||124/08:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2541.png|2415:00]]||101/15:00||[[Media:time2619.png|2493:00]]||104/21:00||[[Media:time2697.png|2571:00]]||108/03:00||[[Media:time2775.png|2649:00]]||111/09:00||[[Media:time2853.png|2727:00]]||114/15:00||[[Media:time2931.png|2805:00]]||117/21:00||[[Media:time3009.png|2883:00]]||121/03:00||[[Media:time3087.png|2961:00]]||124/09:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2542.png|2416:00]]||101/16:00||[[Media:time2620.png|2494:00]]||104/22:00||[[Media:time2698.png|2572:00]]||108/04:00||[[Media:time2776.png|2650:00]]||111/10:00||[[Media:time2854.png|2728:00]]||114/16:00||[[Media:time2932.png|2806:00]]||117/22:00||[[Media:time3010.png|2884:00]]||121/04:00||[[Media:time3088.png|2962:00]]||124/10:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2543.png|2417:00]]||101/17:00||[[Media:time2621.png|2495:00]]||104/23:00||[[Media:time2699.png|2573:00]]||108/05:00||[[Media:time2777.png|2651:00]]||111/11:00||[[Media:time2855.png|2729:00]]||114/17:00||[[Media:time2933.png|2807:00]]||117/23:00||[[Media:time3011.png|2885:00]]||121/05:00||[[Media:time3089.png|2963:00]]||124/11:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2544.png|2418:00]]||101/18:00||[[Media:time2622.png|2496:00]]||105/00:00||[[Media:time2700.png|2574:00]]||108/06:00||[[Media:time2778.png|2652:00]]||111/12:00||[[Media:time2856.png|2730:00]]||114/18:00||[[Media:time2934.png|2808:00]]||118/00:00||[[Media:time3012.png|2886:00]]||121/06:00||[[Media:time3090.png|2964:00]]||124/12:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2545.png|2419:00]]||101/19:00||[[Media:time2623.png|2497:00]]||105/01:00||[[Media:time2701.png|2575:00]]||108/07:00||[[Media:time2779.png|2653:00]]||111/13:00||[[Media:time2857.png|2731:00]]||114/19:00||[[Media:time2935.png|2809:00]]||118/01:00||[[Media:time3013.png|2887:00]]||121/07:00||[[Media:time3091.png|2965:00]]||124/13:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2546.png|2420:00]]||101/20:00||[[Media:time2624.png|2498:00]]||105/02:00||[[Media:time2702.png|2576:00]]||108/08:00||[[Media:time2780.png|2654:00]]||111/14:00||[[Media:time2858.png|2732:00]]||114/20:00||[[Media:time2936.png|2810:00]]||118/02:00||[[Media:time3014.png|2888:00]]||121/08:00||[[Media:time3092.png|2966:00]]||124/14:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2547.png|2421:00]]||101/21:00||[[Media:time2625.png|2499:00]]||105/03:00||[[Media:time2703.png|2577:00]]||108/09:00||[[Media:time2781.png|2655:00]]||111/15:00||[[Media:time2859.png|2733:00]]||114/21:00||[[Media:time2937.png|2811:00]]||118/03:00||[[Media:time3015.png|2889:00]]||121/09:00||[[Media:time3093.png|2967:00]]||124/15:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2548.png|2422:00]]||101/22:00||[[Media:time2626.png|2500:00]]||105/04:00||[[Media:time2704.png|2578:00]]||108/10:00||[[Media:time2782.png|2656:00]]||111/16:00||[[Media:time2860.png|2734:00]]||114/22:00||[[Media:time2938.png|2812:00]]||118/04:00||[[Media:time3016.png|2890:00]]||121/10:00||[[Media:time3094.png|2968:00]]||124/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2549.png|2423:00]]||101/23:00||[[Media:time2627.png|2501:00]]||105/05:00||[[Media:time2705.png|2579:00]]||108/11:00||[[Media:time2783.png|2657:00]]||111/17:00||[[Media:time2861.png|2735:00]]||114/23:00||[[Media:time2939.png|2813:00]]||118/05:00||[[Media:time3017.png|2891:00]]||121/11:00||[[Media:time3095.png|2969:00]]||124/17:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2550.png|2424:00]]||102/00:00||[[Media:time2628.png|2502:00]]||105/06:00||[[Media:time2706.png|2580:00]]||108/12:00||[[Media:time2784.png|2658:00]]||111/18:00||[[Media:time2862.png|2736:00]]||115/00:00||[[Media:time2940.png|2814:00]]||118/06:00||[[Media:time3018.png|2892:00]]||121/12:00||[[Media:time3096.png|2970:00]]||124/18:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2551.png|2425:00]]||102/01:00||[[Media:time2629.png|2503:00]]||105/07:00||[[Media:time2707.png|2581:00]]||108/13:00||[[Media:time2785.png|2659:00]]||111/19:00||[[Media:time2863.png|2737:00]]||115/01:00||[[Media:time2941.png|2815:00]]||118/07:00||[[Media:time3019.png|2893:00]]||121/13:00||[[Media:time3097.png|2971:00]]||124/19:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2552.png|2426:00]]||102/02:00||[[Media:time2630.png|2504:00]]||105/08:00||[[Media:time2708.png|2582:00]]||108/14:00||[[Media:time2786.png|2660:00]]||111/20:00||[[Media:time2864.png|2738:00]]||115/02:00||[[Media:time2942.png|2816:00]]||118/08:00||[[Media:time3020.png|2894:00]]||121/14:00||[[Media:time3098.png|2972:00]]||124/20:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2553.png|2427:00]]||102/03:00||[[Media:time2631.png|2505:00]]||105/09:00||[[Media:time2709.png|2583:00]]||108/15:00||[[Media:time2787.png|2661:00]]||111/21:00||[[Media:time2865.png|2739:00]]||115/03:00||[[Media:time2943.png|2817:00]]||118/09:00||[[Media:time3021.png|2895:00]]||121/15:00||[[Media:time3099.png|2973:00]]||124/21:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2554.png|2428:00]]||102/04:00||[[Media:time2632.png|2506:00]]||105/10:00||[[Media:time2710.png|2584:00]]||108/16:00||[[Media:time2788.png|2662:00]]||111/22:00||[[Media:time2866.png|2740:00]]||115/04:00||[[Media:time2944.png|2818:00]]||118/10:00||[[Media:time3022.png|2896:00]]||121/16:00&lt;br /&gt;
|-&lt;br /&gt;
|[[Media:time2555.png|2429:00]]||102/05:00||[[Media:time2633.png|2507:00]]||105/11:00||[[Media:time2711.png|2585:00]]||108/17:00||[[Media:time2789.png|2663:00]]||111/23:00||[[Media:time2867.png|2741:00]]||115/05:00||[[Media:time2945.png|2819:00]]||118/11:00||[[Media:time3023.png|2897:00]]||121/17:00&lt;br /&gt;
|}&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
{{clear}}&lt;br /&gt;
&lt;br /&gt;
==Where's the discussion block?==&lt;br /&gt;
It was getting large, so the discussion block has been moved. You can still discuss this comic here: [[Talk:1190: Time]]&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Dynamic comics]]&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:204:_America&amp;diff=67860</id>
		<title>Talk:204: America</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:204:_America&amp;diff=67860"/>
				<updated>2014-05-22T18:33:04Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: Created page with &amp;quot;I must admit, as a &amp;quot;younger&amp;quot; reader I thought that this was a joke. ~~~~&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;I must admit, as a &amp;quot;younger&amp;quot; reader I thought that this was a joke. [[Special:Contributions/108.162.238.221|108.162.238.221]] 18:33, 22 May 2014 (UTC)&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1037:_Umwelt&amp;diff=67082</id>
