explain xkcd - User contributions [en]

2306: Common Cold

2020-05-13T23:53:49Z

108.162.242.19: /* Explanation */

{{comic
| number = 2306
| date = May 14, 2020
| title = Common Cold
| image = common_cold.png
| titletext = Not even metapneumovirus, easily the common cold virus with the coolest name, warrants our sympathy. Colds suck. No mercy.
}}

==Explanation==
{{incomplete|Created by a PLEADING PNEUMOVIRUS. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
Many of the measures humans have undertaken to fight SARS CoV-2 (the virus that causes the COVID-19 coronavirus disease), such as careful handwashing and sanitization of frequently-touched surfaces, are effective against other viruses as well. This strip suggests that the viruses that cause the common cold are in a desperate situation and may, incidentally to the COVID-19 issue, end up being eliminated. Consequently, large, sentient versions of these viruses appear and plead for mercy, asking that people stop the good hygiene practices that "make things really hard" for them to reproduce.

However, while colds are unlikely to kill otherwise healthy humans, they are still unpleasant. Randall has previously described the unpleasant nature of colds described by the viruses in [[1612: Colds]], and in [[1618: Cold Medicine]], Cueball was suffering from a cold severe enough that he didn't care what sort of authority watchlist he ended up on as long as he got effective medicine to weaken the symptoms. As such, Cueball {{tvtropes|BigNO|denies the request of the viruses with vehemence}}.

The ''[[what_if?|what if?]]'' book previously dealt with the plausibility of eliminating the common cold through aggressive physical distancing alone.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

{{comic discussion}}

2280: 2010 and 2020

2020-05-05T18:28:18Z

108.162.242.19: /* Explanation */

{{comic
| number = 2280
| date = March 13, 2020
| title = 2010 and 2020
| image = 2010_and_2020.png
| titletext = 2030: "I just bought a house for one bitcoin. No, it's the equivalent of a dollar. Houses are often transferred for a nominal fee because the buyer is taking responsibility for containing the holo-banshees in the attic."
}}

==Explanation==
This comic is the sixth comic in a row in a [[:Category:COVID-19|series of comics]] about the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} - {{w|SARS-CoV-2}}.

[[White Hat]], who lives in 2010, and [[Cueball]], who lives in 2020, are in contact with each other via some kind of time travel. White Hat wants to learn about life in 2020 and is particularly interested in {{w|bitcoin}}, a decentralized {{w|cryptocurrency}} which was released in 2009, and whether it had become an acceptable currency. Cueball answers that bitcoin still exists, and that he just bought a bottle of {{w|hand sanitizer}} for the price of one bitcoin. White Hat probably assumes that bitcoin is a widely accepted currency worth a few dollars, and thinks that the situation is "normal". (In April 2010, one bitcoin was worth about 14 cents.)

At the time of this comic, the COVID-19 disease caused by SARS-CoV-2 infection (commonly known as "the coronavirus", though many colds are in fact a coronavirus; also see [[2275: Coronavirus Name]]), is spreading around the world, causing thousands of people to die (although relatively few compared to the number of people that have gotten better) and billions to panic. This increased the demand for hygiene products, including hand sanitizers, and therefore their price has increased. It also triggered a panic on financial markets, including severe devaluation of the infamously volatile bitcoin. Despite the crash, one bitcoin was still worth about $5,400 on the day this strip was published, not a few dollars. Therefore, buying a hand sanitizer for one bitcoin is not as normal as White Hat assumes.

The price of hand sanitizer has not reached the price of a bitcoin (yet), although some people on sites such as {{w|Amazon.com}} are attempting to sell it for ludicrous amounts and there are attempts by Amazon, eBay, and other selling platforms, as well as potential legislation, aimed at curtailing such {{w|price gouging}}.

The title text claims that, in 2030, bitcoin will again be worth about one dollar, but houses will also be worth only one dollar due to the difficulty inherent in containing "holo-banshees" in the attic. What a holo-banshee is is not explained, but one can guess as to what it might mean. "Holo" is generally short for {{w|hologram}} and typically denotes some kind of 3D looking digital visual form, and a "{{w|banshee}}" is a mythological wailing creature or spirit. So even if not a physical object, constant shrieking would be undesirable.

The "nominal fee" mentioned by the 2030 time traveler is known in legal parlance as a "peppercorn". In reality, such a practice has been quite common for several decades (though not for something on the scale of a house); legal processes state that both sides must give something in order for a contract to exist, and a minimal peppercorn payment to secure a contract is preferable to the legal hoops that must be jumped through in order to lawfully give something away for nothing.

==Transcript==
:[White Hat and Cueball are walking to the right of the panel. There is a gray outline around Cueball, indicating he is from the future]
:White Hat: What are things like ten years from now in 2020?
:White Hat: We have this new "bitcoin" thing — does it ever catch on and become normal?

:[A frameless panel, with White Hat and Cueball still walking to the right.]
:Cueball: It's still around. I just bought a bottle of hand sanitizer for one bitcoin.

:[A regular panel, with them continuing to walk]
:White Hat: Cool, that sounds pretty normal.
:Cueball: Well, here's the thing...

== Trivia ==
* Cueball has previously traveled back in time ''twenty'' years to converse with his past self in [[2220: Imagine Going Back in Time]]. Like this conversation, his past self has a completely different set of concerns and expectations about the future compared to his present self like White Hat has compared to Cueball in this comic.

{{comic discussion}}

[[Category:COVID-19]]
[[Category: Comics featuring Cueball]]
[[Category: Comics featuring White Hat]]
[[Category: Time travel]]

2298: Coronavirus Genome

2020-04-26T07:38:12Z

108.162.242.19: /* Explanation */

{{comic
| number = 2298
| date = April 24, 2020
| title = Coronavirus Genome
| image = coronavirus_genome.png
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.
}}

==Explanation==
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abbreviated as G, A, C, T, and U).

The nucleotide sequence displayed is a 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from the East Coast of the United States. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. However, SARS-CoV-2 is an RNA-virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence has been altered to resemble the more familiar codes of DNA.

[[Cueball]] is surprised that Megan and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this "{{w|epigenetics}}". In the real world, epigenetics is the study of changes that are not caused by changes in nucleotides, but by other chemical modifications to DNA and chromosomes that cause changes in patterns of gene expression and activation, often many generations down. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or rendered in boldface or enlarged to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.

The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude,{{Citation needed}} and may exceed the capabilities of any available spell-checking program. Furthermore, a spellcheck program underlines the whole word if a single letter is wrong and not just the letter itself. Thus, it would not be able to highlight individual mutated base pairs.

The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences against ones previously known, an activity which is the bread and butter of bioinformatics nowadays. Grammar checking would be analogous to having some sort of sense as to how well all the sequences generally cooperate and interact to create possibly viable functionality in an organism, something we are unable to do at the moment except in very limited ways and only in a few simple cases. It may also be a snarky commentary on the untrustworthy nature of grammar-check programs in general, which often follow grammatical rules far more strictly than is practical, especially in English (whose grammatical rules are numerous and often contradictory); it's not uncommon for an author to follow a grammar-check recommended correction only to find the corrected portion is now part of a longer portion that the checker deems "incorrect".

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]
:Cueball (off-screen): So that's the coronavirus genome, huh?
:Megan: It is!
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA

:[Cueball walks up and stands behind Megan, still working on the laptop.]
:Cueball: It's weird that you can just look at it in a text editor.
:Megan: It's essential!
:Megan: We geneticists do most of our work in Notepad.

:[A frameless panel, Cueball still standing behind Megan.]
:Cueball: Notepad?
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.
:Cueball: Ah, okay.
:Megan: That extra formatting is called "epigenetics".

:[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.]
:Cueball: Hey, why does that one have a red underline?
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.
:Cueball: ''Clever!''

{{comic discussion}}
[[Category: Comics featuring Cueball]]
[[Category: Comics featuring Megan]]
[[Category: Biology]]
[[Category:COVID-19]]

2288: Collector's Edition

2020-04-10T16:43:18Z

108.162.242.19: Updated "New phone released each year hint"

{{comic
| number = 2288
| date = April 3, 2020
| title = Collector's Edition
| image = collectors_edition.png
| titletext = I'm sure you can find some suitable worldbuilding material if you scavenge through the archives.
}}

==Explanation==
{{incomplete|Created by TECHNICAL DIFFICULTIES. The hint table needs to be completed. The mechanics should be explained more in-depth, if possible, screenshots of the hints, items in inventory, items-placing mechanics etc. should be added.}}

This was the 2020 April 1st comic. It is a large image, of which only part is visible, but can be dragged around. This space acts as a shared virtual sandbox where viewers can interact. "Items" (small, often humorous images) could be collected from other comics and then placed in this image by viewers. The collection then updated for all viewers in real-time. Multiples of the same item are often seen.

There is a "backpack" at the bottom, similar to backpacks in video games containing items collected by the player. As hinted by the title text, items could be found by visiting different XKCD comics/pages. Randomly, some pages would have a treasure chest which contained the sticker related to the page. The hint would refer to the page which currently had a chest.

The sticker images can be seen at <nowiki>https://xkcd.com/2288/collectors/static/loot/loot_</nowiki>'''XXX'''.png, where XXX is a number from 001-253. Additionally, some images can be found at custom URLs, for example the periodic elements can be found at <nowiki>https://xkcd.com/2288/collectors/static/loot/element-</nowiki>'''XX'''.png, where XX is the element, and text loot at <nowiki>https://xkcd.com/2288/collectors/static/loot/loot-words-</nowiki>'''X'''.png, where X is the sentence.

As of April 5, chests are no longer dropped.