		<title>1037: Umwelt</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1037:_Umwelt&amp;diff=67082"/>
				<updated>2014-05-10T17:31:43Z</updated>
		
		<summary type="html">&lt;p&gt;108.162.238.221: /* Tornado */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1037&lt;br /&gt;
| date      = April 1, 2012&lt;br /&gt;
| title     = Umwelt&lt;br /&gt;
| image     = umwelt_the_void.jpg&lt;br /&gt;
| titletext = Umwelt is the idea that because their senses pick up on different things, different animals in the same ecosystem actually live in very different worlds. Everything about you shapes the world you inhabit--from your ideology to your glasses prescription to your web browser.&lt;br /&gt;
}}&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{Incomplete|Many of the strips are not explained}}&lt;br /&gt;
An {{w|Umwelt}}, as the title text explains, is the idea that ones entire way of thinking is dependent on their surroundings. Thus, this {{w|April Fools}} comic changes based on the browser, location, or referrer. Thus, what the viewer is viewing the comic on, where they live, or where they came from determines which comic they actually see. As a result, there are actually multiple comics that went up on April Fools' Day, although only one is seen.&lt;br /&gt;
&lt;br /&gt;
Information about how the wide variety of data was collected and credit for the viewers who contributed can be found [http://www.reddit.com/r/xkcd/comments/rnst4/april_fools_xkcd_changing_comic/ here].&lt;br /&gt;
&lt;br /&gt;
===The Void===&lt;br /&gt;
[[File:umwelt_the_void.jpg]]&lt;br /&gt;
&lt;br /&gt;
If the device or browser you are using does not support Javascript, you will simply see a static image of a white swirl on a dark background.&lt;br /&gt;
&lt;br /&gt;
Possible reference to The Ring (http://imgur.com/wlGmm), as though to suggest that using an alternative browser is dismal and horrific.&lt;br /&gt;
&lt;br /&gt;
Davean (xkcd's sysadmin): &amp;quot;[This] comic isn't available everywhere and it can come up i[n] some situation[s] only for recognized browsers.&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Browser: Alternative Browser&lt;br /&gt;
&lt;br /&gt;
===Aurora===&lt;br /&gt;
[[File:umwelt_aurora.png]]&lt;br /&gt;
&lt;br /&gt;
The joke here is either that Canadians, where the comic was shown, would regard the {{w|Aurora (astronomy)|Aurora Borealis}} as normal and thus, would not've seen the sight as particularly amazing, or that XKCD characters see in black and white and would not notice the colors.&lt;br /&gt;
Alternately, one could interpret that since Megan didn't go out and therefore missed seeing the Aurora, the main character lied. That way, she wouldn't have felt sad that she missed out.&lt;br /&gt;
&lt;br /&gt;
This image changed based on the size of the browser window including different panels at different sizes.&lt;br /&gt;
&lt;br /&gt;
Locations: Canada, Boston, Maine, New York, Ohio, Oregon, Minnesota, Norway, Denmark&lt;br /&gt;
&lt;br /&gt;
===Snake===&lt;br /&gt;
[[File:umwelt_snake_composite_1024.png]]&lt;br /&gt;
[[:File:umwelt_snake_composite.png|Full size]]&lt;br /&gt;
&lt;br /&gt;
The joke here is the extreme length of snakes. The world's longest snake is the python, the longest ever being 33 feet or approx. 10 meters. The red and blue circles refer to the hit game {{w|Portal}}.&lt;br /&gt;
There is also a reference to the book &amp;quot;The Little Prince&amp;quot; in the second panel.&lt;br /&gt;
&lt;br /&gt;
Also, the number and content of the panels changes depending on the size of your browser window.&lt;br /&gt;
&lt;br /&gt;
This image changed based on the size of the browser window including different panels at different sizes.&lt;br /&gt;
&lt;br /&gt;
Specific AltText for this image: Umwelt is the idea that because their senses pick up on different things, different animals in the same ecosystem actually live in very different worlds. Everything about you shapes the world you inhabit -from your ideology to your glasses prescription to your browser window size.&lt;br /&gt;
&lt;br /&gt;
Location: Texas (on Chrome Version 33.0.1750.154 m),&lt;br /&gt;
&lt;br /&gt;
===Black Hat===&lt;br /&gt;
[[File:umwelt_tortoise_1024.png]]&lt;br /&gt;
[[:File:umwelt_tortoise.png|Full size]]&lt;br /&gt;
&lt;br /&gt;
An analyst attempts to psychoanalyze [[Black Hat|Black Hat's]] [[72: Classhole|classhole]] tendencies. The joke here is that the turtle has actually been turned over and neither sees helping it as a priority. It's a reference to the Voight-Kampff test used in the movie Blade Runner (1982) to identify replicants.&lt;br /&gt;
&lt;br /&gt;
Location: Seems to appear mostly in &amp;quot;other countries&amp;quot; - those without location-specific comics.&lt;br /&gt;
&lt;br /&gt;
===Too Quiet===&lt;br /&gt;
[[File:umwelt_too_quiet_1024.png]]&lt;br /&gt;
[[:File:umwelt_too_quiet.png|Full size]]&lt;br /&gt;
&lt;br /&gt;
A reference to {{w|Jurassic Park (film)|Jurassic Park}} which has been [[87: Velociraptors|constantly]] [[135: Substitute|referred]] [[1110: Click and Drag|to]] [[155: Search History|before]] [[758: Raptor Fences|in]] this comic.&lt;br /&gt;
&lt;br /&gt;
Also referencing the film {{w|2 Fast 2 Furious|2 Fast 2 Furious}}, an entertaining, yet intellectually unprovoking sequel in a popular film franchise, which is aimed at teenagers and young adults, prompting the blunt response from the stickman. The fact that Steve would use such a cliché {{w|2000s (decade)|noughties}} movie term in such an intense moment, and the subsequent curse, is the joke in this comic.&lt;br /&gt;
&lt;br /&gt;
Location: short version - iPhone 5c Safari browser in Texas,&lt;br /&gt;
&lt;br /&gt;
===Pond===&lt;br /&gt;
[[File:umwelt_pond_mobile.png]][[File:umwelt_pond_wide.png]]&lt;br /&gt;
&lt;br /&gt;
Two different versions showed, the narrower version for mobile devices.&lt;br /&gt;
&lt;br /&gt;
Location: unknown&lt;br /&gt;
&lt;br /&gt;
===Galaxies===&lt;br /&gt;
[[File:umwelt_galaxies_1024.jpg]]&lt;br /&gt;
[[:File:umwelt_galaxies.jpg|Full size]]&lt;br /&gt;
&lt;br /&gt;
Megan is distracted from her conversation with [[Cueball]] by realizing that the space behind his head, from her vantage point, contains millions of galaxies. This is similar to an [http://nssdc.gsfc.nasa.gov/image/astro/hst_deep_field.jpg incredible photograph] taken by the Hubble Telescope, in which a tiny dark area of space in fact contained numerous galaxies.&lt;br /&gt;