===Hints===

{| class="wikitable"
!Hint
!Comic
!Unlocked item
!Item image
!Notes
|-
|Doctors in a row||Maybe [[1529: Bracket]] or [[497: Secretary: Part 4]]? Need confirmation.||Cory Doctorow || [[File:2288_loot_019.png|50px]] || These comics all have the same hint, but only one will have the chest
|-
|Get out the (US) vote||[[2224: Software Updates]]|| Statue of liberty ||[[File:2288_loot_246.png|75px]]||
|-
|Find a box of nice stuff on a picture with words like these|| [[1133: Up Goer Five]] (maybe incomplete) || Signpost || [[File:2288_loot_126.png|75px]] ||
|-
|Plug in or find another power source||[[1373: Screenshot]]|| ||[[File:2288_loot_228.png|50px]] or [[File:miniloot-words-dispenser.png|75px]] (maybe incomplete)||
|-
|Sweet dreams, kitty||[[729: Laser Pointer]] (maybe incomplete)|| Cat licking laser point || [[File:2288_loot_090.png|75px]] ||
|-
|What is this hint pointing to? Hell if I know.||[[28: Elefino]] (maybe incomplete)||2 + lightbulb = boat||[[File:2288_loot_185.png|75px]]||
|-
|Somebody set up us the bomb||[[286: All Your Base]]||Exploding rock||[[File:loot_197.png|75px]]||
|-
|Cowabunga||[[1412: Teenage Mutant Ninja Turtles]] (maybe incomplete)||Women Science Fiction Authors || [[File:loot_175.png|75px]] || [[197: Ninja Turtles]] also works
|-
|I want to believe||[[2156: Ufo]]||Ufo||[[File:loot_210.png|75px]]||
|-
|Bleeped||[[290]], [[398]], [[430]], [[447]], [[533]], [[549]], [[677]], [[724]] or [[1671]]|| *$@#! ||[[File:loot_044.png|75px]]||Comics that involve swearing
|-
|why waste time say few word when lot word do trick||[[7]], [[111]], [[139]], [[143]], [[179]], [[217]], [[445]], [[470]], [[822]], [[823]], [[1022]], [[1247]], [[1491]], [[1921]], [[1991]], [[2182]] or [[2231]]|| First Annual Award for Excellence in Being Very Smart ||[[File:loot_159.png|75px]]||
|-
|Cooler than electric scooters||[[139]], [[409]], [[577]], [[578]], [[579]], [[580]] or [[581]]||An electric scooter||[[File:loot_006.png|75px]]||
|-
|Take it from the top||[[1: Barrel - Part 1]] (maybe incomplete)||I am a turtle from [[889: Turtles]] || loot_095.png ||
|-
|I accept the yucca gnocchi, this meal is a success!||[[1713: 50 ccs]] (maybe incomplete)||Man carrying parentheses from [[297: Lisp Cycles]] || loot_031.png ||
|-
|Catch up on the news||[[1699: Local News]] (maybe incomplete)|| || ||
|-
|Participation trophy||[[2288: Collectors Edition]] (maybe incomplete)|| Server rack || loot_096.png ||
|-
|Find an opportunity for a sojourn||[[665]], [[681]], [[695]], [[1091]], [[1504]], [[1613]], [[1663]] or [[2111]]||Opportunity Mars rover from [[2111: Opportunity Rover]]||loot_161.png||
|-
|Tastier than tau day||[[179: e to the pi times i]] (maybe incomplete)||First annual award for excellence in being very smart || loot_159.png || Need to find out the difference between this, and the entry below!
|-
|Tastier than tau day||[[235]], [[396]], [[872]], [[1029]], [[1342]], [[1655]] or [[1967]]|| Pie sign ||loot_056.png|| Published on Pi day
|-
|418 I'm a teapot||[[1866: Russell's Teapot]] (maybe incomplete)||S.S. NASA: Space is Hard || loot_216.png ||
|-
|26th September, 1983||[[2052: Stanislav Petrov Day]]||White dove||loot_205.png||Might also be written "September 26th, 1983". Locale dependent?
|-
|There are 4241 as of Apr 1, 2020||[[1071: Exoplanets]] (maybe incomplete)|| Little girl from [[2264: Satellite]] || loot_151.png ||
|-
|asableiK||[[645: RPS]]|| A reverse Polish hotdog ||loot_079.png|| "Kielbasa" backwards, which is "sausage" in Polish
|-
|Critical mass elements||[[235: Kite]] or [[239: Blagofaire]]|| ||loot_203.png||
|-
|Some Februarys are more equal than others||[[390: Nightmares]]? (maybe incomplete)|| Cueball wheelie from [[272: Linux User at Best Buy]] || loot_036.png || Comic-hint connection largely conjectural; 390 was the first comic published on a leap day.
|-
|Five spice||[[1511: Spice Girl]] or [[1554: Spice Girls]]|| Rock guitarist ||loot_022.png||
|-
|Call the plumber||[[290: Fucking Blue Shells]] (maybe incomplete)|| || loot_058.png ||
|-
|Was it a rat I saw?||[[1632: Palindrome]] (maybe incomplete)|| Cueball with a large sack, pulling a wagon || loot_103.png || or [[1503: Squirrel Plan]] for cueball holding a balloon caught in a ceiling fan.
|-
|Churchill's gonna have to seriously rehydrate||[[1148: Nothing to Offer]]|| Bottle of soda ||loot_045.png||
|-
|Keep coming back|| || || ||
|-
|A new model released each year||Triggered by visiting all xkcd phone comics in order|| Phone screaming "Noooo" || loot_235.png ||
|-
|Tea Time||Maybe [[581: The Race: Part 5]]? Need confirmation.||All our tea ||loot_232.png||
|-
|Try pattern-matching! Look for comic 'bout alphabet?||[[1045: Constraints]]||Two Tetris blocks||loot_092.png||
|-
|Where's Hilbert?||[[195: Map of the Internet]] (maybe incomplete)|| Hilbert Curve || loot_021.png ||
|-
|Science fiction fetish||[[1585: Similarities]]|| ||loot_202.png||
|-
|The first one was funnier||[[11: Barrel - Part 2]] (maybe incomplete)||Falling feather / Sign "The uncomfortable truths well" || loot_250.png / loot_067.png ||
|-
|It's up to over 260 million cycles!||[[1941: Dying Gift]]|| Megan on a tire swing ||loot_127.png||
|-
|Sleeping Beauty is the same everywhere though||[[2233: Aurora Meaning]] (maybe incomplete)|| Sleeping Cat || loot_163.png ||
|-
|On the internet, nobody knows you're an arachnid||[[1530: Keyboard Mash]] (maybe incomplete)|| Cobwebbed frame from [[1135: Arachnoneurology]]|| loot_191.png ||
|-
|Did James Cameron pay for the rice cooker too?||[[1598: Salvage]] (maybe incomplete)||Rice bowl || loot_152.png ||
|-
|Never going to give you up||[[351]], [[389]], [[396]], [[524]], [[573]], [[609]], [[802]], [[1212]], [[1757]] or [[1981]]|| Cueball in car listening to music ||loot_010.png||
|-
|If red touches yellow, that's 24 ohms||[[1604: Snakes]], [[227: Color Codes]]? (maybe incomplete)|| Yoda with an mp3 player from What If || loot_247.png ||
|-
|An enthusiastic but questionable business opportunity||[[1021]], [[1032]], [[1117]], [[1293]], [[1493]], [[1533]], [[1772]], [[1812]], [[1871]], [[1903]], [[1997]], [[2140]], [[2209]] or [[2277]]|| Beret guy with a goat on leash ||loot_115.png||
|-
|Read the fine manual||[[293]], [[434]], [[456]], [[912]], [[1343]] or [[1692]]|| ||Multiple: loot_106.png, miniloot-words-hair.png, miniloot-words-ominous.png, miniloot-words-eruption.png, miniloot-words-flying.png or miniloot-words-ghost.png (maybe incomplete)||
|-
|That thing's undecimodal!||[[1347: t Distribution]] (maybe incomplete)|| Floating tentacled alien || loot_209.png ||
|-
|Actually, it's Myanmar-Shave now||[[491: Twitter]] (maybe incomplete)||Expensive bottle || loot_253.png ||
|-
|You don't have to find all 99||[[121: Balloon]] (maybe incomplete)||Balloon copter || loot_002.png || Or [[51: Malaria]] ?
|-
|Going in circles||[[378: Real Programmers]] (maybe incomplete)|| Cueball spinning in desk chair || loot_098.png ||
|-
|Couldn't you try knitting, or maybe stamp collecting?||[[37]], [[53]], [[60]], [[75]], [[79]], [[148]], [[168]], [[174]], [[236]], [[259]], [[287]], [[296]], [[326]], [[331]], [[389]], [[437]], [[451]], [[559]], [[590]], [[605]], [[687]], [[719]], [[733]], [[790]], [[845]], [[966]], [[1004]], [[1119]], [[1145]], [[1169]], [[1208]], [[1278]], [[1304]], [[1329]], [[1340]], [[1355]], [[1405]], [[1480]], [[1546]], [[1598]], [[1677]], [[1697]], [[1705]], [[1788]], [[1795]], [[1960]], [[1995]], [[2032]], [[2123]], [[2208]] or [[2252]]||Phishing License sign||loot_158.png||Mostly comics that include "My hobby:"
|-
|It's the ciiiiircle of HONK||[[537: Ducklings]] or [[1729: Migrating Geese]]||DUCKLOOP'D?||loot_069.png||
|-
|Fool me twice||Maybe [[880: Headache]]? Need confirmation.|| Raptor Attack || loot_033.png ||The second April fools' comic
|-
|oOOOoooo||Maybe [[316: Loud Sex]]? Need confirmation.|| Sleeping cat || ||
|-
|Maybe we can ask for new wishes||[[879: Lamp]]||Genie and his bottle||loot_004.png||If you place the genie last, you get another genie (indefinitely) - Needs verification, this may also just be a bug!
|-
|HACK THE PLANET||[[1337: Hack]] (maybe incomplete)|| Crash and Burn in the pool from the end of ''Hackers'' || loot_130.png ||
|-
|Monetization haute couteur||[[20]], [[23]], [[55]], [[123]], [[149]], [[150]], [[162]], [[208]], [[231]], [[242]], [[256]], [[273]], [[285]], [[303]], [[327]], [[377]], [[386]], [[420]], [[435]], [[442]], [[482]], [[505]], [[552]], [[556]], [[585]], [[614]], [[627]], [[657]], [[681]], [[688]], [[705]], [[710]], [[802]], [[821]], [[980]], [[1033]], [[1040]], [[1079]], [[1127]], [[1133]], [[1196]], [[1298]] or [[1428]] (maybe false positives)||Two bags of money ||loot_162.png||
|-
|Maybe writing a script would help||[[1319: Automation]]|| ||miniloot-words-eater.png (maybe incomplete)||
|-
|Go big to go small||[[1365: Inflation]]|| ||loot_245.png||
|-
|Are you projecting||[[850]], [[977]], [[1500]], [[1784]], [[1799]], [[2242]] or [[2256]]||Squirrel on a gun||loot_237.png||
|-
|Do spiders really have six legs||[[8]], [[43]], [[126]], [[427]], [[442]] or [[1110]]|| ||loot_007.png||
|-
|Istanbul or Constantinople or St. Trimble's Island?||[[1688: Map Age Guide]]||Cephalopod||loot_071.png||
|-
|Another rulebook?||[[393: Ultimate Game]]|| Merlin in a chair from [[270: Merlin]] ||loot_037.png||
|-
|Moooooon||[[482]], [[681]], [[1276]], [[1291]], [[1300]], [[1389]], [[1458]], [[1515]], [[1633]], [[1738]], [[1878]] or [[2258]]|| MOOOOOON ||loot_192.png||
|-
|Take a flight from LOL to FFS||[[1937: IATA Airport Abbreviations]]|| ||loot_049.png||
|-
|Everyone deserves a second chnace||All comics searched, no matches|| || ||The misspelling is intentional. [[745: Dyslexics]] would have been a good fit
|-
|Community contribution||[[822]], [[823]], [[824]], [[825]], [[826]]|| [Citation Needed] protester from [[285: Wikipedian Protester]] || loot_035.png ||
|-
|On the other side of the wardrobe||[[665: Prudence]], [[969: Delta-P]] or [[2218: Wardrobe]] (maybe incomplete)||Authentic Reindeer pulling sled from [[1776: Reindeer]] || loot_154.png ||
|-
|Today's your lucky day||[[1053: Ten Thousand]] (maybe incomplete)|| Ms. Frizzle || loot_105.png ||
|-
|[This hint has been redacted due to a copyright claim]||[[1005: SOPA]]|| ||loot_038.png||
|-
|Try a different approach||[[55: Useless]] (maybe incomplete)|| Equals sign ||loot_times.png or loot_div.png (maybe incomplete)||
|-
|The cake is a lie!||[[606: Cutting Edge]]|| Cake ||loot_144.png||
|-
|Joanna, fire.||[[322: Pix Plz]]|| Joanna with EMP cannon ||loot_026.png||
|-
|Everything changes from time to time when the fire nation attacks|| [[965: Elements]] || Symposium || ||
|-
|90KG x 300M||[[382: Trebuchet]]|| Trebuchet ||loot_041.png||
|-
|Copyright Enforcement Brigade||[[344: 1337: Part 4]]|| ||loot_046.png||
|-
|Where Cape Town meets Chukotka||[[1500: Upside-Down Map]]|| Crater ||loot_128.png||
|-
|Take a ride in a barrel||View all five barrel comics in reverse order ([[31]], [[25]], [[22]], [[11]], [[1]])|| Cueball at the door to the playpen-ball-filled apartment from [[150: Grownups]] || loot_005.png ||
|-
|Compiling...||[[303: Compiling]]|| ||loot_030.png||
|-
| || [[2288: Collectors Edition]] || Sheeple eye || loot_109.png ||
|-
| || [[2288: Collectors Edition]] || Time machine from [[1747: Spider Paleontology]] || loot_167.png ||
|}

[[File:2288_full.png]]

==Trivia==
* This comic is the 2020 April Fools comic and was supposed to be released Wednesday, April 1st, but did not go live until Friday, April 3. (Friday's comic was published on Saturday.) However, the message below was displayed on the top of the page from Wednesday until the comic finally went live:
<blockquote>
Note: For technical reasons Wednesday's comic will be posted Thursday instead. Apologies for the delay!
</blockquote>
* This is one of the few comics released four days after the previous one. The last time this occurred was [[2224: Software Updates]].
* Placement is limited to 10,000 horizontal units and 5,000 vertical units from the origin. Users received no messages if they try placing something outside the boundary, with a silent fail with the object not being placed.
* Coordinates are relative to the bottom left corner of the canvas. As the default coordinates are (-370,-277) and the origin is in the center, the displayed portion of the canvas can be found to be twice this in magnitude, 740 x 544 units.
* The comic contains 32993 separate images.
* The most common image is loot-30.png, which appears 2576 times.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[Cueball stands to the left of a vibrating box.]
:[The words "Collector's Edition" are written above him and boxed.]

{{comic discussion}}

[[Category:April fools' comics]]
[[Category:Comics featuring Cueball]]
[[Category:Interactive comics]]

Talk:Main Page

2020-04-04T21:07:29Z

108.162.242.19: /* Latest comic released. */

{{notice|This page is for discussion of the [[Main Page]] itself. Other issues probably belong at the [[Explain XKCD:Community portal]].}}

As a new user, I think the first page is very important. So I thought why not begin a discussion here what to have on the first page every user visits.--[[User:Relic|Relic]] ([[User talk:Relic|talk]]) 05:59, 1 August 2012 (EDT) Re-signed here - b/c I broke the comment in two when I added the "List of comics" header. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 23:01, 2 August 2012 (EDT)

==List of comics==
I was thinking of having a quick link to the list of comics that is explained. Right know, it took me a while to even see any of them. Eventually I found the "List All Pages" (found it in Special pages) where I could find the comics that have been explained. What do you think?
:A category tag will do that for you automatically. Having a list of comics indexed by its number would be a little different.--[[User:Relic|Relic]] ([[User talk:Relic|talk]]) 05:59, 1 August 2012 (EDT)
::Sounds like a great list - I ''think'' it'd have to be manually maintained until/unless we get someone who knows how to make a bot update it. Categories will be useful, but they only work if someone added the category to the page in the first place. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 07:21, 1 August 2012 (EDT)
:::A (somewhat) related question - should [[:Category:Comics]] be sorted alphabetically or by comic number? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 07:43, 1 August 2012 (EDT)
::::I think [[:Category:Comics]] should be sorted by comic number. If you are looking for a specific comic, you will use the search field. Is there a way to make that happen? --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 08:11, 1 August 2012 (EDT)
:::::They are two different functions. For the former, instead of adding <nowiki>[[Category:Comics]]</nowiki>, add, say, <nowiki>[[Category:Comics|1]]</nowiki>. For the second, we can create redirects. Normally, I'd say just make sure the search term was in the article text, but since numbers are going to be use for other purposes than just comic titles, it may be better to create [[1]] and [[Comic 1]] as redirects to the relevant articles right off the bat. --08:24, 1 August 2012 (EDT)
::::::We could also have a comic-list template on the Main Page, I suppose, or perhaps two - one for number and one for name? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:54, 1 August 2012 (EDT)
:::::::Here's what I was thinking of for that: {{tl|Comics navbox}} Thoughts? ''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]]
:(outdent) It's ugly, but a sortable wikitable [[User:SurturZ/sandbox|(click here for example)]] could be used as a checklist to see what has been uploaded and what hasn't. What's the project namespace here, anyway (analogue of "WP:")? --[[User:SurturZ|SurturZ]] ([[User talk:SurturZ|talk]]) 03:04, 3 August 2012 (EDT)
:OK, I've found a way to get all the titles of the comics, so I was confident enough to create <big>[[Explain XKCD:Checklist]]</big> which can be used to fill in the gaps. --[[User:SurturZ|SurturZ]] ([[User talk:SurturZ|talk]]) 03:41, 3 August 2012 (EDT)
::I'm liking the checklist! That should do quite nicely as a "tool for editors". (I'm linking to it at the Community Portal). We still need the "template for readers." Did you think {{tl|Comics navbox}} was on the right track or should we do something else for that? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 20:09, 3 August 2012 (EDT)
::Better idea - I'm throwing it directly onto the Main Page. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 20:10, 3 August 2012 (EDT)

==Admin list==
You can find a system-accurate list of admins [{{canonicalurl:Special:ListUsers|group=sysop}} here], so that might good to share, along with the manual list. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 07:13, 1 August 2012 (EDT)
:Added to page. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:10, 1 August 2012 (EDT)
::That's exactly what I wanted, but couldn't find the auto page for it. I knew it was somewhere. I don't see any reason to keep the link to the manual page. Do you? --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 08:11, 1 August 2012 (EDT)
:::Not unless you want it. I'll remove it. Should I add the similar link for 'crats or is that unnecessary at this point? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:25, 1 August 2012 (EDT)
::::To be honest, I have no idea what the Burecrats role does. Might be unnecessary now but helpful in the future? --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 11:16, 1 August 2012 (EDT)
:::::Bureaucrats can turn other users into administrators (or indeed, other bureaucrats). That privilege isn't available to ordinary administrators. I'd keep it to yourself for the time being. :-) --[[User:Yirba|Yirba]] ([[User talk:Yirba|talk]]) 17:39, 1 August 2012 (EDT)
::::::You can actually see a technical list of which rights each group confers at [[Special:ListGroupRights]]. As the wiki grows, you might want to spin off a few, such as the ability to grant rollbacker and autopatrolled, to admins as some other wikis have. But for the time being, at least, there's really no reason for the wiki to have more than one 'crat. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 17:07, 2 August 2012 (EDT)

== Community portal ==

I've created the [[Explain XKCD:Community portal]] as a tools/help page. If that's not what you want, feel free to change/move/whatever it, but I thought it'd be nice to save this page for discussion of the Main Page and discuss the wiki as a whole/ask for help there. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:36, 1 August 2012 (EDT)

== Direct link to latest comic ==

There should be a direct link to the latest comic at the top of the Main page. A nice thing about going to explainxkcd.com was that the latest comic is right there at the top. For those changing their default link to the wiki, there should be an easy "Latest Comic" link that quickly takes them there. I'm sure some folks actually skip xkcd.com and come directly here instead to read the latest offering from Randall. They shouldn't have to search for it.
[[User:Christopher Foxx|- CFoxx]] ([[User talk:Christopher Foxx|talk]]) 11:59, 1 August 2012 (EDT)

: Maybe the page [[latest]] should redirect to the most recent comic? Could that be taken care of by some sort of script/template so it doesn't have to be manually updated? Should each explination page also have "next", "previous", "random", "first" and "latest" links, possibly also generated automatically via scripts/templates? Additionally, shouldn't the number page be the canonical one? It seems like [[Internal monologue]] should redirect to [[1089]] rather than the other way around - certainly it would make a bunch of scripting types of things a lot easier. [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:02, 1 August 2012 (EDT)
:::If you wanted, we could even use wiki-magic to show the title of the page as the Comic name, but the URL as the number - in order to parallel the actual XKCD website. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 17:09, 2 August 2012 (EDT)
:: Shouldn't there be a way to programmatically find the comic with the highest number that has a page with content? That would work as long as no one puts future comic pages up. --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 20:25, 1 August 2012 (EDT)
:::It's all sounding like folks are over-complicating something quite easy. All I'm suggesting is a prominent link to http://www.xkcd.com/. No need, I think, to list which number the latest is, or include the next/last/random buttons, etc. [[User:Christopher Foxx|- CFoxx]] ([[User talk:Christopher Foxx|talk]]) 11:41, 3 August 2012 (EDT)
::::Oh. We've got that, now, in the sidebar - labeled as "XKCD." I do think that having an internal link to the latest (explained) comic would be a great thing, though. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 16:36, 4 August 2012 (EDT)

You can transclude the latest comic on the main page like this: <nowiki>{{:pagename}} e.g. {{:Internal_monologue}} </nowiki>--[[User:SurturZ|SurturZ]] ([[User talk:SurturZ|talk]]) 00:25, 2 August 2012 (EDT)
: I've started with just a manual link to the latest comic. Ideally it will be automatic, but a manual link will work for now as I've had quite a few people ask for it. --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 21:09, 1 August 2012 (EDT)

Transclusion of the latest comic is great. Someone with the right permissions should add (for instance on the top-right corner of the grey transclusion area) a link to edit the corresponding wiki page, so that people seeing something they could add would feel invited to do so (wiki style). In my opinion this would be a good way to improve the quality of the user-generated explanations.
Also, all the "XKCD"s in the "New here?" section should be converted to the lowercase "xkcd"...
[[User:Cos|Cos]] ([[User talk:Cos|talk]]) 14:00, 6 August 2012 (UTC)
:Good points. I've done both. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 15:48, 6 August 2012 (UTC)

Call me dumb, but... You've got a link called "prev" that goes to the explaination for the previous comic. Then a link called "comic #42" but that goes to xkcd. And then a smaller, less prominent link called "go to this comic" that doesn't go to the comic but to its explaination. Anyone else think that's a little back-to-front? [[User:Zootle|Zootle]] ([[User talk:Zootle|talk]]) 17:18, 31 August 2012 (UTC)
:OK, you're dumb :-). The standard template for an explanation page includes the header with "Prev", "Comic # (date)", and "Next" links. If we don't have explanation pages for the previous or next comic, we don't show the respective link. I hadn't noticed that the "Comic # (date)" bit was a link to the xkcd site before, but in context it makes sense to me. Including a link to the Explain page for the comic who's explain page you are already looking at doesn't make sense.
:The explanation page for the latest comic is "transcluded" in the main page pretty much as-is, so we get the header, the comic, the explanation, etc. We don't get the discussion, which is visible at the bottom of the Explain page. Because there is never an explanation for a comic that hasn't been released yet, there is never a "Next" link on the main page's transcluded header. So you get "Prev" and "Comic" links. The "Go to this comic" link is added by the main page above the transcluded explain page.
:I can see how the "Go to this comic" link might be poorly worded especially as it's placement seems to be within the explanation it's linking to. [[User:Blaisepascal|Blaisepascal]] ([[User talk:Blaisepascal|talk]]) 18:16, 31 August 2012 (UTC)
::Rather than "Go to this comic" maybe it could be "Go to full explanation" ? Something else? [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:38, 5 September 2012 (UTC)
::There was [http://www.explainxkcd.com/wiki/index.php?title=explain_xkcd:Community_portal/Admin_requests#.22Edit_this_explanation.22_link_on_main_page a discussion at one point] about a wittier/more descriptive link - but no one came up with anything. I do like "Go to Full Explanation" better, for what it's worth. --[[User:DanB|DanB]] ([[User talk:DanB|talk]]) 15:31, 5 September 2012 (UTC)
:::My problem with that suggestion is that it implies that the main page explanation is not full. As of right now, the full explanation is transcluded on the main page. There's nothing more to see by clicking that link (explanation wise) Perhaps "Go to full explanation page" but that doesn't quite sound right to me... [[User:TheHYPO|TheHYPO]] ([[User talk:TheHYPO|talk]]) 15:42, 7 September 2012 (UTC)
::::How about "Go to this Comic Explanation Page"? One nice thing about the specific page rather than the [[Main_Page]] transcoding is that it nicely includes the discussion as well. I have a bookmark to the [[Main_Page]] that I look at every day, but I want to easily read the discussions, not only the explanation. Humm, maybe we could have a page [[most recent comic]] that automagically redirects to the most recent comic? [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 12:42, 8 September 2012 (UTC)
:::::I tried to get [[most recent comic]] to redirect to LATESTCOMIC, but can't get the syntax working - it is possible? [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:03, 8 September 2012 (UTC)
::::::Apparently it isn't. I would have tried <code><nowiki>#REDIRECT [[{{LATESTCOMIC}}]]</nowiki></code> like you did, but since that doesn't work, I'll delete the page for now. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 16:38, 20 November 2012 (UTC)

== Discussion of latest comic ==
Perhaps include the discussions of the latest comic here? I almost missed there was a discussion field a few times because I would only read about the latest comic on the main page. [[User:Carewolf|Carewolf]] ([[User talk:Carewolf|talk]]) 14:54, 22 September 2012 (UTC)

This comics's explanation is complete bollocks, I think. Of course it is NOT a "fact that such a room exists". This comics parodies trope often used in cop movies - an elderly cop goes to work for the last time before his retirement, packs things, plans fishing the next day ... only to be called to one more case (possibly with a new, young and brash partner). And despites his efforts not to screw anything and stay clear of danger, he is either mortally wounded or screws big time and is degraded. So much clichè, that if someone says "It's my last day or service", you might be sure one of the two options above happens. See http://tvtropes.org/pmwiki/pmwiki.php/Main/Retirony [[User:edheldil|Edheldil]] 10:17, 26 September 2012 (UTC)

I believe this link maybe relevant: http://en.wikipedia.org/wiki/Turtle_graphics {{unsigned|Rhudi}}

I went ahead and filled out the bracket from today's (see edit date) comic: http://m.imgur.com/gallery/WyPkHx2 {{unsigned|Glaucon81}}

*rise

Btw, why wouldn't I just enter "ipconfig free" if I didn't want my IP address showing? {{unsigned ip|172.68.65.48}}

== The comic explanation count is wrong ==

The adjustment is currently 3, but there are now 6 subcategories and one list making the current correct adjustment 7.
If the wiki was upgraded to version 1.20, a form exists to automatically exclude subcategories.
--[[User:Divad27182|Divad27182]] ([[User talk:Divad27182|talk]]) 09:56, 8 October 2012 (UTC)

:Looks like another week of the wiki going down then.
:But seriously, I've been noticing this too. Didn't know what was causing it, but it's going to have to be fixed sometime.[[User:Davidy22|Davidy22]] ([[User talk:Davidy22|talk]]) 10:25, 8 October 2012 (UTC)

::The text reads <pre><nowiki>We already have [[:Category:Comics|'''{{#expr:{{PAGESINCAT:Comics}}-3}}''' comic explanations]]!</nowiki></pre> The -3 is to account for the subcategories and non-explanation pages in the category. There apparently used to be three such pages, and now there are seven. I would fix this myself, but the page is protected. If the wiki where upgraded to version 1.20, the categories could be explicitly excluded, but the [[List of all comics]] would still be in the category. (Note that the -3 actually appears twice.) --[[User:Divad27182|Divad27182]] ([[User talk:Divad27182|talk]]) 05:03, 11 October 2012 (UTC)

:::Mediawiki 1.20 fixes this issue, although it'd be nice if this could be fixed in the meantime via the hack reccommended by divad. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 06:40, 16 November 2012 (UTC)

:Looks like Waldir updated the "Comic Correction Count" to "10" (as of 20 November 2012):
<nowiki> We already have [[:Category:Comics|'''{{#expr:{{PAGESINCAT:Comics}}-10}}''' comic explanations]]!</big>
Note: the -10 in the calculation above is to discount subcategories (there are 7 of them as of 20 November 2012),
non-comic pages (2 as of same date: [[List of all comics]] and [[Exoplanet]])
and the comic 404, which was deliberately not posted. Thus 7 + 2 + 1 = 10
(But there are still {{#expr:{{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-10)}} to go. Come and [[List of all comics|add yours]]!)</nowiki>
:Could we possibly make this more dynamic by creating a "IGNORE_IN_COUNT" category or something? and then using something like: <nowiki>{#expr:{{PAGESINCAT:Comics}}-{{PAGESINCAT:IGNORE_IN_COUNT}}}</nowiki>? Then any additional entries to the "Comics" category (that are 'special' entries) could just have the special category added and no main page editing would be necessary? --[[User:Bpothier|B. P.]] ([[User talk:Bpothier|talk]]) 07:50, 22 November 2012 (UTC)

==Make Jeff stop apologizing==
The apology for server downtime has been around for a while now. Can we take it down? [[User:Davidy22|Davidy22]] ([[User talk:Davidy22|talk]]) 04:41, 11 October 2012 (UTC)

== Spambots ==

I think someone should install [http://www.mediawiki.org/wiki/Extension:AbuseFilter AbuseFilter]. --[[User:Kronf|Kronf]] ([[User talk:Kronf|talk]]) 10:09, 13 October 2012 (UTC)

== Purge ==

We should regularly purge the server's cache for the main page using http://www.explainxkcd.com/wiki/index.php?title=Main_Page&action=purge to keep the explanation up to date. --[[User:Kronf|Kronf]] ([[User talk:Kronf|talk]]) 02:28, 3 November 2012 (UTC)

== Updating the Rules ==

I've been having a lovely discussion with someone who apparently thought the "edit anything you want" rule applied to the Talk pages. As we don't have any codified rules for ''here'' and can only point to "well the canonical way this is done on Wikipedia is..." I think that there are a few things we need to put into the list of Rules on the front page, and then have a link to a more in-depth talk about why the rules exist and what-not.

Specifically, I'm talking about writing "Feel free to edit any page on the wiki to be better. But, treat talk pages like you would blog comments: comments by other people ''cannot be changed by you'', you can only respond to them." as a new rule to be plastered on the front page, as there seems to be an increasing number social neophytes that seem to think that editing words that are attributed as being said by another person is perfectly legitimate and non-controversial.