&lt;br /&gt;
The title text is a imaginative leap from this scenario: that the galaxies would be up to no good once Cueball is turned away from them.&lt;br /&gt;
&lt;br /&gt;
This comic was only reported once... the intended environmental context is a mystery.&lt;br /&gt;
&lt;br /&gt;
Location: unknown&lt;br /&gt;
&lt;br /&gt;
===xkcd Gold===&lt;br /&gt;
[[File:umwelt_xkcd_gold.png]]&lt;br /&gt;
&lt;br /&gt;
This is probably a reference to the 4chan Gold Account, an implementation on 4chan that does not actually exist, and is usually used to trick newcomers into revealing their credit card numbers. The joke is that &amp;quot;Gold Account&amp;quot; users can supposedly block other users from viewing images they have posted. The fifth panel is probably a reference to Beecock, a notorious set of shocker images. 4chan's moderators have been known to give out &amp;quot;beecock bans&amp;quot; to particularly annoying users, which redirect the user to a page containing beecock and the text &amp;quot;OH NO THE BOARD IS GONE&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
Referrer: 4chan&lt;br /&gt;
&lt;br /&gt;
===Yo Mama===&lt;br /&gt;
[[File:umwelt_dog_ballast.png]]&lt;br /&gt;
&lt;br /&gt;
Possible reference to Kurt Vonnegut Jr.'s &amp;quot;{{w|Harrison Bergeron}}.&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Possibly a veiled criticism of Facebook. This could be slightly rewritten as: &amp;quot;This comic takes place in a dystopian future where the government is afraid of dissent, so it tracks everyone at all times, and some people privately doubt the government, but not enough to stop submitting information to Facebook. But that dystopian future is now.&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Referrer: Facebook&lt;br /&gt;
&lt;br /&gt;
===Reddit===&lt;br /&gt;
[[File:umwelt_reddit.png]]&lt;br /&gt;
&lt;br /&gt;
Reference to referencing, because Reddit, as a referring site, likes references to its referencing in its references.&lt;br /&gt;
&lt;br /&gt;
This comic also features recursive imagery similar to [[688:_Self-Description|Self Description]] where the second panel embeds the entire comic within itself.&lt;br /&gt;
&lt;br /&gt;
Referrer: Reddit&lt;br /&gt;
&lt;br /&gt;
===Buns and Hot dogs===&lt;br /&gt;
[[File:umwelt_somethingawful.jpg]]&lt;br /&gt;
&lt;br /&gt;
This is a reference to the question &amp;quot;Why do hot dogs come in packages of 6 while buns come in packages of 8?&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Referrer: SomethingAwful, Questionable Content, &amp;amp; MetaFilter&lt;br /&gt;
&lt;br /&gt;
===Twitter===&lt;br /&gt;
[[File:umwelt_twitter.jpg]]&lt;br /&gt;
&lt;br /&gt;
Referrer: Twitter&lt;br /&gt;
&lt;br /&gt;
===Wikipedia===&lt;br /&gt;
[[File:umwelt_wikipedia_wide.jpg]]&lt;br /&gt;
[[File:umwelt_wikipedia_mobile.png]]&lt;br /&gt;
&lt;br /&gt;
The term {{w|Mile High Club}} (or MHC) is a slang term applied collectively to individuals who have sexual intercourse while on board an aircraft. Randall says that reading the news articles on it has distracted him from making that comic.&lt;br /&gt;
&lt;br /&gt;
Two different versions showed, the narrower version for mobile devices.&lt;br /&gt;
&lt;br /&gt;
Referrer: Wikipedia&lt;br /&gt;
&lt;br /&gt;
===Google Chrome===&lt;br /&gt;
[[File:umwelt_chrome1.jpg]]&lt;br /&gt;
&lt;br /&gt;
{{w|Sergey Brin}} (born August 21, 1973) is an American computer scientist and Internet entrepreneur who, with Larry Page, co-founded Google, one of the most profitable Internet companies. As of 2013, his personal wealth was estimated to be $24.4 billion. Randall makes the joke that as the founder of Google, Brin's permission would be needed to use Google Chrome. Because there are millions of people who use Google, it is likely that at least some of the time Brin would be asleep, thus he would need to be woken.&lt;br /&gt;
&lt;br /&gt;
Browser: Chrome&lt;br /&gt;
&lt;br /&gt;
===Chrome/Firefox===&lt;br /&gt;
[[File:umwelt_chrome2.png]]&lt;br /&gt;
&lt;br /&gt;
Mozilla {{w|Firefox}} is a free and open-source web browser developed for Windows, OS X, and Linux, with a mobile version for Android, by the Mozilla Foundation and its subsidiary, the Mozilla Corporation. Cueball is complaining about {{w|Google Chrome}}, to which [[Ponytail]] replies that there is an {{w|add-on}} that fixes what he is complaining about. When questioned, she replies that the add-on is Firefox, which isn't an add-on at all and is instead a different browser.&lt;br /&gt;
&lt;br /&gt;
Browser: Chrome&lt;br /&gt;
&lt;br /&gt;
===Google Chrome-2===&lt;br /&gt;
[[File:umwelt_chrome3.png]]&lt;br /&gt;
&lt;br /&gt;
This panel references Google Chrome's error screen, which shows a puzzle piece. The comic humorously implies that Chrome is looking for that piece. However, the piece in question cannot possibly line up with any corner.&lt;br /&gt;
&lt;br /&gt;
Browser: Chrome&lt;br /&gt;
&lt;br /&gt;
===Mozilla Firefox Private Browsing===&lt;br /&gt;
[[File:umwelt_firefox_incognito.png]]&lt;br /&gt;
&lt;br /&gt;
Another reference to crashing web browsers.&lt;br /&gt;
&lt;br /&gt;
Browser: Firefox (Incognito only?)&lt;br /&gt;
&lt;br /&gt;
===Internet Explorer===&lt;br /&gt;
[[File:umwelt_ie.png]]&lt;br /&gt;
&lt;br /&gt;
Yet another reference to crashing web browsers&lt;br /&gt;
&lt;br /&gt;
Browser: Internet Explorer&lt;br /&gt;
&lt;br /&gt;
===Maxthon===&lt;br /&gt;
[[File:umwelt_maxthon.png]]&lt;br /&gt;
&lt;br /&gt;
Browser: Maxthon&lt;br /&gt;
&lt;br /&gt;
===Netscape Navigator===&lt;br /&gt;
[[File:umwelt_netscape_womanoctopus.png]]&lt;br /&gt;
&lt;br /&gt;
[[File:umwelt_netscape_man.png]]&lt;br /&gt;
&lt;br /&gt;
Browser: Netscape&lt;br /&gt;
&lt;br /&gt;
===Rockmelt===&lt;br /&gt;
[[File:umwelt_rockmelt.png]]&lt;br /&gt;
&lt;br /&gt;
{{w|Rockmelt}} is a social-media-based browser.&lt;br /&gt;
&lt;br /&gt;
Reference to the gospel song {{w|Longing for Old Virginia: Their Complete Victor Recordings (1934)|&amp;quot;There's no hiding place down here&amp;quot; by The Carter Family}}, later covered by Stephen Stills.&lt;br /&gt;
&lt;br /&gt;
:I run to the rock just to hide my face&lt;br /&gt;
:And the rocks cried out, no hiding place&lt;br /&gt;
:There's no hiding place down here&lt;br /&gt;
&lt;br /&gt;
It may additionally be a reference to the ''Babylon 5'' episode &amp;quot;And the Rock Cried Out, No Hiding Place,&amp;quot; which featured the song.&lt;br /&gt;
&lt;br /&gt;
Browser: Rockmelt&lt;br /&gt;
&lt;br /&gt;
===Plugin Disabled===&lt;br /&gt;
[[File:umwelt_plugin_disabled.png]]&lt;br /&gt;
&lt;br /&gt;
Browser: Plugin (?) Disabled&lt;br /&gt;
&lt;br /&gt;
===Corporate Networks===&lt;br /&gt;
[[File:umwelt_corporate_general.png]]&lt;br /&gt;
[[File:umwelt_corporate_amazon_chrome.png]]&lt;br /&gt;
[[File:umwelt_corporate_amazon_firefox.png]]&lt;br /&gt;
[[File:umwelt_corporate_amazon_other.png]]&lt;br /&gt;
[[File:umwelt_corporate_google_chrome.png]]&lt;br /&gt;
[[File:umwelt_corporate_microsoft_chrome.png]]&lt;br /&gt;
[[File:umwelt_corporate_microsoft_firefox.png]]&lt;br /&gt;
[[File:umwelt_corporate_microsoft_other.png]]&lt;br /&gt;
[[File:umwelt_corporate_nytimes_chrome.png]]&lt;br /&gt;
[[File:umwelt_corporate_nytimes_other.png]]&lt;br /&gt;
&lt;br /&gt;
ISP: Corporate networks of Amazon, Google, Microsoft, NY Times&lt;br /&gt;
&lt;br /&gt;
===Military===&lt;br /&gt;
[[File:umwelt_military.png]]&lt;br /&gt;
&lt;br /&gt;
ISP: Military networks&lt;br /&gt;
&lt;br /&gt;
===T-Mobile===&lt;br /&gt;
[[File:umwelt_tmobile.png]]&lt;br /&gt;
&lt;br /&gt;
Reference to T-Mobile's distinguishing feature of weaker coverage, in relation to other major providers.&lt;br /&gt;
&lt;br /&gt;
ISP: T-Mobile&lt;br /&gt;
&lt;br /&gt;
===Verizon and AT&amp;amp;T===&lt;br /&gt;
[[File:umwelt_verizon.png]]&lt;br /&gt;
&lt;br /&gt;
[[File:umwelt_att.png]]&lt;br /&gt;
&lt;br /&gt;
Reference to Verizon and AT&amp;amp;T's scandals/controversy regarding implementation of bandwidth caps.&lt;br /&gt;
&lt;br /&gt;
ISP: Verizon and AT&amp;amp;T&lt;br /&gt;
&lt;br /&gt;
===France===&lt;br /&gt;
[[File:umwelt_france.jpg]]&lt;br /&gt;
&lt;br /&gt;
A Google search of &amp;quot;French Military Victories&amp;quot; + 'I'm feeling lucky' used to direct to &amp;quot;did you mean: french military defeats&amp;quot; (due to a {{w|Google bomb}}), referencing a stereotype of the French:[http://www.albinoblacksheep.com/text/victories.html][http://politicalhumor.about.com/library/images/blpic-frenchmilitaryvictories.htm][http://politicalhumor.about.com/library/jokes/bljokefrenchmilitaryhistory.htm]&lt;br /&gt;
&lt;br /&gt;
Locations: France &amp;amp; Quebec&lt;br /&gt;
&lt;br /&gt;
===Germany===&lt;br /&gt;
[[File:umwelt_germany.png]]&lt;br /&gt;
&lt;br /&gt;
This comic references the {{w|Berlin airlift#The start of the Berlin Airlift|Berlin Airlift}}, a relief measure for citizens in West Berlin (surrounded by East Germany) instituted by the Western Allies after World War II. In reality, the Western Allies flew a grand total of 500,000 tons of food over the Soviet blockade in planes. Randall puts a twist on this event by making it more fun: dropping supplies from a grand chairlift. The play on words is that &amp;quot;chairlift&amp;quot; rhymes with &amp;quot;airlift&amp;quot; and thus makes an easy substitution. The chair force is also a name that other service branches use to make fun of the air force.&lt;br /&gt;
&lt;br /&gt;
Location: Germany&lt;br /&gt;
&lt;br /&gt;
===Israel===&lt;br /&gt;
[[File:umwelt_israel.png]]&lt;br /&gt;
&lt;br /&gt;
(Translation from Hebrew)&lt;br /&gt;
&lt;br /&gt;
Person: Mom, I met a great guy! But he's not Jewish. ...Wait, what do you mean &amp;quot;neither are we&amp;quot;? I'm completely confused.&lt;br /&gt;
&lt;br /&gt;
A reference to the multiple use of the word Jewish to denote both a religious group and a nationality.&lt;br /&gt;
&lt;br /&gt;
Location: Israel&lt;br /&gt;
&lt;br /&gt;
===Carnot Cycle===&lt;br /&gt;
[[File:umwelt_japan.png]]&lt;br /&gt;
&lt;br /&gt;
A pun on &amp;quot;cycle&amp;quot;; a [http://en.wikipedia.org/wiki/Carnot_cycle &amp;quot;Carnot Cycle&amp;quot;] is a thermodynamic cycle (e.g. refrigeration). Its efficiency depends on the temperature of the hot and cold 'reservoirs' in which it is operating.&lt;br /&gt;
&lt;br /&gt;
Location: Japan&lt;br /&gt;
&lt;br /&gt;
===UK===&lt;br /&gt;
[[File:umwelt_uk.jpg]]&lt;br /&gt;
&lt;br /&gt;
He worded this as though to imply that the UK is a state of the U.S., and an unimportant one at that, which pokes fun at the UK, creating a paradox (sort of).&lt;br /&gt;
&lt;br /&gt;
Location: UK&lt;br /&gt;
&lt;br /&gt;
===Blizzard===&lt;br /&gt;
[[File:umwelt_disasters_blizzard.png]]&lt;br /&gt;
&lt;br /&gt;
For each location this displayed in, the state name was substituted in the third panel.&lt;br /&gt;
&lt;br /&gt;
Locations: Alabama, Boston, Chicago, Dallas, Georgia, Halifax, Illinois, Michigan, Minnesota, Missouri, the Northeast, Ohio, Oklahoma, Ottawa, Pennsylvania, Philadelphia, Texas, Toronto, Tennessee, New York, Wisconsin&lt;br /&gt;
&lt;br /&gt;
===Tornado===&lt;br /&gt;
[[File:umwelt_disasters_tornado.png]]&lt;br /&gt;
&lt;br /&gt;
For each location this displayed in the state name was substituted in the third panel.&lt;br /&gt;
&lt;br /&gt;
Locations: Alabama, Dallas, Illinois, Georgia, The Midwest, Missouri, Ohio, Oklahoma, Ottawa, Tennessee, Texas&lt;br /&gt;
&lt;br /&gt;
===Hurricane===&lt;br /&gt;
[[File:umwelt_disasters_hurricane.png]]&lt;br /&gt;
&lt;br /&gt;
For each location this displayed in the state name was substituted in the third panel.&lt;br /&gt;
&lt;br /&gt;
Locations: D.C, Florida, Houston, Miami, New Jersey, North Carolina, South Carolina, Virgina&lt;br /&gt;
&lt;br /&gt;
===Lake Diver Killer===&lt;br /&gt;
[[File:umwelt_lake_diver.png]]&lt;br /&gt;
&lt;br /&gt;
Locations: Bay Areas&lt;br /&gt;
&lt;br /&gt;
Location: Vermont showed an image specifically referencing Lake Champlain&lt;br /&gt;
&lt;br /&gt;
===Lincoln Memorial===&lt;br /&gt;
[[File:umwelt_lincoln_memorial.png]]&lt;br /&gt;
&lt;br /&gt;
Locations: Illinois &amp;amp; Washington D.C.&lt;br /&gt;
&lt;br /&gt;
===Helicopter Hunting===&lt;br /&gt;
[[File:umwelt_helicoptor.png]]&lt;br /&gt;
&lt;br /&gt;
In Alaska, governments and individuals have {{w|Wolf hunting#North America 2|shot wolves en masse from helicopters}} in an attempt to artificially inflate populations of game, such as moose and caribou, to make hunting them easier. This is opposed by many, as the game populations are not endangered (thus, this threatens ecological balance); wolves are a small threat to livestock in North America; most of the wolf body - including meat and bones - goes wasted as they are sought mainly for their pelts.&lt;br /&gt;
&lt;br /&gt;
Location: Alaska&lt;br /&gt;
&lt;br /&gt;
===Newspaper===&lt;br /&gt;
[[File:umwelt_life_scientists.png]][[File:umwelt_life_rit.png]][[File:umwelt_life_umass.png]]&lt;br /&gt;
&lt;br /&gt;