Shall we discuss? [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 01:25, 15 November 2012 (UTC)

:We could add the etiquette rules as an addendum to the signature reminder at the top of the page. Just an extra note below the alert box asking people to not edit other people's comments. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 06:40, 16 November 2012 (UTC)

::It really should be right down with the "edited mercilessly" description, because this is an exception to that statement. Shouldn't have two sets of contradictory instructions in different places. When I made my improper edit, I had a semi-conscious moment of doubt about whether changing the other guy's comment was ok, even though this is a wiki (and even though it wasn't really clear to me that this "discussion" box held something totally separate from the page content), but that statement at the bottom put all such doubts to rest. I read it multiple times to be sure. But I did not notice that line at the top about the four tildes until ''much'' later. It's somewhat lost, visually, in the header line, when you're not looking directly at it.[[Special:Contributions/50.0.38.245|50.0.38.245]] 18:32, 18 November 2012 (UTC)

:::There's discussion to replace that message with a more noticeable alert box. The message at the bottom of the page appears for all pages, including talk pages, so a talk-page specific message there would not entirely fit. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 00:18, 19 November 2012 (UTC)

::::If that text at the bottom is in fact alterable, it should be written to take every case into account. It's an extremely poor user interface that has instructions appearing on a page stating rules that are the exact opposite of reality. And note that the altert box on the top looks a lot like a banner add, when you don't focus on it and read it. People will tend to habitually filter out anything written there from their perception. Also, it can easily be scrolled off the top of the screen when the discussion starts to get long, and they have a preview displayed.
::::So I think after the "...then do not submit it here.", it should add, "'''Exception''': others' comments in Discussion pages are not to be altered. See full rules at <<link to appropriate wikipedia page>>."[[Special:Contributions/50.0.38.245|50.0.38.245]] 15:46, 28 November 2012 (UTC)

== Update after changes ==

The front page explanation hasn't been updated at all day to match changes in the explanation on the comic's page. This is a major problem i think, as it is the front page explanation people visitors will most often read. --[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 20:43, 26 November 2012 (UTC)
: It might be a caching issue. Appending <code>&action=purge</code> to the URL will probably fix it. Can you confirm it looks good to you now? --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 00:29, 27 November 2012 (UTC)
::Yep, now it updates instantly! Well done, whatever you did! :) --[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 16:24, 27 November 2012 (UTC)

:::I've also added a link underneath the comic box that has the action embedded, so no one has to do any manual URL hacking. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 17:38, 11 December 2012 (UTC)

::::Just wanted to check in on this - are there issues with automated systems or spammers following this link? I know it can affect performance - caching is important on a busy site! --[[User:Overand|Overand]] ([[User talk:Overand|talk]]) 22:37, 13 September 2013 (UTC)

== Suggestion: Change "Go to this comic" to "Go to this entry" ==

Just a small suggestion. For the Main Page, I suggest changing "Go to this comic" to say "Go to this ''entry''" instead to remove any confusion for new and regular viewers. It certainly took me a while to figure how to go to each featured comic's entry from the main page.

[[Special:Contributions/69.43.114.2|69.43.114.2]] 17:04, 11 December 2012 (UTC)

:How about if it reads "Go to this comic explanation"? Would that be less confusing? I only quibble because the explanations aren't really entries, in wiki parlance each page is usually called an article, but that doesn't seem to fit here as we really have explanation pages. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 17:41, 11 December 2012 (UTC)

::Agreed. [[User:Ctxppc|Randy Marsh]] ([[User talk:Ctxppc|talk]]) 22:55, 8 January 2013 (UTC)

== Explain the Unreleased Comic? ==
:I wonder if [[http://i56.tinypic.com/a9ton8.png this comic]] is permitted to be explained, despite the double issue of Randall pulling the comic plus me finding the pulled comic through "xkcd overrated"... [[User:Greyson|Greyson]] ([[User talk:Greyson|talk]]) 18:21, 12 December 2012 (UTC)

== Comic 1156 ==

I don't have an account to edit the page directly, so here's an edit someone should make:
It looks like whoever wrote the existing page simply googled 'conditioning' and found the first link that came up.
Please modify the link to point to 'Classical conditioning', not 'Operant conditioning'.
Thanks. {{unsigned ip|124.191.56.91|05:26, 7 January 2013‎ (UTC)}}

:Hi. This is the talk page for the main page of the wiki. This page only has a "view" of the actual comic explanation. The actual explanation page is at [[1156: Conditioning]], and I assure you, edit permissions have not been restricted for that page. Someone has already changed the page to link to Classical conditioning, but the original editor came back stating that Operant was correct. If you would like to start a discussion about this [[Talk:1156: Conditioning|on the talk page for this explanation]] that would be much more conducive to getting this matter settled. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 05:52, 7 January 2013 (UTC)

== Comic Links ==

Some of the links seem to be confusing, as they're titled in a weird way. The link/button 'go to this comic', I'd expect would go to the actual comic on XKCD's page. Yet it goes to the comic's wiki page. And clicking on the comic # and date directs you to the XKCD page, yet I really feel that link should go to the wiki page, as it's right at the top center there, and has the date and everything, sort of indicating that it's a wiki page, yet it's not. And the prev and next buttons next to it don't go to the xkcd page, they go to the wiki pages. Which is really messed up, I think. Because of my confusion, every single time I visit here, I clicked on the wrong link, though now I've gotten used to it. I suggest rewording the links as 'XKCD Comic # and date' and 'go to this comic's wiki page'. And possibly switching the links' positions so that the wiki links could be in that navigation bar and the XKCD links could be off to the side. After all, we are a wiki, so putting our wiki links to the comic off to the side and the direct xkcd link in the center seems odd. Anyway, has anyone had the same thoughts and/or agree with me on this?--[[Special:Contributions/69.119.250.251|69.119.250.251]] 18:19, 9 January 2013 (UTC)

== Unexplained comics ==

The template that starts each explanation page should be edited to have the next and previous buttons automatically skip over pages that don't exist, rather than simply not being there if comic n+1 or n-1 doesn't exist. Preferably it would append a notice to the next page (like the redirect notices commonly found on mediawiki) telling you how many comics have been skipped. I'm not sure how feasible this would be to script, however. [[Special:Contributions/130.160.145.185|130.160.145.185]] 23:45, 9 March 2013 (UTC)

== Percentage of remaining comics calculation is off... ==

Okay, I hate to be "that pedantic math guy", but... Today the main page reads "We have collaboratively explained 936 xkcd comics, and only 252 (27%) remain." While I agree that 252/936 is roughly 27%, I believe we should really be calculating the percentage as "the number left to explain" divided by "the total number of comics that exist", not divided by "the number we have finished". That is (today), 252/1188=21%. Think about it. If we had completed 594 comics today, with 594 remaining, what should the percentage be? 594/594=100%? That's not right... 594/1188=50%? That's what we really want to say.

The page is protected, which makes sense. So I'll make my suggestion here.

Change this:

<pre>
and only {{#expr:{{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)}}
({{#expr: ({{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)) / ({{PAGESINCAT:Comics}}-9) * 100 round 0}}%)
remain.
</pre>
To this:
<pre>
and only {{#expr:{{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)}}
({{#expr: ({{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)) / {{#expr:{{LATESTCOMIC}}}} * 100 round 0}}%)
remain.
</pre>
[[User:Imperpay|Imperpay]] ([[User talk:Imperpay|talk]]) 15:32, 20 March 2013 (UTC)

:Done and done. '''[[User:Davidy22|{{Color|purple|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 15:37, 20 March 2013 (UTC)

:Thanks for the heads-up! However, notice that the #expr: around LATESTCOMIC was unnecessary. I've removed it. [[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 11:30, 21 March 2013 (UTC)

::Waldir, you have exposed me as a charlatan and a fool! (I just copied, pasted, and tinkered until I made something that worked. I don't actually understand it. No formal training, you see. It's what we used to call "hacking" back in the dawn of the digital era, before the word took on connotations of vandalism, trespassing, and fraud. Have you kids come up with another word for it?) [[User:Imperpay|Imperpay]] ([[User talk:Imperpay|talk]]) 13:59, 22 March 2013 (UTC)

::: Joke's on me then, 'cause you sure fooled me – I readily assumed you knew your way around those parser functions. Nice job hacking the code, it was a nearly perfect crime ;) --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 03:26, 25 March 2013 (UTC)

:::I've heard the cool kids call that the "Maker Mentality", usually with a reference to [http://makezine.com/ Make magazine] and [http://makerfaire.com/ Maker Faire]. But I think there's also a movement to resurrect the original meaning of hacker. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 04:21, 25 March 2013 (UTC)

==sidebar ads?==
''Moved to [[explain xkcd:Community portal/Proposals]] –– [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 08:06, 4 May 2013 (UTC)''

== Expression error on Main Page ==

Please use <code><nowiki>{{PAGESINCAT:...|R}}</nowiki></code> instead of <code><nowiki>{{PAGESINCAT:...}}</nowiki></code> to correct these errors :) --[[Special:Contributions/110.168.83.62|110.168.83.62]] 10:55, 8 April 2013 (UTC)
:Dun diddly done. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 11:21, 8 April 2013 (UTC)

== Compile a list of non-technical comics to non-technical readers? ==

I'm a long-time reader and fan of >< |< C |}, but my normal approach is useless when I introduce this provocative comic series to my less technical friends. They stay at the apparent level of many comics. They don't bother reading the explanations, but they would say, "it's hard to make sense". Imagine an average non-technical (and non-arts) major guy/girl, can we compile a list of state-of-the-art but less-technical, easy-to-comprehend but "ah ha!!" strips that is suitable for them? --[[User:FrenzY|W shll nvr flly xpln xkcd!]] ([[User talk:FrenzY|talk]]) 12:39, 18 May 2013 (UTC)
:Oh my god that signature.
:Gaah, derailment. Uh, pretty much anything that isn't tagged with the physics or math categories are easy enough to understand for the average English speaker, so just check the categories at the bottom of the page for that. Also, avoid comics with the incomplete tag, and that oughta be fine. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 14:41, 18 May 2013 (UTC)

== Quit building? ==
''This post was moved to [[Talk:1214: Geoguessr]].''

:Hello, this is the talk page for the content of the front page of the wiki, not for discussion of the most recent comic, that happens [[Talk:1214: Geoguessr|here]]. I've moved your post over there for you. Cheers, and welcome to explain xkcd! [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 05:09, 22 May 2013 (UTC)

== List of incomplete comics ==
We need a link to the "Incomplete articles" at the main page below the "Missing link". Most pages are created but many are incomplete.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 19:06, 7 June 2013 (UTC)

== Header message ==

'''Please don't take this seriously unless you actually think it's a good idea:'''

I think the header should be changed from "explain xkcd: It's 'cause you're dumb." to "explain xkcd: It's 'cause you're dumb... or still have some hope that comic [[1190]] will end." or something similar. [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 14:53, 9 June 2013 (UTC)

::Nope! This page is trying to explain more than 1222 comics, not only [[1190: Time]]. The header just states the truth.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 15:49, 9 June 2013 (UTC)

I'd vote for a change. People have started coming over to discuss the comic even when they've 'gotten' it. That, and the fact that this is one step ahead of Googling the references yourself. So.. maybe, "it's because you're dumb..and lazy."[[Special:Contributions/220.224.246.97|220.224.246.97]] 02:26, 31 August 2013 (UTC)
:I honestly don't think it either. This is the most comprehensive comic-by-comic Wiki. People don't come here because they're dumb ''or'' lazy. That's like saying I'm dumb for reading a review of an episode after I've watched it - I'm interested in seeing what other people up with or caught that I didn't. It denigrates the idea of aggregating information, which is a very un-XKCD idea.

As a regular reader of explainxkcd (who was to lazy to cotribute anything until now), I'd like to support the proposed edit. (... and lazy) It really fits to the tone of our favourite waste of otherwise productive time (which is xkcd for myself). Best wishes from Heidelberg, Germany. --[[Special:Contributions/147.142.13.86|147.142.13.86]] 14:38, 10 October 2013 (UTC)

A friend that happens to be blind hates this site because of the "It's cause you're dumb" tagline. If he wants a transcript of the comic on xkcd, his option is to come here and have his screen reader program telling him that he is dumb every single time.