Creating new life has long been a well understood process, in a lab or otherwise.&lt;br /&gt;
&lt;br /&gt;
Location: Various&lt;br /&gt;
&lt;br /&gt;
Specific versions appeared for RIT and UMass Amherst&lt;br /&gt;
&lt;br /&gt;
===Robot Paul Revere===&lt;br /&gt;
[[File:umwelt_paul_revere.png]]&lt;br /&gt;
&lt;br /&gt;
Combination of the legend of [http://en.wikipedia.org/wiki/Paul_Revere#.22Midnight_Ride.22 Paul Revere] and computer binary.&lt;br /&gt;
&lt;br /&gt;
Location: Boston&lt;br /&gt;
&lt;br /&gt;
===Counting Cards===&lt;br /&gt;
&amp;lt;!-- card counting explanation needed. --&amp;gt;&lt;br /&gt;
All four colleges in this series are in Massachusetts and, being similar, in pairs, rival each other to some extent (Harvard-MIT, and Smith-Wellesley). The comic contains a reference to the {{w|MIT Blackjack Team}}, which entered popular culture via the {{w|21 (2008 film)|film 21}}, and a possible reference to Orwell's book '1984' and/or {{w|Chain of Command (Star Trek: The Next Generation)|popular homage to it via Star Trek}}: &amp;quot;There are four lights.&amp;quot;[http://www.youtube.com/watch?v=ChYIm6MW39k]&lt;br /&gt;
&lt;br /&gt;
Bonus: The thought-gears in panel 3 are spinning against each other.&lt;br /&gt;
&lt;br /&gt;
Location: Harvard&lt;br /&gt;
&lt;br /&gt;
[[File:umwelt_counting_cards_harvard.png]]&lt;br /&gt;
&lt;br /&gt;
Location: MIT&lt;br /&gt;
&lt;br /&gt;
[[File:umwelt_counting_cards_mit.png]]&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Course 15s&amp;quot; at MIT are the business major students, often mocked for taking a less-rigorous program.&lt;br /&gt;
&lt;br /&gt;
Location: Smith&lt;br /&gt;
&lt;br /&gt;
[[File:umwelt_counting_cards_smith.png]]&lt;br /&gt;
&lt;br /&gt;
It looks like he forgot to draw the hair in the last three panels. Smith is an all-girls college.&lt;br /&gt;
&lt;br /&gt;
Location: Wellesley&lt;br /&gt;
&lt;br /&gt;
[[File:umwelt_counting_cards_wellesley.png]]&lt;br /&gt;
&lt;br /&gt;
Wellesley is an all-girls college.&lt;br /&gt;
&lt;br /&gt;
===Giant Box Trap===&lt;br /&gt;
[[File:umwelt_box_trap.png]]&lt;br /&gt;
&lt;br /&gt;
Randall got his undergrad in Physics at the {{w|Christopher Newport University}}, and was scheduled to return shortly to give a talk.&lt;br /&gt;
&lt;br /&gt;
Location: Christopher Newport University&lt;br /&gt;
&lt;br /&gt;
===Chemo Support===&lt;br /&gt;
[[File:umwelt_chemo.jpg]]&lt;br /&gt;
&lt;br /&gt;
Randall's now-wife was diagnosed with breast cancer, and apparently DFCI is where they've been spending much of their time.&lt;br /&gt;
&lt;br /&gt;
Location: Dana-Farber Cancer Institute&lt;br /&gt;
&lt;br /&gt;
===Reviews===&lt;br /&gt;
[[File:reviews.png]]&lt;br /&gt;
&lt;br /&gt;
The previous strip appears twice when using [[wikipedia:Tor_(anonymity_network)|TOR]].&lt;br /&gt;
&lt;br /&gt;
Browser: Any using TOR (?)&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Note to courageous readers- The transcript has been reordered in the order in which the comics appear in the picture and appropriate names have been given.]&lt;br /&gt;
&lt;br /&gt;
:'''The Void'''&lt;br /&gt;
:[An epic void with a bright light shining right on you.]&lt;br /&gt;
&lt;br /&gt;
:'''Aurora'''&lt;br /&gt;
:[Cueball heading out past Megan comfortably sitting in front of a desk.]&lt;br /&gt;
:Cueball: Apparently there's a solar flare that's causing some Great Aurorae. CBC says they may even be visible here! Wanna drive out to see?&lt;br /&gt;
:Megan: Hockey's on.&lt;br /&gt;
:Cueball: Ok. Later.&lt;br /&gt;
&lt;br /&gt;
:[An expansive, marvelous image of emerald green northern lights, floating down through the sky.]&lt;br /&gt;
&lt;br /&gt;
:Megan: See anything?&lt;br /&gt;
:Cueball: No, just clouds.&lt;br /&gt;
:Megan: Not surprised.&lt;br /&gt;
&lt;br /&gt;
:'''Aurora-US'''&lt;br /&gt;
:[Cueball heading out past Megan comfortably sitting in front of a desk.]&lt;br /&gt;
:Cueball: Apparently there's a solar storm causing northern lights over Canada. CNN say they might even be visible {Options: &amp;quot;As Far South As Us&amp;quot;, &amp;quot;Here in Boston&amp;quot;, &amp;quot;Maine&amp;quot;, &amp;quot;Ohio&amp;quot;, &amp;quot;Oregon&amp;quot;, &amp;quot;New York&amp;quot;}! Wanna drive out to see?&lt;br /&gt;
:Megan: It's cold out.&lt;br /&gt;
:Cueball: Ok. Later.&lt;br /&gt;
&lt;br /&gt;
:[An expansive, marvelous image of emerald green northern lights, floating down through the sky.]&lt;br /&gt;
&lt;br /&gt;
:Megan: See anything?&lt;br /&gt;
:Cueball: No, just clouds.&lt;br /&gt;
:Megan: Not surprised.&lt;br /&gt;
&lt;br /&gt;
:'''Snake'''&lt;br /&gt;
:[Two people standing next to each other. Megan is holding the head end of a snake. Depending on the width of your browser, the snake is: three frames, the third of which  has a little bit of a bump; the first frame has a human-size bump, the second has a third person looking at the snake, and the third has the snake going though two Portals; a squirrel and the human-size bump in the first frame, a ring next to the third person in the second frame, and Beret Guy riding the snake in front of the portal; or The squirrel, a fourth person within the snake being coiled, and the human bump in the first frame, the ring, a fifth person in love, and the third person in the second frame, Beret Guy and the portal in the third frame, and the same two people in the fourth frame.]&lt;br /&gt;
&lt;br /&gt;
:Megan: I found a snake, but then I forgot to stop.&lt;br /&gt;
&lt;br /&gt;
:'''Black hat'''&lt;br /&gt;
:[Two people sitting at a desk. One is Black Hat. The other is an analyst. Black Hat has a number of terminals attached to his head.]&lt;br /&gt;
:Analyst: You come across a tortoise in the desert. You flip it over. It struggles to right itself. You watch. You're not helping. Why is that?&lt;br /&gt;
&lt;br /&gt;
:Black Hat: It '''knows''' what it did.&lt;br /&gt;
&lt;br /&gt;
:[View of the entire scene, with said turtle off in the distance on its back and trying to right itself.]&lt;br /&gt;
&lt;br /&gt;
:'''Too quiet'''&lt;br /&gt;
:[A group of four scale down a wall into a field in the middle of the night. They walk off single-file.]&lt;br /&gt;
:Person 1: It's quiet.&lt;br /&gt;
&lt;br /&gt;
:Person 3: Yeah - *Too* quiet.&lt;br /&gt;
&lt;br /&gt;
:[A Velociraptor is off in the distance, following the group.]&lt;br /&gt;
:Person 4: Yeah - too *too* quiet.&lt;br /&gt;
&lt;br /&gt;
:Person 2: Yeah - 2quiet2furious.&lt;br /&gt;
:Person 1: Fuck off, Steve.&lt;br /&gt;
&lt;br /&gt;
:'''Pond'''&lt;br /&gt;
:[A landscape showing a pond, some reeds, and a set of mountains off in the distance.]&lt;br /&gt;
&lt;br /&gt;
:'''Galaxies'''&lt;br /&gt;
:[A trio of galaxies.]&lt;br /&gt;
:Galaxy 1: He's not looking!&lt;br /&gt;
:Galaxy 3: Let's get him!&lt;br /&gt;
:[Lines draw in illustrating the eye-line of one of a pair of people.]&lt;br /&gt;
:Cueball: So he said he didn't get the text, but c'mon, he *never* misses texts. Right? ..hello?&lt;br /&gt;
:Megan: I'm just staring at your head freaked out by the fact that there are millions of galaxies *directly behind it*.&lt;br /&gt;
&lt;br /&gt;
:'''xkcd Gold'''&lt;br /&gt;
:[Cueball holding bat.]&lt;br /&gt;
&lt;br /&gt;
:Cueball: Sorry, but this comic&lt;br /&gt;
&lt;br /&gt;
:[Cueball starts to wind up.]&lt;br /&gt;
&lt;br /&gt;
:Cueball: requires&lt;br /&gt;
&lt;br /&gt;
:[Cueball prepares to strike with bat.]&lt;br /&gt;
&lt;br /&gt;
:Cueball: XKCD&lt;br /&gt;
&lt;br /&gt;
:[Cueball swings at a beehive.]&lt;br /&gt;
:GOLD&lt;br /&gt;
&lt;br /&gt;
:[Penis Bees fly out of the beehive.]&lt;br /&gt;
&lt;br /&gt;
:'''Yo mamma'''&lt;br /&gt;
:[Cueball yells at a friend.]&lt;br /&gt;
:Cueball: Oh yeah? Well you mama's so ''cynical'', her only dog ballast is a ''leash''!&lt;br /&gt;
:(This comic takes place in a dystopian future where the government is afraid dogs can hover, so it requires them to wear weights at all times, and some people privately doubt the government, but not enough to stop buying dog weights.)&lt;br /&gt;
&lt;br /&gt;
:'''Reddit'''&lt;br /&gt;
:Five seconds ago:&lt;br /&gt;
:[You sitting in front of a desk, reading a reddit thread.]&lt;br /&gt;
:You: Oh, hey, reddit has a link to some XKCD april fools comic.&lt;br /&gt;
&lt;br /&gt;
:Now: [An image of the xkcd comic page.]&lt;br /&gt;
:Five seconds from now:&lt;br /&gt;
&lt;br /&gt;
:You: ..hey&lt;br /&gt;
&lt;br /&gt;
:30 seconds from now:&lt;br /&gt;
:[DANCE PARTY!]&lt;br /&gt;
&lt;br /&gt;
:'''Buns and Hot dogs'''&lt;br /&gt;
:Cueball: What I wanna know is why do hot dogs come in packages of six while buns come in these huge sacks of ash and blood from which &amp;quot;Ave Maria&amp;quot; is faintly audible?&lt;br /&gt;
:[Chanting sacks of gore in the background.]&lt;br /&gt;
&lt;br /&gt;
:'''Twitter'''&lt;br /&gt;
:[A Twitter account page with the following: Many tweets, fewer following, even fewer followers, A bunch of assholes in the suggested follow box, trending topics partitioned into: Word Games, Misogyny, and Bieber, stuff your eyes automatically ignore, A really pleasant blue. and the timeline: Something about a podcast, Someone confused because the description doesn't match the link, The link you clicked on to get to this comic, Rob Delaney, Passive Aggression, and horse ebooks.]&lt;br /&gt;
&lt;br /&gt;
:'''Wikipedia'''&lt;br /&gt;
:[There's no comic here because instead of drawing one, I spent the last hour reading every news story cited in the Wikipedia article on The Mile High Club.]&lt;br /&gt;
&lt;br /&gt;
:'''Google Chrome'''&lt;br /&gt;
:[A Chrome plugin error page.]&lt;br /&gt;
:Chrome: This plugin requires Sergey Brin's permission to run. Please wait while he is woken.&lt;br /&gt;
&lt;br /&gt;
:'''Chrome/Firefox'''&lt;br /&gt;
:[Two people; Cueball is sitting at a desk in front of a laptop.]&lt;br /&gt;
:Cueball: Man, chrome's hardware acceleration really sucks.&lt;br /&gt;
:Ponytail: Oh - Theres' a great add-on that fixes it.&lt;br /&gt;
:Cueball: Oh? What's it called?&lt;br /&gt;
:Ponytail: &amp;quot;Firefox&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
:'''Google Chrome-2'''&lt;br /&gt;
:[A Chrome plugin error page with the characteristic jigsaw piece.]&lt;br /&gt;
:Chrome: Chrome is looking for this piece. Have you seen it? Chrome thinks it links up with a corner.&lt;br /&gt;
&lt;br /&gt;
:'''Mozilla Firefox Private Browsing'''&lt;br /&gt;
:[Firefox error page.]&lt;br /&gt;
:Firefox: Well, this is embarrassing. You know how I'm not supposed to peek at your browsing in private mode? Firefox.. is sorry. Firefox will not blame you if you&lt;br /&gt;
:[Button with text.]&lt;br /&gt;
:Click here to report this incident.&lt;br /&gt;
&lt;br /&gt;
:'''Internet Explorer'''&lt;br /&gt;
:[IE error page.]&lt;br /&gt;
:IE: Error: Internet Explorer has given up.&lt;br /&gt;
&lt;br /&gt;
:'''Maxthon'''&lt;br /&gt;
:Cueball: Maxthon? Hey, 2005 called. Didn't say anything. All I could hear was sobbing. This is getting harder. Anyway, yeah, Maxthon's still cool! Didn't know it was still around!&lt;br /&gt;
&lt;br /&gt;
:'''Netscape Navigator'''&lt;br /&gt;
:[Two different versions exist: one with Cueball talking and one with Megan with tentacle arms talking.]&lt;br /&gt;
:Person: Netscape Navigator? Hey, the nineties called - drunk as usual. I hung up without saying anything. This is getting harder. Anyway - it's cool that you'e got netscape running.&lt;br /&gt;
&lt;br /&gt;
:'''Rockmelt'''&lt;br /&gt;
:[Cueball running to laptop.]&lt;br /&gt;
:I ran to Rockmelt to hide my face&lt;br /&gt;
&lt;br /&gt;
:[Cueball sitting at laptop.]&lt;br /&gt;
:But Rockmelt cried out -&lt;br /&gt;
&lt;br /&gt;
:[Laptop shouting.]&lt;br /&gt;
:NO HIDING PLACE&lt;br /&gt;
&lt;br /&gt;
:[zoom out.]&lt;br /&gt;
:NO HIDING PLACE DOWN HERE&lt;br /&gt;
&lt;br /&gt;
:'''Google Chrome-3'''&lt;br /&gt;
:[A chrome plugin error page.]&lt;br /&gt;
:Chrome: There does not exist --nor could there '''ever''' exist-- a plugin capable of displaying this content.&lt;br /&gt;
&lt;br /&gt;
:'''Microsoft/Amazon/The Times/Google - Chrome'''&lt;br /&gt;
:[Chrome error page.]&lt;br /&gt;
:Chrome: This plugin requires clearance from the corporate press office in order to run. Remember, Microsoft/Amazon/The Times/Google is a team; individual employees should ''never'' speak for the company without authorization.&lt;br /&gt;
&lt;br /&gt;
:'''Microsoft/Amazon - Firefox'''&lt;br /&gt;
:[Firefox error page.]&lt;br /&gt;
:Error: This plugin requires clearance from the corporate press office in order to run. Remember, Microsoft/Amazon is a team; individual employees should ''never'' speak for the company without authorization.&lt;br /&gt;
&lt;br /&gt;
:'''Microsoft/The Times'''&lt;br /&gt;
:[Error page.]&lt;br /&gt;
:Error: This plugin requires clearance from the corporate press office in order to run. Remember, Microsoft/The Times is a team; individual employees should ''never'' speak for the company without authorization.&lt;br /&gt;
&lt;br /&gt;
:'''Corporate - Generic '''&lt;br /&gt;
:[Error page.]&lt;br /&gt;