How about, "explain xkcd: because sometimes we all need a little help."? -- [[Special:Contributions/173.245.54.65|173.245.54.65]] 02:07, 8 February 2016 (UTC)

:Oh, hadn't thought about that. There's been recurring complaints about this over the years, though the tagline's been around since before we were a wiki. I'll write something up and put this to a vote. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 09:00, 8 February 2016 (UTC)

== A point of confusion ==

Why is 'Apatosaurus' a category but 'Internet Argument' no longer a category? [[User:Greyson|Greyson]] ([[User talk:Greyson|talk]]) 13:53, 20 June 2013 (UTC)
:Cuz people hit the random button, see an Apatosaurus feature in three comics and figure it must be a recurring theme. Same as the internet argument thing. Will get round to a category purge after we've cleared out all the incomplete tags. I think there's one for ferrets hidden away somewhere in the dark recesses of our catalog of categories. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 14:45, 20 June 2013 (UTC)
::On the subject, can I suggest a "Barred from Conferences" category, or similar? That's definitely a recurring theme (for a long, long time), and thus should be justified enough. I'd be happy to add various qualifying articles as I scroll through again, if I can, but first I'll leave it up to someone else to solidify the actual name. (In case it turns out not to be just conferences, for example.) [[Special:Contributions/178.98.31.27|178.98.31.27]] 16:27, 22 June 2013 (UTC)

== Incomplete comics statement ==

I suggest the minor change: "We have an explanation for all x xkcd comics, and only y (y/x %) are '''marked as''' incomplete." –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 08:07, 21 June 2013 (UTC)

== 1262 is out ==

So what are you waiting for? [[Special:Contributions/75.60.27.102|75.60.27.102]] 06:25, 9 September 2013 (UTC)
:<nowiki>(diff | hist) . . N 1262: Unquote‎; 06:23, 9 September 2013 (UTC) . . (+322)‎ . . ‎Davidy22 (Talk | contribs | block)‎ (Created page with "{{comic | number = 1262 | date = September 9, 2013 | title = Unquote | image = unquote.png | titletext = I guess it's a saying from the Old Country. }} ==Expl...")</nowiki>
:Examine the time stamps. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:30, 9 September 2013 (UTC)

== Adverts ==

I am not going to disable my adblock, I hate ads. If you accept bitcoin I can make a donation though. [[Special:Contributions/184.66.160.91|184.66.160.91]] 05:24, 27 September 2013 (UTC)
:Our ads are always easy-to-load images as opposed to flash ads, they're always pointing to some valuable product of some form and we've looked at and approved all of them. They also occupy space that would otherwise have been empty, as our one ad is bound strictly to the sidebar. We used to have a paypal donation button, but it was pitifully tended to and a much less reliable source of income than ads. Ads are the only reliable business model for small sites like this one; unless our readers suddenly become willing to pay all our server costs for us, we can't feasibly afford a better hosting plan without ads. We legally aren't allowed to open a merch store, because that infringes on Randall's shop, and we haven't had a single generous benefactor yet. If you want to stop seeing our server error messages, loosening up adblock for us and contributing to our impressions count will help us massively. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:00, 27 September 2013 (UTC)

I don't care about your server message, I wanted to make a donation. Sooo, you don't want any bitcoins? [[Special:Contributions/37.221.161.235|37.221.161.235]] 07:16, 27 September 2013 (UTC)
:This took a bit of digging. We're fine with bitcoin donations, it's just that at the rate donations came in, they were just not enough to pay for anything. [https://coinbase.com/checkouts/b19f921822ac962807a8f72d51509e59] '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 20:34, 28 September 2013 (UTC)

Donation made! [[Special:Contributions/184.66.160.91|184.66.160.91]] 23:23, 30 September 2013 (UTC)
:Thanks! '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 02:27, 1 October 2013 (UTC)

Am I the only one that feels it is "wrong" that the explainxkcd site has ads and the real xkcd doesn't have any? It feels like someone is profiting off of Randall's work. Does he officially endorse this website? Do any proceeds help go to support his ongoing publication of an awesome comic? [[Special:Contributions/173.245.54.19|173.245.54.19]] 16:01, 7 July 2015 (UTC)

:An admin will be able to give you more detail than me, but explainxkcd has a significant number of visitors (and thus hosting costs), and no way to generate income other than donations and ads. In contrast, Randall makes money from his comics by way of books and merchandise (and possibly public speaking), some of which will pay for his hosting. He could choose to have ads on his site to generate additional income, its his choice not to. I have no knowledge of the finances of explainxkcd, however I doubt there is much/any surplus ad revenue being pocketed by the owners/admin. As far as the site being officially endorsed, not as far as I'm aware, no.
:Also, for more discussion on adverts/income, see [http://www.explainxkcd.com/wiki/index.php/explain_xkcd:Community_portal/Proposals#Sidebar_ads here].--[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 16:21, 7 July 2015 (UTC)

== /wiki is returning a 403 ==

Hello, 
http://www.explainxkcd.com/wiki/ is returning a 403 now. In my eyes you should redirect it to the main-page instead :-). --[[User:DaB.|DaB.]] ([[User talk:DaB.|talk]]) 12:41, 8 November 2013 (UTC)
:We have a new, hopefully better, server. The problem is already reported to [[User_talk:Jeff#Forbidden]] --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 14:22, 8 November 2013 (UTC)

== Explain Explain XKCD / Explain^2 XKCD ==

This particular comic explanation requires explanation. Way too many potential cross references with each conjecture requiring its own explanation page. Dial it back a little. {{unsigned ip|108.162.245.11}}
:Uh, sorry, could you clarify that a little? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 07:23, 19 November 2013 (UTC)

::He is talking about the [http://www.explainxkcd.com/wiki/ http://www.explainxkcd.com/wiki/] issue. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:32, 19 November 2013 (UTC)
:::Well if it's that, that's an intentional permissions setting on a URL that no-one is feasibly going to type. Unless you can come up with a better use for that URL, with a reason? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 08:40, 20 November 2013 (UTC)
::::A symlink to "index.php" at the root folder would solve the problem.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 09:26, 20 November 2013 (UTC)
:::::I cannot believe how many weeks that took to fix. Amazing. No one was going to type it, but everyone was going to get redirected to it from the home page! [[Special:Contributions/108.162.222.227|108.162.222.227]] 11:37, 20 November 2013 (UTC)

The problem is still not solved. [http://www.explainxkcd.com/wiki/ http://www.explainxkcd.com/wiki/] gives still a 403 error because "index.php" is not included in the http server configuration as a default index page. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:07, 20 November 2013 (UTC)
:: I've fixed this. Sorry about the delay. Was super busy! --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 16:02, 21 November 2013 (UTC)
:::Thanks Jeff, it's working. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:20, 21 November 2013 (UTC)

== Webmaster: Obtrusive video ad on your site ==

In the ad section I saw a box sticking out and blocking out the explanation. This was therefore a very obtrusive botched video ad. Please remove this ad from your site. [[Special:Contributions/199.27.128.188|199.27.128.188]] 22:29, 6 June 2014 (UTC)

EDIT: It's now sticking out and preventing me from clicking on the "Save page" button. [[Special:Contributions/199.27.128.188|199.27.128.188]] 22:29, 6 June 2014 (UTC)
:We only accept GIFs for moving ads. Ads should also be contained within the sidebar as they're techonogically restricted to standard-sized PNGs and GIFs, so an extruding ad would be a CSS error on the site end/browser error. In addition, we run ads from lots of advertisers, and "this ad" is not specific enough to tell us which ad you want us to remove. Could you provide a screenshot/link/more information? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 22:54, 6 June 2014 (UTC)

== Adding an arcs list page ==

I think there should be a page listing all webcomics arcs so far (the red spiders, the race, etc.)[[Special:Contributions/188.114.102.134|188.114.102.134]] 12:47, 2 October 2014 (UTC)

:This already exists, see [[:Category:Comic series]]. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 05:39, 10 April 2015 (UTC)

== This explanation may be incomplete or incorrect: link ==

This has been bothering me for a while now. Why does the link in the info box for the main page link to editing the main page? It needs to link to the editing of the page which the comic's explanation is on. When I would like to edit the latest XKCD explanation, I click that thinking I am going to edit the explanation, but instead I am led to editing the main page. [[User:Auraxangelic|Auraxangelic]] ([[User talk:Auraxangelic|talk]]) 15:19, 24 October 2014 (UTC)
:Ooooooh, nice catch. I've actually never noticed that before, and it's definitely not intentional. It happens because the text of the explanation page is folded into the main page before mediawiki parses links and syntax, and the "Edit this page" button links to the page that the link is on. I have an idea for how to fix it though, so I'll get on that. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 01:49, 25 October 2014 (UTC)

== #1454 - bad description ==

"Curly-hair states longingly..." She comes across as disappointed (or even heartbroken), not "longing", which suggests sounding somewhat positive and energetic, rather than deflated. [[Special:Contributions/141.101.99.88|141.101.99.88]] 22:29, 2 December 2014 (UTC)

==Cueball/Rob merge==

It seems to me from a general reading of the comics that Randall has always intended for the character we here call "Cueball" to have the name "Rob". Much as "Cutie" was renamed "Megan" when we learned her name, and now she is identified as "Megan" even in comics where her name is not explicitly mentioned, I think we should consider merging the "Cueball" and "Rob" articles. I know there's a lot of inertia here, but it seems to me that this is Randall's intention for the character's name. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 13:38, 10 March 2015 (UTC)
: Alternatively, we should un-merge [[Megan]] and [[Cutie]] for consistency. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 14:50, 10 March 2015 (UTC)
: I'm pretty sure this is an augmentation of the author's internal characters, including the one he has developed involuntarily as to the nature of his love. His memory of his love is not his love, yet it is what he has to love. Randall seems the type to delve into this, and thus I am in support of keeping the character names as they stand. /eof [[Special:Contributions/173.245.56.185|173.245.56.185]] 05:43, 25 March 2015 (UTC)

== Kerbal Space Program ==

I'm a schizophrenic who's been playing Kerbal Space Program for about five days with no sleep, and I'm pretty sure this is a reference to [https://www.google.com/search?q=xkcd+kerbal+space+program&oq=xkcd+kerbal+space+program&aqs=chrome..69i57.10851j0j7&sourceid=chrome&es_sm=122&ie=UTF-8 comic 1365] :D [[Special:Contributions/173.245.56.185|173.245.56.185]] 05:39, 25 March 2015 (UTC)

== 1509 is missing ==

When will it be added? By bot, I presume.--[[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 04:51, 8 April 2015 (UTC)

== Broken Date Box on comics ==

The "Comic #1511 (April 13, 2015)" textbox that appears on top of each comic breaks if you shrink the screen. I think the space after the comma needs to be replaced with a non breaking space.{{unsigned ip|108.162.238.144}}

:Is it fixed now? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 20:59, 13 April 2015 (UTC)

::It looks like it. I had pointed it out once before and it was fixed. I guess somebody reverted that change or something... --[[Special:Contributions/173.245.56.202|173.245.56.202]] 13:42, 15 April 2015 (UTC)

== 1515? ==

Is it correct that we have 1515 comics, as of April 15, 2015? --[[Special:Contributions/173.245.48.122|173.245.48.122]] 05:20, 15 April 2015 (UTC)
:It's not, but some people insist on making comic pages for things that aren't comics. I'll fix that. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:27, 15 April 2015 (UTC)

== 972 is broken ==

Look, I'm not going to make an account here or anything, but I just wanted to point out that trying to access the page for comic #972 leads to a database error, and maybe someone should check on that. [[Special:Contributions/173.245.48.102|173.245.48.102]] 07:45, 14 July 2015 (UTC)

Actually a lot of other pages lead to that same error as well... Even the 'Technical Diskussions' sub-page is broken. Seems to my, like some swap-spac needs cleaning up? [[Special:Contributions/108.162.230.83|108.162.230.83]] 10:32, 14 July 2015 (UTC)
:Yep. It's a symptom of another problem, but the errors should be cleared up now. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 16:31, 14 July 2015 (UTC)
::No dice. [[997]] is still broken. --[[Special:Contributions/198.41.235.119|198.41.235.119]] 00:27, 3 August 2015 (UTC)

:::Looks like they're working now. 21:01, 2016-11-27 {{unsigned ip|141.101.98.163}}

== #1567 ==

I think the current explanation is missing the connection, and the parody of, many "As Seen On TV" commercials selling kitchen products. Many of these commercials show people trying to use common kitchen equipment (pots, pans, can openers, etc) in a way that no normally functioning human would do it (for example, one has a lady draining the liquid from a pot of food into a sink in an extremely awkward manner — one that no normal person who has ever seen a kitchen would do — but then the lid flies one way, food goes another, there's a huge mess, etc; another commercial has someone trying to open a can of food using a can opener '''backwards''', with the woman looking extremely confused looking on how the can opener is supposed to be used or attached to the can [if you told someone act like they are a clueless monkey trying to use a can opener for the first time, that's basically what the commercial had the woman doing — no joke]). These commercials often begin with phrases such as "If you are like me" or "If you are like most home makers" or some other closely related "If you are like..." phrase (thus this comic is directly tieing itself to these commercials using this catch phrase). [[Special:Contributions/108.162.220.11|108.162.220.11]] 07:50, 21 August 2015 (UTC)
:: Other opening catch phrases for these commercials include the "Tired of [fill-in made-up frustration]" and the "Do you [fill-in made-up frustration]" kind. [[Special:Contributions/108.162.220.11|108.162.220.11]] 08:09, 21 August 2015 (UTC)

== "I used Google news BEFORE it was clickbait" ==

Go to a handful of older pages on this wiki, and it won't be long before you see this phrase in the comments - [[941: Depth Perception]], for instance has two of them. Does anyone know why this happens? [[Special:Contributions/108.162.221.116|108.162.221.116]] 10:59, 23 August 2015 (UTC)
:That's the signature of a person who used to post here. If you click through, it actually goes to a userpage. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 14:25, 23 August 2015 (UTC)

== URL ==

I notice that whenever you add "explain" to an xkcd url, it takes you here! neat! [[Special:Contributions/198.41.235.233|198.41.235.233]] 23:13, 28 August 2015 (UTC)
:Someone noticed! Finally! '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 04:45, 29 August 2015 (UTC)

== Should we really be using CC-BY-SA? ==

Don't get me wrong, CC-BY-SA is my favorite creative commons license. The problem is, are we really allowed? The reason I'm worried is that I'm not sure if what we are doing really counts as "fair use" with respect to XKCD. It would probably be better to do CC-NC-BY-SA, to respect XKCD, or at least put a note that CC-BY-SA only covers the wiki portion (since it's probably too late to do CC-BY-SA anyway).
[[Special:Contributions/173.245.54.37|173.245.54.37]] 23:38, 27 January 2016 (UTC)
:This is a tough one. Mediawiki sites generally use CC-BY-SA, even if the content they're based off is copyrighted (Wikia sites for various topics do this). The license only does apply to content ''created'' here. What should probably be done, if it isn't already, is some specification on pages in the <code>File:</code> namespace indicating that they are owned by someone other than the owners of this site. [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 19:37, 7 April 2016 (UTC)

== #1663: Garden not yet added? ==

For me it's 4:30 AM, 4/4/16 - I have a sleep schedule just like [https://xkcd.com/361/], so I've been first on quite a few xkcd explanations immediately. when they came out.
I notice that usually, immediately once a new xkcd comic is released, a bot generates a corresponding bare-bones page on this wiki. However, this new comic "1663: Garden" doesn't yet have an automatically-generated page. Maybe it's because of the strange user-session hash key that appears in the URL bar when the "comic" is interacted with? Maybe this sort of interactive thing messes with the bot?
Am I just being impatient? Do I have to wait a few minutes? (I'm going to bed, and this probably won't be seen until tomorrow, but I am at least interested in knowing how the bot system works.) [[Special:Contributions/173.245.54.21|173.245.54.21]] 09:01, 4 April 2016 (UTC)

== Skins broken ==

It seems both the Classic and Monobook skins are very very broken. Only Vector seems to be laid out normally. [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 19:39, 7 April 2016 (UTC)
: Yes, for me too. Let me see what can be done. [[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 20:10, 12 April 2016 (UTC)
::All calls to /load.php seem to fail, which results in the broken look. --[[Special:Contributions/162.158.86.167|162.158.86.167]] 11:02, 14 April 2016 (UTC)
:::Oh wow, I thought I was the only one. [[User:SuperSupermario24|Just some random derp]] 15:57, 8 May 2016 (UTC)
::::Should be fixed now. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 18:59, 17 May 2016 (UTC)

== #1682: Not sure about the reference for Russian meaning for Bun ==
''Also interesting to note is that in several Slavic languages (including Russian, Czech and Polish), the word for Rabbit literally means Little King''

I'm a native Russian speaker, and i've never heard of Rabbit being used for ''Little King''...