:Error: This plugin requires clearance from the corporate press office in order to run. Remember, we work as a team; individual employees should ''never'' speak for the company without authorization.&lt;br /&gt;
&lt;br /&gt;
:'''Military'''&lt;br /&gt;
:[Person looking at two browser windows.]&lt;br /&gt;
:Cueball: I know y'all know what you're doing. But if you're on a military machine and you're supposed to be watching for missiles or something, I hope you're keeping an eye on that in the background while you're reading comics. Also: Thanks.&lt;br /&gt;
&lt;br /&gt;
:'''T-Mobile'''&lt;br /&gt;
:[Error page.]&lt;br /&gt;
:Data Error: T-Mobile was unable to establish a connection&lt;br /&gt;
&lt;br /&gt;
:'''Verizon'''&lt;br /&gt;
:[Error page]&lt;br /&gt;
:Error: You have exceeded your Verizon monthly bandwidth cap. Mobile web browsing has been disabled.&lt;br /&gt;
&lt;br /&gt;
:'''France'''&lt;br /&gt;
:[Two people; one of which is browsing using a laptop.]&lt;br /&gt;
:Cueball: Hey, you're French, right? Ever see what happens when you type &amp;quot;French Military Victories&amp;quot; into Google?&lt;br /&gt;
:French person: Does it take you to an article on Napoleon?&lt;br /&gt;
&lt;br /&gt;
:French person: ..no? Strange, given how he kicked everyone's asses up and down Europe for over a decade.&lt;br /&gt;
&lt;br /&gt;
:[Beat frame.]&lt;br /&gt;
&lt;br /&gt;
:Cueball: Touche.&lt;br /&gt;
:French person: You know, that'd sound smarter if you didn't pronounce it like it rhymes with &amp;quot;douche&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
:'''Germany'''&lt;br /&gt;
:[Cueball dropping food from an unorthodox high perch.]&lt;br /&gt;
:June 1948: In response to the Soviet blockade of East Germany, the western allies construct the Berlin Chairlift.&lt;br /&gt;
:Cueball on chairlift: Food!&lt;br /&gt;
&lt;br /&gt;
:'''Israel'''&lt;br /&gt;
:[Person on phone.]&lt;br /&gt;
:Person (Translation from Hebrew): Mom, I met a great guy! But he's not Jewish. ...Wait, what do you mean &amp;quot;neither are we&amp;quot;? I'm completely confused.&lt;br /&gt;
&lt;br /&gt;
:'''Carnot Cycle'''&lt;br /&gt;
:[Ponytail on a motorcycle with a heat-entropy graph on the side.]&lt;br /&gt;
:Ponytail: Check out my new Carnot Cycle!&lt;br /&gt;
:Cueball: Neat - how fast does it go?&lt;br /&gt;
:Ponytail: Depends how cold it is outside.&lt;br /&gt;
&lt;br /&gt;
:'''Great Britain'''&lt;br /&gt;
:[Illustration of the Atlantic ocean.]&lt;br /&gt;
:American person: Sorry I don't have a comic poking fun at the UK here. I only had time to get to the most ''important'' US states.&lt;br /&gt;
:British person: Hey - At least we have free health care and real ale.&lt;br /&gt;
&lt;br /&gt;
:'''Earthquake-Blizzard'''&lt;br /&gt;
:[Two people sitting at a desk, facing each other. The desk rattles.]&lt;br /&gt;
:Cueball: Stop jiggling your leg.&lt;br /&gt;
:Danish: I'm not ji-.. oh!&lt;br /&gt;
:Cueball: What!&lt;br /&gt;
:Danish: You'll get it..&lt;br /&gt;
&lt;br /&gt;
:[EVERYTHING RUMBLES.]&lt;br /&gt;
:Cueball: ..HOLY CRAP IT'S AN EARTHQUAKE!&lt;br /&gt;
:Danish: Just a little one. Happens all the time back in San Francisco.&lt;br /&gt;
&lt;br /&gt;
:Cueball: But this is {Options: &amp;quot;Alabama&amp;quot;, &amp;quot;Boston&amp;quot;, &amp;quot;Chicago&amp;quot;, &amp;quot;Dallas&amp;quot;, &amp;quot;Georgia&amp;quot;, &amp;quot;Halifax&amp;quot;, &amp;quot;Illinois&amp;quot;, &amp;quot;Michigan&amp;quot;, &amp;quot;Minnesota&amp;quot;, &amp;quot;Missouri&amp;quot;, &amp;quot;the Northeast&amp;quot;, &amp;quot;Ohio&amp;quot;, &amp;quot;Oklahoma&amp;quot;, &amp;quot;Ottawa&amp;quot;, 'Pennsylvania&amp;quot;, &amp;quot;Philadelphia&amp;quot;, &amp;quot;Texas&amp;quot;, &amp;quot;Toronto&amp;quot;, &amp;quot;Tennessee&amp;quot;, &amp;quot;New York&amp;quot;, &amp;quot;Wisconsin&amp;quot;}! That was huge!&lt;br /&gt;
:Danish: Seriously? That's the worst this place can do? Wow. I guess we grow up tougher in California.&lt;br /&gt;
:Cueball: Oh ''really''...&lt;br /&gt;
&lt;br /&gt;
:Six Months Later..&lt;br /&gt;
:[Both people are trudging through a massive blizzard.]&lt;br /&gt;
:Danish: In pictures, snow always looked so nice and sof - ''AAAA! MY NECK! How do people live here?!''&lt;br /&gt;
:Cueball: Come on - it's only three more miles.&lt;br /&gt;
&lt;br /&gt;
:'''Earthquake-Tornado'''&lt;br /&gt;
:[Two people sitting at a desk, facing each other. The desk rattles.]&lt;br /&gt;
:Cueball: Stop jiggling your leg.&lt;br /&gt;
:Danish: I'm not ji-.. oh!&lt;br /&gt;
:Cueball: What!&lt;br /&gt;
:Danish: You'll get it..&lt;br /&gt;
&lt;br /&gt;
:[EVERYTHING RUMBLES.]&lt;br /&gt;
:Cueball: ..HOLY CRAP IT'S AN EARTHQUAKE!&lt;br /&gt;
:Danish: Just a little one. Happens all the time back in San Francisco.&lt;br /&gt;
&lt;br /&gt;
:Cueball: But this is {Options: &amp;quot;Alabama&amp;quot;, &amp;quot;Dallas&amp;quot;, &amp;quot;Illinois&amp;quot;, &amp;quot;The Midwest&amp;quot;, &amp;quot;Missouri&amp;quot;, &amp;quot;Ohio&amp;quot;, &amp;quot;Oklahoma&amp;quot;, &amp;quot;Ottawa&amp;quot;, &amp;quot;Tennessee&amp;quot;, &amp;quot;Texas&amp;quot;}!&lt;br /&gt;
:Cueball: That was huge!&lt;br /&gt;
:Danish: Seriously? That's the worst this place can do? Wow. I guess we grow up tougher in California.&lt;br /&gt;
:Cueball: Oh ''really''...&lt;br /&gt;
&lt;br /&gt;
:Six Months Later..&lt;br /&gt;
:[Both people are in a shelter in a prairie with a rapidly-approaching tornado.]&lt;br /&gt;
:Danish: AAAA CLOSE THE SHELTER DOOR!&lt;br /&gt;
:Cueball: Say the magic words...&lt;br /&gt;
:Danish: THIS PLACE IS THE WORST!&lt;br /&gt;
:Cueball: Thank you.&lt;br /&gt;
&lt;br /&gt;
:'''Earthquake-Hurricane'''&lt;br /&gt;
:[Two people sitting at a desk, facing each other. The desk rattles.]&lt;br /&gt;
:Cueball: Stop jiggling your leg.&lt;br /&gt;
:Danish: I'm not ji-.. oh!&lt;br /&gt;
:Cueball: What!&lt;br /&gt;
:Danish: You'll get it..&lt;br /&gt;
&lt;br /&gt;
:[EVERYTHING RUMBLES.]&lt;br /&gt;
:Cueball: ..HOLY CRAP IT'S AN EARTHQUAKE!&lt;br /&gt;
:Danish: Just a little one. Happens all the time back in San Francisco.&lt;br /&gt;
&lt;br /&gt;
:Cueball: But this is {Options: &amp;quot;D.C&amp;quot;, &amp;quot;Florida&amp;quot;, &amp;quot;Houston&amp;quot;, &amp;quot;Miami&amp;quot;, &amp;quot;New Jersey&amp;quot;, &amp;quot;North Carolina&amp;quot;, &amp;quot;South Carolina&amp;quot;, &amp;quot;Virgina&amp;quot;}! That was huge!&lt;br /&gt;
:Cueball: That was huge!&lt;br /&gt;
:Danish: Seriously? That's the worst this place can do? Wow. I guess we grow up tougher in California.&lt;br /&gt;