* Rabbit: ''krolik'' (кролик)
* Little King: ''korolyok'' (королёк)

Not sure if this above statement is correct for Russian language. {{unsigned ip|162.158.255.28}}
:This is the main page. You probably want to put this in [[Talk:1682: Bun]]'''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 16:36, 20 May 2016 (UTC)

== Random Button ==
The actual xkcd site has one and adding one would make it closer to the actual site and make discovering random comics and their explanations easier. It could go next to the comic # button.[[Special:Contributions/173.245.52.69|173.245.52.69]] 01:03, 5 June 2016 (UTC)
:There is a random page button on the left. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 02:36, 5 June 2016 (UTC)
::Oh. Didn't see that. Sorry.[[Special:Contributions/173.245.52.69|173.245.52.69]] 20:16, 5 June 2016 (UTC)

== XKCD Alignment Chart ==

A while back, I was searching for an XKCD alignment chart, with no success, so I made one. It is not perfect, so I'm wondering what other opinions on the alignment of the characters are.

Lawful Good- Beret

Neutral Good- Ponytail

Chaotic Good- Mrs. Roberts

Lawful Neutral-Cueball

Neutral Neutral- Megan

Chaotic Neutral- White hat

Lawful Evil- Hairy

Neutral Evil- Danish

Chaotic Evil- Black Hat

--[[User:Fallencrow305|Fallencrow305]] ([[User talk:Fallencrow305|talk]]) 22:10, 28 July 2016 (UTC)

:What about Help I'm trapped in a drivers license factory Elaine Roberts? --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 15:48, 29 September 2016 (UTC)
::Or Hairbun? Or Science Girl? Here are my predictions: Elaine - Chaotic Good, Hairbun - Lawful Good, Science Girl - Lawful Neutral --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 16:00, 29 September 2016 (UTC)

What? How can Beret Guy be anything other than chaotic?

== 1713 cc also means carbon copy. So 50 carbon copies of either of those words could be called for. ==

1713 cc also means carbon copy. So 50 carbon copies of either of those words could be called for. {{unsigned ip|108.162.215.146}}
:Sorry, but [[User:108.162.215.146|108.162.215.146]], you need to remember to sign your work. --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 11:50, 26 September 2016 (UTC)

== Chatroom Idea... What do you guys think? ==
I have an idea. What if there was a discussion board for the wiki? (And no, I don't mean boards like this or the "comment section" of comic explanations. I mean a live chatroom plugin of sorts. We could add it to the website and enable it so we can talk to each other in real-time and make live edits with each other. This way, we can also let each other know of edits we've made, make new pages altogether, or just talk. What do you guys think? -- [[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 9:10, 13 September 2016
:The [http://www.explainxkcd.com/wiki/index.php/Special:RecentChanges recent changes] log already notifies all users on the site of new pages and edits. User talk pages and the community portals exist for coordination. Also, avoid creating new comment topics in the middle of a talk page in the future, comments are supposed to follow a chronological order. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 15:39, 13 September 2016 (UTC)
::Sorry. --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 13:59, 26 September 2016 (UTC)

== Copying versus embedding ==

Hi, I'm new here and I'm trying not to be an asshole. However, I just noticed that this site uses its own archive of copied xkcd comics, rather than using the image URL provided for hotlinking and embedding. I can understand this website will want to have its own archive in case xkcd.org ever goes offline, but until then, why not just embed the images instead of copying?

The reason I'm asking: I just realised I hardly ever go to xkcd.org anymore ever since my browser put explainxkcd above xkcd.org. Explanations get updated, so sometimes I check back later, which rarely happens with the comics. It makes perfect sense. But if more people experience this issue, xkcd.org is getting fewer unique visitors because of it, and this could be fixed by fetching the image directly from there, while still making and storing a copy in case it is needed in the future. Thoughts, anyone? [[Special:Contributions/141.101.104.33|141.101.104.33]] 17:08, 18 October 2016 (UTC)
:So, we can't do this for every comic, like [[1190]] or other april fools comics. Also, xkcd's revenue comes from merchandise sales, not ad revenue, so I believe it's not actually negatively impacting them that we're serving the images ourselves rather than making the main site serve them for us. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 05:39, 19 October 2016 (UTC)

:Embedding images is generally known as "stealing bandwidth", since it uses resources of the original site's server (may be limited) without bringing it any actual visitors (they won't see anything else of the website, like announcements, shop, other sections, ...). Also, depending on how unique visitors are counted, "visitors" through embedding might be invisible (client's side scripts won't be loaded). So no image embedding without the original site's owner express permission. [[Special:Contributions/141.101.88.106|141.101.88.106]] 12:51, 7 February 2017 (UTC)

== Other Languages ==
Are there translations of pages anywhere. It has been mentioned that they are on subdomains of this site, or a sub-page, as Main_Page/es for spanish. I can't seem to find them there. [[User:The Muffin Man|The Muffin Man]] ([[User talk:The Muffin Man|talk]]) 14:48, 7 February 2017 (UTC)
:It's a work in progress, long delayed but I really do want to get to it eventually. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 18:58, 7 February 2017 (UTC)

== Why are there male/female symbols in some of the entries? ==

Those symbols are not in the comic, but they're in the table. I think a vandal put them there. Can someone remove them from the Lavaball, Bladeball, Eggspotting, Merfishing, Consequence Golf and Heck Escape? (now don't act like someone who criticizes "politically correct leftist "libt++d" SJW snowflakes" just because I said "heck" or censored the derogatory term for "liberal" or not even trying to say these uncensored) -- [[Special:Contributions/108.162.221.106|108.162.221.106]] 12:36, 25 November 2017 (UTC)

== How quaint ==

From the Main Page:

Explain xkcd: '''It's 'cause you're dumb.'''

From the Rules section:

'''Don't be a jerk. '''

(Emphasis mine)

How very ,very quaint. --[[Special:Contributions/162.158.126.100|162.158.126.100]] 21:00, 5 December 2017 (UTC)

== HTTPS? ==

Hi,
With the general trend towards HTTPS being favoured over HTTP for security and speed reasons, would it be possible to force the use of HTTPS and secure the mixed content please?

Please see [https://www.whynopadlock.com/results/7e707bfd-cd71-4b00-b95e-be226fb10fb6 Why no Padlock?] for more details.

Thanks,
[[Special:Contributions/162.158.179.202|162.158.179.202]] 10:32, 13 January 2018 (UTC)

:Browsing using HTTPS seems to just work. There's even a signed certificate.
:https://www.explainxkcd.com/wiki/index.php/1946

:I really don't get why people are so convinced that browsing using HTTPS is so much more "secure". You even seem to claim that it's faster?
:If you love it so much, install a browser extension like https://www.eff.org/https-everywhere.

:With the exception of the login / register page, I really don't see the point for enforcing this for the whole site. I am no admin though.
[[Special:Contributions/172.69.54.93|172.69.54.93]] 22:30, 25 January 2018 (UTC)

We are already in 2018 and this website still does not even redirect automatically to HTTPS ([https://support.cloudflare.com/hc/en-us/articles/200170536-How-do-I-redirect-all-visitors-to-HTTPS-SSL- you can do it so easily with Couldflare...]) nor enforce HTTPS with {{w|HSTS}}... I don't know, just check [https://scotthelme.co.uk/hardening-your-http-response-headers/#strict-transport-security on Scott Helme's site] why it's important. Having to rely on the user installing an extension for doing the sysadmin work is a bad joke, really. And it does not fix some issues with mixed content of course. With Let's Encrypt and Cloudflare providing certificates for free and the plethora of tutorials online on securing a website (not limited to HTTPS), there is no excuse to not do it. -- [[User:guest|guest]] ([[User talk:guest|talk]]) 11:22, 31 January 2018 (UTC)

== "It's because you're dumb" ==
I see that there was some talk about this a while ago, in which people seemed to agree that the "It's because you're dumb" tagline is unnecessarily mean and should be changed... and yet, it's still here. I'd like to add some more fuel to the fire with several reasons why I really hate this tagline:

* The tagline doesn't fit the tone of XKCD. Randall celebrates knowledge. Even Black Hat wouldn't just outright say "You're dumb", because he's a classhole who can insult way better than that.
* Many of the people who contribute to this wiki are very smart. They're not dumb.
* They're also quite amicable from what I've seen. If they wouldn't insult someone, why is the website doing so?
* Not knowing something is not the same as being dumb. Even the smartest people don't know everything.
* Having a desire to learn is smart, not dumb.
* The tagline's logic is flawed. Just because you learn a new thing, doesn't mean you were dumb to begin with.

Anyone with me on this?

[[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 14:07, 20 February 2018 (UTC)

: The first line of the "Rules" section is "Don't be a jerk" at the time of writing. The first thing this wobsite does is to break that rule. I'm not sure what else is to be said here. --[[Special:Contributions/162.158.126.76|162.158.126.76]] 16:55, 20 March 2018 (UTC)

:I always thought that was weird too. But it's still there... I'll tell the admins about it, and hopefully it will be changed. [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 13:18, 18 April 2018 (UTC)

Explanation: ''This'' is a joke... Missing the punchline? --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 15:15, 18 April 2018 (UTC)

Personally, I'm fine with the current tagline. I consider it a joke and don't feel offended. However, if there is consensus a) that and b) to what it should be changed, I'm ok with changing it. --[[User:SlashMe|SlashMe]] ([[User talk:SlashMe|talk]]) 16:18, 18 April 2018 (UTC)

I'm wondering, would it be possible to temporarily (a week or so?) stop new ads from appearing in the sidebar and replace it with a poll concerning this issue? Right now it's just showing what appeared in the banners in [[1965: Background Apps]], and not a real ad. [[Special:Contributions/162.158.58.81|162.158.58.81]] 10:12, 19 April 2018 (UTC)
:The advertisement is used to pay the fees needed to run this site. Right now this wiki get's an upgrade but when it's done this discussion will get a proper placement here. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 13:37, 21 April 2018 (UTC)

The first time I encountered this tagline I thought it was pretty funny. Satire can be hard to detect online but this one seems clear enough. --[[User:DKMell|DKMell]] ([[User talk:DKMell|talk]]) 20:42, 20 August 2018 (UTC)
:What is it satirizing? I'm serious; I genuinely don't know. It could well be that I just don't get the joke. [[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 13:39, 10 January 2019 (UTC)

At first I liked the joke, but now it's either annoying or I ignore it. Personally I don't feel it needs to be changed, as it's in the satirical spirit of xkcd, but I wouldn't care too much. [[User:Nyx goddess|Nyx goddess]] ([[User talk:Nyx goddess|talk]]) 22:56, 5 December 2018 (UTC)

It's satire, if it gets removed that's exactly the kind of overzealous political correctness that MAGA chuds are talking about when they accuse us of being snowflakes, howabout let's not give them ammo. - 02:03, 22 December 2018 (UTC) {{unsigned ip|162.158.63.94}}
:As above: what it is satirizing? Also, for my part, it's not about political correctness at all; it's that the tagline doesn't match my personal positive image of XKCD, nor of this wiki, and it just feels unfitting to me, for all the reasons that I laid out. [[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 13:39, 10 January 2019 (UTC)

I'm in favor of a change. Let's drop the "dumb". Or at least modify it. I propose a "strikethrough" of dumb, then add any one of a list of possible words: confused, ignorant, curious, wondering, befuddled... (Oooh, could it randomly change each time the page is loaded? Code wizards, advance!) [[User:Imperpay|Imperpay]] ([[User talk:Imperpay|talk]]) 22:25, 24 January 2019 (UTC)
:A complete list of all synonyms of dumb, including dumb and all synonyms of those synonyms, according to thesaurus.com. One randomly loads each time you load the page via rng, or on a once a day system, like the incomplete page of the day. That would actually probably make it more mean on average, but more clearly a joke. Wouldn’t be impossible to code either.[[User:Netherin5|Netherin5]] ([[User talk:Netherin5|talk]]) 15:18, 21 February 2019 (UTC)

The reason I come to Explain XKCD is because I'm excited to see what other people have said about it. I agree with the above - it doesn't fit the spirit of xkcd's joy for knowledge and it really just isn't why people come here. Furthermore, it skirts demeaning people with disabilities. Please remove it. [[User:Jachra|Jachra]] ([[User talk:Jachra|talk]]) 07:43, 2 July 2019 (UTC)