:Cueball: Oh ''really''...&lt;br /&gt;
&lt;br /&gt;
:Six Months Later..&lt;br /&gt;
&lt;br /&gt;
:[Both are in the middle of a hurricane. Danish is grabbing onto a signpost to avoid being swept away.]&lt;br /&gt;
:Danish: AAAAA WHAT THE SHIIIIT!&lt;br /&gt;
:Cueball: Calm down - this is barely a category 2.&lt;br /&gt;
&lt;br /&gt;
:'''Lake Diver Killer'''&lt;br /&gt;
:[TV Field Reporter in front of a cordoned-off lake.]&lt;br /&gt;
:Reporter: Police divers searching the bay say they have recovered the body of another victim of the &amp;quot;Lake Diver Killer.&amp;quot;&lt;br /&gt;
:Reporter: During the search, three more divers were reported missing.&lt;br /&gt;
&lt;br /&gt;
:'''Washington'''&lt;br /&gt;
:[The statue of Abraham Lincoln in the Lincoln Memorial.]&lt;br /&gt;
:In this Marble Prison As in the nightmares of the nation they tried to devour&lt;br /&gt;
:The nanobots that constituted Abraham Lincoln&lt;br /&gt;
:Are entombed forever.&lt;br /&gt;
&lt;br /&gt;
:'''Alaska'''&lt;br /&gt;
:[A person with a gun chasing a helicopter on the back of a wolf in a snowy Alaskan field.]&lt;br /&gt;
:Some people hunt wolves from helicopters. I hunt helicopters from a wolf.&lt;br /&gt;
&lt;br /&gt;
:'''Life in lab'''&lt;br /&gt;
:[Newspaper headline.]&lt;br /&gt;
:Scientists/UMass Amherst students/RIT students create life in lab&lt;br /&gt;
:[Caption under picture of scientists.]&lt;br /&gt;
:&amp;quot;The trick was fuckin'&amp;quot;&lt;br /&gt;
&lt;br /&gt;
:'''American Revolution'''&lt;br /&gt;
:Robot Paul Revere: Remember: Zero if by land, One if by sea.&lt;br /&gt;
&lt;br /&gt;
:'''MIT'''&lt;br /&gt;
:[Two people in front of a group of students.]&lt;br /&gt;
:Cueball: I've hired a team of MIT students to count cards for us.&lt;br /&gt;
:Hairy: We'll be rich!&lt;br /&gt;
&lt;br /&gt;
:[Hairy deals some cards while the students watch.]&lt;br /&gt;
&lt;br /&gt;
:[The gears turn..]&lt;br /&gt;
&lt;br /&gt;
:Student: Five. There are five cards.&lt;br /&gt;
:Cueball: I see their admission standards have been slipping.&lt;br /&gt;
:Hairy: Yeah - there are actually four.&lt;br /&gt;
&lt;br /&gt;
:'''MIT Course 15c'''&lt;br /&gt;
:[Two people in front of a group of students.]&lt;br /&gt;
:Cueball: I've hired a team of MIT students to count cards for us.&lt;br /&gt;
:Hairy: We'll be rich!&lt;br /&gt;
&lt;br /&gt;
:[Hairy deals some cards while the students watch.]&lt;br /&gt;
&lt;br /&gt;
:[The gears turn..]&lt;br /&gt;
&lt;br /&gt;
:Student: Five. There are five cards.&lt;br /&gt;
:Cueball: I *knew* we shouldn't have picked course 15s.&lt;br /&gt;
:Hairy: Yeah - there are actually four.&lt;br /&gt;
&lt;br /&gt;
:'''Smith/Wellesley'''&lt;br /&gt;
:[Two people in front of a group of students.]&lt;br /&gt;
:Cueball: I've hired a team of Smith/Wellesley students to count cards for us.&lt;br /&gt;
:Hairy: We'll be rich!&lt;br /&gt;
&lt;br /&gt;
:[Hairy deals some cards while the students watch.]&lt;br /&gt;
&lt;br /&gt;
:[The gears turn..]&lt;br /&gt;
&lt;br /&gt;
:Student: Five. There are five cards.&lt;br /&gt;
:Cueball: We should've gone with Wellesley/Smith.&lt;br /&gt;
:Hairy: Yeah - there are actually four.&lt;br /&gt;
&lt;br /&gt;
:'''CNU'''&lt;br /&gt;
:[Person unsuspectingly strolls under a giant box trap controlled by a Trible.]&lt;br /&gt;
:I worry that CNU only invited me back as a ruse because they realized I never turned in my final paper and want my diploma back. But if it turns out it's for real, I'll see you Wednesday at the Ferguson!&lt;br /&gt;
&lt;br /&gt;
:'''Dana Farber'''&lt;br /&gt;
:[Cueball, pointing towards head.]&lt;br /&gt;
:Cueball: Check it out - In support of people going through chemo, I shaved my head.&lt;br /&gt;
:Lots of love to everyone reading this at Dana Farber. Cancer sucks. If you are new to DCFI, there's a great little garden on the third floor of the yawkey if you need somewhere quiet to just sit for a little bit and breathe.&lt;br /&gt;
&lt;br /&gt;
:'''Reviews'''&lt;br /&gt;
:Shopping before online reviews:&lt;br /&gt;
:[Cueball and Megan stand in a store. Cueball points at a lamp on the table in front of him. There is another lamp on the table behind them.]&lt;br /&gt;
:Cueball: This lamp is pretty.&lt;br /&gt;
:Megan: And affordable.&lt;br /&gt;
:Cueball: Let's get it.&lt;br /&gt;
:Megan Ok! &lt;br /&gt;
&lt;br /&gt;
:Shopping now:&lt;br /&gt;
:[Cueball points at a lamp on the table in front of him. Megan looks at her phone.]&lt;br /&gt;
:Cueball: This lamp is pretty.&lt;br /&gt;
:Megan: It's got 1 1/2 stars on Amazon. Reviews all say to avoid that brand.&lt;br /&gt;
&lt;br /&gt;
:[Cueball and Megan are now both looking at their phones.]&lt;br /&gt;
:Cueball: This one has good reviews.&lt;br /&gt;
:Megan: Wait, one guy says when he plugged it in, he got a metallic taste in his mouth and his cats went deaf.&lt;br /&gt;
:Cueball: Eek. What about- ...no, review points out it resembles a uterus.&lt;br /&gt;
&lt;br /&gt;
:[Cueball is still looking at his phone, Megan has hers at her side.]&lt;br /&gt;
:Cueball: Ok, I found a Swiss lampmaker with perfect reviews. Her lamps start at 1,300 Francs and she's only reachable by ski lift.&lt;br /&gt;
:Megan: You know, our room looks fine in the dark.&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*Reddit user [http://www.reddit.com/user/SomePostMan SomePostMan] created a [http://www.reddit.com/r/xkcd/comments/t6wmh/all_umwelt_1037_comics_in_two_imgur_albums/ post] that collected all of the Umwelt comics and added explanations. Much of his information is now included in this wiki.&lt;br /&gt;
&lt;br /&gt;
*The transcript section for this comic also included a note alluding to its extreme length:&lt;br /&gt;
: [ [Two people...] ]  ((..wait.. &amp;lt;scrolls through a listing of everything&amp;gt; oh goddammit Randall. Thanks a bunch, dude. I better get a raise for typing out all this))  &lt;br /&gt;
: [Two people standing next to each other.  One is holding the head end of a snake...&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring Black Hat]]&lt;br /&gt;
[[Category:Comics featuring Beret Guy]]&lt;br /&gt;
[[Category:Comics featuring Danish]]&lt;br /&gt;
[[Category:Comics featuring Hairy]]&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Dynamic comics]]&lt;br /&gt;
[[Category:April fool's comics]]&lt;br /&gt;
[[Category:Philosophy]]&lt;br /&gt;
[[Category:Penis]]&lt;br /&gt;
[[Category:Video games]]&lt;br /&gt;
[[Category:Velociraptors]]&lt;/div&gt;</summary>
		<author><name>108.162.238.221</name></author>	</entry>

	</feed>