I also agree with Hawthorn. This tagline always was very strange for me. No, this is nothing about political correctness. I don't mind being insulted, if there is a joke, or something ironical or satirical behind it. But there just isn't. It's just not funny at all.
A random selection on every page load from a long list of completely absurd reasons would be more the XKCDs way. You could even try to create one or more "''It's because ...''" explanations for every comic and randomly display one out of those. 2206: "''... you don't know how to type capital numbers.''", 2205: "''... you don't assume Pi is one.''", 2204: "''... you didn't give us a moon.''", 2203: "''... there wasn't a really big meteor impact for a while.''" and so on. Pretty straight forward. The more frequent visitors of XKCD would probably even get many of the references and remember the corresponding comic. --[[Special:Contributions/162.158.91.221|162.158.91.221]] 17:39, 24 September 2019 (UTC)
:I did recently raise the issue again on the [https://www.explainxkcd.com/wiki/index.php/explain_xkcd:Community_portal/Miscellaneous#Is_the_.22It.27s_.27cause_you.27re_dumb.22_tagline_a_relic_of_the_past.3F Community Portal], explaining my case in more detail, although it seems to have garnered little interest. [[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 12:13, 30 September 2019 (UTC)

What instead, then? It's poor form to suggest half a change; if not "it's cause you're dumb," what should the tagline be? [[Special:Contributions/173.245.52.85|173.245.52.85]] 16:37, 25 December 2019 (UTC)

== Editor FAQ ==
Eventually we may need that banner at the top for something else, like the incomplete explanation spotlight, or when the wiki was being upgraded, so I think we should add the Editor FAQ in the New Here? section. [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 11:21, 2 June 2018 (UTC)
:It's a first draft and I'm just waiting to be convinced that it's NOT incomplete. And be sure I haven't written it without a plan how to present it on the proper places. Furthermore this "Sitenotice" on the top is only "dissmissable" for valid users, every visitor not logged in does see this always. Thanks for your participation and I'm grateful about any help. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 16:30, 2 June 2018 (UTC)

== Categories on Main Page ==

[[MediaWiki:Common.css]] has the following entry:
<pre>
.page-Main_Page div#catlinks ul li {
border-left: none;
position: absolute;
left: 70px;
bottom: 6px;
}
</pre>
The <code>70px</code> cause an overlap for me in Firefox, and much too small a gap in Chrome. I suggest to actually remove that line completely, just compare it with categories on other pages: The gap is quite large. In Firefox, also the <code>6px</code> are too much, but in Chrome they are required. But it might be worth to try whether setting vertical align to something else can achieve a more consistent display. --[[Special:Contributions/162.158.88.230|162.158.88.230]] 10:22, 13 July 2018 (UTC)
:And the comment above that says: "Dirty hack to hide the categories of the current comic from main page. ...". I'm aware of this but there is much more, especially for a mobile version I'm looking forward to. Only in this case I see three problems: The component is rendered as a list (ul,li) by hiding the bullets. This then empty space is always rendered different in different browsers. Using "position: absolute" tries to circumvent this but absolute positioning is bad layout and never should be used. Furthermore mixing the units ''px'' and ''em'' in many places is also a problem when comparing it at different browsers. I'm working on this with the final goal also having a proper mobile version, not only for Firefox, Chrome, Edge,... on a desktop. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 12:12, 13 July 2018 (UTC)

== Bookmark ==

I think we should add this book mark I made to automatically transfer anything from xkcd to its explainxkcd page (I was frustrated, ok?):

javascript:x=window.location.href;x = x.replace(/\D/g,'');t=document.title.substring(5).replace(/ /g,"_");window.location.href="https://www.explainxkcd.com/wiki/index.php/"+x+":"+t;

I know the code could be more compact, but using this, you can just press a button and it will take you to the explain page {{unsigned ip|172.68.47.84}}
:Just changing the URL from <code>xkcd.com/2115/</code> to <code>explainxkcd.com/2115/</code> (putting the word explain to the beginning) does the same. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 16:41, 22 February 2019 (UTC)

== Non-comic explanations? ==

So I was looking at xkcd and I noticed a little jokey line near the bottom of the page in very small print that reads <pre> <nowiki> "xkcd.com is best viewed with Netscape Navigator 4.0 or below on a Pentium 3±1 emulated in Javascript on an Apple IIGS at a screen resolution of 1024x1. Please enable your ad blockers, disable high-heat drying, and remove your device from Airplane Mode and set it to Boat Mode. For security reasons, please leave caps lock on while browsing." </nowiki> </pre>
Now, I know enough to understand the joke, but it would be nice to have a page for this. Do we have one? Am I just blind? Either way, I would like to know. Thanks! [[User:Nyx goddess|Nyx goddess]] ([[User talk:Nyx goddess|talk]]) 23:39, 28 March 2019 (UTC)
:Nevermind, I just found it. Sorry! [[User:Nyx goddess|Nyx goddess]] ([[User talk:Nyx goddess|talk]]) 23:40, 28 March 2019 (UTC)

== Latest comic released. ==

I don't know where to post this, but the bots haven't created the page yet.
[[User:HelloWorld|HelloWorld]] ([[User talk:HelloWorld|talk]]) 19:24, 4 April 2020 (UTC)

: Probably infected by COVID-19. That's why you should wash your keyboards after visiting other websites. Until then, feel free to create the page manually (if possible). --[[Special:Contributions/108.162.242.19|108.162.242.19]] 21:07, 4 April 2020 (UTC)

Talk:Main Page

2020-04-04T21:07:13Z

108.162.242.19: /* Latest comic released. */

{{notice|This page is for discussion of the [[Main Page]] itself. Other issues probably belong at the [[Explain XKCD:Community portal]].}}

As a new user, I think the first page is very important. So I thought why not begin a discussion here what to have on the first page every user visits.--[[User:Relic|Relic]] ([[User talk:Relic|talk]]) 05:59, 1 August 2012 (EDT) Re-signed here - b/c I broke the comment in two when I added the "List of comics" header. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 23:01, 2 August 2012 (EDT)

==List of comics==
I was thinking of having a quick link to the list of comics that is explained. Right know, it took me a while to even see any of them. Eventually I found the "List All Pages" (found it in Special pages) where I could find the comics that have been explained. What do you think?
:A category tag will do that for you automatically. Having a list of comics indexed by its number would be a little different.--[[User:Relic|Relic]] ([[User talk:Relic|talk]]) 05:59, 1 August 2012 (EDT)
::Sounds like a great list - I ''think'' it'd have to be manually maintained until/unless we get someone who knows how to make a bot update it. Categories will be useful, but they only work if someone added the category to the page in the first place. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 07:21, 1 August 2012 (EDT)
:::A (somewhat) related question - should [[:Category:Comics]] be sorted alphabetically or by comic number? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 07:43, 1 August 2012 (EDT)
::::I think [[:Category:Comics]] should be sorted by comic number. If you are looking for a specific comic, you will use the search field. Is there a way to make that happen? --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 08:11, 1 August 2012 (EDT)
:::::They are two different functions. For the former, instead of adding <nowiki>[[Category:Comics]]</nowiki>, add, say, <nowiki>[[Category:Comics|1]]</nowiki>. For the second, we can create redirects. Normally, I'd say just make sure the search term was in the article text, but since numbers are going to be use for other purposes than just comic titles, it may be better to create [[1]] and [[Comic 1]] as redirects to the relevant articles right off the bat. --08:24, 1 August 2012 (EDT)
::::::We could also have a comic-list template on the Main Page, I suppose, or perhaps two - one for number and one for name? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:54, 1 August 2012 (EDT)
:::::::Here's what I was thinking of for that: {{tl|Comics navbox}} Thoughts? ''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]]
:(outdent) It's ugly, but a sortable wikitable [[User:SurturZ/sandbox|(click here for example)]] could be used as a checklist to see what has been uploaded and what hasn't. What's the project namespace here, anyway (analogue of "WP:")? --[[User:SurturZ|SurturZ]] ([[User talk:SurturZ|talk]]) 03:04, 3 August 2012 (EDT)
:OK, I've found a way to get all the titles of the comics, so I was confident enough to create <big>[[Explain XKCD:Checklist]]</big> which can be used to fill in the gaps. --[[User:SurturZ|SurturZ]] ([[User talk:SurturZ|talk]]) 03:41, 3 August 2012 (EDT)
::I'm liking the checklist! That should do quite nicely as a "tool for editors". (I'm linking to it at the Community Portal). We still need the "template for readers." Did you think {{tl|Comics navbox}} was on the right track or should we do something else for that? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 20:09, 3 August 2012 (EDT)
::Better idea - I'm throwing it directly onto the Main Page. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 20:10, 3 August 2012 (EDT)

==Admin list==
You can find a system-accurate list of admins [{{canonicalurl:Special:ListUsers|group=sysop}} here], so that might good to share, along with the manual list. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 07:13, 1 August 2012 (EDT)
:Added to page. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:10, 1 August 2012 (EDT)
::That's exactly what I wanted, but couldn't find the auto page for it. I knew it was somewhere. I don't see any reason to keep the link to the manual page. Do you? --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 08:11, 1 August 2012 (EDT)
:::Not unless you want it. I'll remove it. Should I add the similar link for 'crats or is that unnecessary at this point? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:25, 1 August 2012 (EDT)
::::To be honest, I have no idea what the Burecrats role does. Might be unnecessary now but helpful in the future? --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 11:16, 1 August 2012 (EDT)
:::::Bureaucrats can turn other users into administrators (or indeed, other bureaucrats). That privilege isn't available to ordinary administrators. I'd keep it to yourself for the time being. :-) --[[User:Yirba|Yirba]] ([[User talk:Yirba|talk]]) 17:39, 1 August 2012 (EDT)
::::::You can actually see a technical list of which rights each group confers at [[Special:ListGroupRights]]. As the wiki grows, you might want to spin off a few, such as the ability to grant rollbacker and autopatrolled, to admins as some other wikis have. But for the time being, at least, there's really no reason for the wiki to have more than one 'crat. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 17:07, 2 August 2012 (EDT)

== Community portal ==

I've created the [[Explain XKCD:Community portal]] as a tools/help page. If that's not what you want, feel free to change/move/whatever it, but I thought it'd be nice to save this page for discussion of the Main Page and discuss the wiki as a whole/ask for help there. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:36, 1 August 2012 (EDT)

== Direct link to latest comic ==

There should be a direct link to the latest comic at the top of the Main page. A nice thing about going to explainxkcd.com was that the latest comic is right there at the top. For those changing their default link to the wiki, there should be an easy "Latest Comic" link that quickly takes them there. I'm sure some folks actually skip xkcd.com and come directly here instead to read the latest offering from Randall. They shouldn't have to search for it.
[[User:Christopher Foxx|- CFoxx]] ([[User talk:Christopher Foxx|talk]]) 11:59, 1 August 2012 (EDT)

: Maybe the page [[latest]] should redirect to the most recent comic? Could that be taken care of by some sort of script/template so it doesn't have to be manually updated? Should each explination page also have "next", "previous", "random", "first" and "latest" links, possibly also generated automatically via scripts/templates? Additionally, shouldn't the number page be the canonical one? It seems like [[Internal monologue]] should redirect to [[1089]] rather than the other way around - certainly it would make a bunch of scripting types of things a lot easier. [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:02, 1 August 2012 (EDT)
:::If you wanted, we could even use wiki-magic to show the title of the page as the Comic name, but the URL as the number - in order to parallel the actual XKCD website. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 17:09, 2 August 2012 (EDT)
:: Shouldn't there be a way to programmatically find the comic with the highest number that has a page with content? That would work as long as no one puts future comic pages up. --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 20:25, 1 August 2012 (EDT)
:::It's all sounding like folks are over-complicating something quite easy. All I'm suggesting is a prominent link to http://www.xkcd.com/. No need, I think, to list which number the latest is, or include the next/last/random buttons, etc. [[User:Christopher Foxx|- CFoxx]] ([[User talk:Christopher Foxx|talk]]) 11:41, 3 August 2012 (EDT)
::::Oh. We've got that, now, in the sidebar - labeled as "XKCD." I do think that having an internal link to the latest (explained) comic would be a great thing, though. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 16:36, 4 August 2012 (EDT)

You can transclude the latest comic on the main page like this: <nowiki>{{:pagename}} e.g. {{:Internal_monologue}} </nowiki>--[[User:SurturZ|SurturZ]] ([[User talk:SurturZ|talk]]) 00:25, 2 August 2012 (EDT)
: I've started with just a manual link to the latest comic. Ideally it will be automatic, but a manual link will work for now as I've had quite a few people ask for it. --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 21:09, 1 August 2012 (EDT)

Transclusion of the latest comic is great. Someone with the right permissions should add (for instance on the top-right corner of the grey transclusion area) a link to edit the corresponding wiki page, so that people seeing something they could add would feel invited to do so (wiki style). In my opinion this would be a good way to improve the quality of the user-generated explanations.
Also, all the "XKCD"s in the "New here?" section should be converted to the lowercase "xkcd"...
[[User:Cos|Cos]] ([[User talk:Cos|talk]]) 14:00, 6 August 2012 (UTC)
:Good points. I've done both. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 15:48, 6 August 2012 (UTC)

Call me dumb, but... You've got a link called "prev" that goes to the explaination for the previous comic. Then a link called "comic #42" but that goes to xkcd. And then a smaller, less prominent link called "go to this comic" that doesn't go to the comic but to its explaination. Anyone else think that's a little back-to-front? [[User:Zootle|Zootle]] ([[User talk:Zootle|talk]]) 17:18, 31 August 2012 (UTC)
:OK, you're dumb :-). The standard template for an explanation page includes the header with "Prev", "Comic # (date)", and "Next" links. If we don't have explanation pages for the previous or next comic, we don't show the respective link. I hadn't noticed that the "Comic # (date)" bit was a link to the xkcd site before, but in context it makes sense to me. Including a link to the Explain page for the comic who's explain page you are already looking at doesn't make sense.
:The explanation page for the latest comic is "transcluded" in the main page pretty much as-is, so we get the header, the comic, the explanation, etc. We don't get the discussion, which is visible at the bottom of the Explain page. Because there is never an explanation for a comic that hasn't been released yet, there is never a "Next" link on the main page's transcluded header. So you get "Prev" and "Comic" links. The "Go to this comic" link is added by the main page above the transcluded explain page.
:I can see how the "Go to this comic" link might be poorly worded especially as it's placement seems to be within the explanation it's linking to. [[User:Blaisepascal|Blaisepascal]] ([[User talk:Blaisepascal|talk]]) 18:16, 31 August 2012 (UTC)
::Rather than "Go to this comic" maybe it could be "Go to full explanation" ? Something else? [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:38, 5 September 2012 (UTC)
::There was [http://www.explainxkcd.com/wiki/index.php?title=explain_xkcd:Community_portal/Admin_requests#.22Edit_this_explanation.22_link_on_main_page a discussion at one point] about a wittier/more descriptive link - but no one came up with anything. I do like "Go to Full Explanation" better, for what it's worth. --[[User:DanB|DanB]] ([[User talk:DanB|talk]]) 15:31, 5 September 2012 (UTC)
:::My problem with that suggestion is that it implies that the main page explanation is not full. As of right now, the full explanation is transcluded on the main page. There's nothing more to see by clicking that link (explanation wise) Perhaps "Go to full explanation page" but that doesn't quite sound right to me... [[User:TheHYPO|TheHYPO]] ([[User talk:TheHYPO|talk]]) 15:42, 7 September 2012 (UTC)
::::How about "Go to this Comic Explanation Page"? One nice thing about the specific page rather than the [[Main_Page]] transcoding is that it nicely includes the discussion as well. I have a bookmark to the [[Main_Page]] that I look at every day, but I want to easily read the discussions, not only the explanation. Humm, maybe we could have a page [[most recent comic]] that automagically redirects to the most recent comic? [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 12:42, 8 September 2012 (UTC)
:::::I tried to get [[most recent comic]] to redirect to LATESTCOMIC, but can't get the syntax working - it is possible? [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:03, 8 September 2012 (UTC)
::::::Apparently it isn't. I would have tried <code><nowiki>#REDIRECT [[{{LATESTCOMIC}}]]</nowiki></code> like you did, but since that doesn't work, I'll delete the page for now. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 16:38, 20 November 2012 (UTC)

== Discussion of latest comic ==
Perhaps include the discussions of the latest comic here? I almost missed there was a discussion field a few times because I would only read about the latest comic on the main page. [[User:Carewolf|Carewolf]] ([[User talk:Carewolf|talk]]) 14:54, 22 September 2012 (UTC)

This comics's explanation is complete bollocks, I think. Of course it is NOT a "fact that such a room exists". This comics parodies trope often used in cop movies - an elderly cop goes to work for the last time before his retirement, packs things, plans fishing the next day ... only to be called to one more case (possibly with a new, young and brash partner). And despites his efforts not to screw anything and stay clear of danger, he is either mortally wounded or screws big time and is degraded. So much clichè, that if someone says "It's my last day or service", you might be sure one of the two options above happens. See http://tvtropes.org/pmwiki/pmwiki.php/Main/Retirony [[User:edheldil|Edheldil]] 10:17, 26 September 2012 (UTC)

I believe this link maybe relevant: http://en.wikipedia.org/wiki/Turtle_graphics {{unsigned|Rhudi}}

I went ahead and filled out the bracket from today's (see edit date) comic: http://m.imgur.com/gallery/WyPkHx2 {{unsigned|Glaucon81}}

*rise

Btw, why wouldn't I just enter "ipconfig free" if I didn't want my IP address showing? {{unsigned ip|172.68.65.48}}

== The comic explanation count is wrong ==

The adjustment is currently 3, but there are now 6 subcategories and one list making the current correct adjustment 7.
If the wiki was upgraded to version 1.20, a form exists to automatically exclude subcategories.
--[[User:Divad27182|Divad27182]] ([[User talk:Divad27182|talk]]) 09:56, 8 October 2012 (UTC)

:Looks like another week of the wiki going down then.
:But seriously, I've been noticing this too. Didn't know what was causing it, but it's going to have to be fixed sometime.[[User:Davidy22|Davidy22]] ([[User talk:Davidy22|talk]]) 10:25, 8 October 2012 (UTC)

::The text reads <pre><nowiki>We already have [[:Category:Comics|'''{{#expr:{{PAGESINCAT:Comics}}-3}}''' comic explanations]]!</nowiki></pre> The -3 is to account for the subcategories and non-explanation pages in the category. There apparently used to be three such pages, and now there are seven. I would fix this myself, but the page is protected. If the wiki where upgraded to version 1.20, the categories could be explicitly excluded, but the [[List of all comics]] would still be in the category. (Note that the -3 actually appears twice.) --[[User:Divad27182|Divad27182]] ([[User talk:Divad27182|talk]]) 05:03, 11 October 2012 (UTC)

:::Mediawiki 1.20 fixes this issue, although it'd be nice if this could be fixed in the meantime via the hack reccommended by divad. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 06:40, 16 November 2012 (UTC)

:Looks like Waldir updated the "Comic Correction Count" to "10" (as of 20 November 2012):
<nowiki> We already have [[:Category:Comics|'''{{#expr:{{PAGESINCAT:Comics}}-10}}''' comic explanations]]!</big>
Note: the -10 in the calculation above is to discount subcategories (there are 7 of them as of 20 November 2012),
non-comic pages (2 as of same date: [[List of all comics]] and [[Exoplanet]])
and the comic 404, which was deliberately not posted. Thus 7 + 2 + 1 = 10
(But there are still {{#expr:{{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-10)}} to go. Come and [[List of all comics|add yours]]!)</nowiki>
:Could we possibly make this more dynamic by creating a "IGNORE_IN_COUNT" category or something? and then using something like: <nowiki>{#expr:{{PAGESINCAT:Comics}}-{{PAGESINCAT:IGNORE_IN_COUNT}}}</nowiki>? Then any additional entries to the "Comics" category (that are 'special' entries) could just have the special category added and no main page editing would be necessary? --[[User:Bpothier|B. P.]] ([[User talk:Bpothier|talk]]) 07:50, 22 November 2012 (UTC)

==Make Jeff stop apologizing==
The apology for server downtime has been around for a while now. Can we take it down? [[User:Davidy22|Davidy22]] ([[User talk:Davidy22|talk]]) 04:41, 11 October 2012 (UTC)

== Spambots ==

I think someone should install [http://www.mediawiki.org/wiki/Extension:AbuseFilter AbuseFilter]. --[[User:Kronf|Kronf]] ([[User talk:Kronf|talk]]) 10:09, 13 October 2012 (UTC)

== Purge ==

We should regularly purge the server's cache for the main page using http://www.explainxkcd.com/wiki/index.php?title=Main_Page&action=purge to keep the explanation up to date. --[[User:Kronf|Kronf]] ([[User talk:Kronf|talk]]) 02:28, 3 November 2012 (UTC)

== Updating the Rules ==

I've been having a lovely discussion with someone who apparently thought the "edit anything you want" rule applied to the Talk pages. As we don't have any codified rules for ''here'' and can only point to "well the canonical way this is done on Wikipedia is..." I think that there are a few things we need to put into the list of Rules on the front page, and then have a link to a more in-depth talk about why the rules exist and what-not.

Specifically, I'm talking about writing "Feel free to edit any page on the wiki to be better. But, treat talk pages like you would blog comments: comments by other people ''cannot be changed by you'', you can only respond to them." as a new rule to be plastered on the front page, as there seems to be an increasing number social neophytes that seem to think that editing words that are attributed as being said by another person is perfectly legitimate and non-controversial.

Shall we discuss? [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 01:25, 15 November 2012 (UTC)

:We could add the etiquette rules as an addendum to the signature reminder at the top of the page. Just an extra note below the alert box asking people to not edit other people's comments. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 06:40, 16 November 2012 (UTC)

::It really should be right down with the "edited mercilessly" description, because this is an exception to that statement. Shouldn't have two sets of contradictory instructions in different places. When I made my improper edit, I had a semi-conscious moment of doubt about whether changing the other guy's comment was ok, even though this is a wiki (and even though it wasn't really clear to me that this "discussion" box held something totally separate from the page content), but that statement at the bottom put all such doubts to rest. I read it multiple times to be sure. But I did not notice that line at the top about the four tildes until ''much'' later. It's somewhat lost, visually, in the header line, when you're not looking directly at it.[[Special:Contributions/50.0.38.245|50.0.38.245]] 18:32, 18 November 2012 (UTC)

:::There's discussion to replace that message with a more noticeable alert box. The message at the bottom of the page appears for all pages, including talk pages, so a talk-page specific message there would not entirely fit. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 00:18, 19 November 2012 (UTC)

::::If that text at the bottom is in fact alterable, it should be written to take every case into account. It's an extremely poor user interface that has instructions appearing on a page stating rules that are the exact opposite of reality. And note that the altert box on the top looks a lot like a banner add, when you don't focus on it and read it. People will tend to habitually filter out anything written there from their perception. Also, it can easily be scrolled off the top of the screen when the discussion starts to get long, and they have a preview displayed.
::::So I think after the "...then do not submit it here.", it should add, "'''Exception''': others' comments in Discussion pages are not to be altered. See full rules at <<link to appropriate wikipedia page>>."[[Special:Contributions/50.0.38.245|50.0.38.245]] 15:46, 28 November 2012 (UTC)

== Update after changes ==

The front page explanation hasn't been updated at all day to match changes in the explanation on the comic's page. This is a major problem i think, as it is the front page explanation people visitors will most often read. --[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 20:43, 26 November 2012 (UTC)
: It might be a caching issue. Appending <code>&action=purge</code> to the URL will probably fix it. Can you confirm it looks good to you now? --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 00:29, 27 November 2012 (UTC)
::Yep, now it updates instantly! Well done, whatever you did! :) --[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 16:24, 27 November 2012 (UTC)

:::I've also added a link underneath the comic box that has the action embedded, so no one has to do any manual URL hacking. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 17:38, 11 December 2012 (UTC)

::::Just wanted to check in on this - are there issues with automated systems or spammers following this link? I know it can affect performance - caching is important on a busy site! --[[User:Overand|Overand]] ([[User talk:Overand|talk]]) 22:37, 13 September 2013 (UTC)

== Suggestion: Change "Go to this comic" to "Go to this entry" ==

Just a small suggestion. For the Main Page, I suggest changing "Go to this comic" to say "Go to this ''entry''" instead to remove any confusion for new and regular viewers. It certainly took me a while to figure how to go to each featured comic's entry from the main page.

[[Special:Contributions/69.43.114.2|69.43.114.2]] 17:04, 11 December 2012 (UTC)

:How about if it reads "Go to this comic explanation"? Would that be less confusing? I only quibble because the explanations aren't really entries, in wiki parlance each page is usually called an article, but that doesn't seem to fit here as we really have explanation pages. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 17:41, 11 December 2012 (UTC)

::Agreed. [[User:Ctxppc|Randy Marsh]] ([[User talk:Ctxppc|talk]]) 22:55, 8 January 2013 (UTC)

== Explain the Unreleased Comic? ==
:I wonder if [[http://i56.tinypic.com/a9ton8.png this comic]] is permitted to be explained, despite the double issue of Randall pulling the comic plus me finding the pulled comic through "xkcd overrated"... [[User:Greyson|Greyson]] ([[User talk:Greyson|talk]]) 18:21, 12 December 2012 (UTC)

== Comic 1156 ==

I don't have an account to edit the page directly, so here's an edit someone should make:
It looks like whoever wrote the existing page simply googled 'conditioning' and found the first link that came up.
Please modify the link to point to 'Classical conditioning', not 'Operant conditioning'.
Thanks. {{unsigned ip|124.191.56.91|05:26, 7 January 2013‎ (UTC)}}

:Hi. This is the talk page for the main page of the wiki. This page only has a "view" of the actual comic explanation. The actual explanation page is at [[1156: Conditioning]], and I assure you, edit permissions have not been restricted for that page. Someone has already changed the page to link to Classical conditioning, but the original editor came back stating that Operant was correct. If you would like to start a discussion about this [[Talk:1156: Conditioning|on the talk page for this explanation]] that would be much more conducive to getting this matter settled. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 05:52, 7 January 2013 (UTC)

== Comic Links ==

Some of the links seem to be confusing, as they're titled in a weird way. The link/button 'go to this comic', I'd expect would go to the actual comic on XKCD's page. Yet it goes to the comic's wiki page. And clicking on the comic # and date directs you to the XKCD page, yet I really feel that link should go to the wiki page, as it's right at the top center there, and has the date and everything, sort of indicating that it's a wiki page, yet it's not. And the prev and next buttons next to it don't go to the xkcd page, they go to the wiki pages. Which is really messed up, I think. Because of my confusion, every single time I visit here, I clicked on the wrong link, though now I've gotten used to it. I suggest rewording the links as 'XKCD Comic # and date' and 'go to this comic's wiki page'. And possibly switching the links' positions so that the wiki links could be in that navigation bar and the XKCD links could be off to the side. After all, we are a wiki, so putting our wiki links to the comic off to the side and the direct xkcd link in the center seems odd. Anyway, has anyone had the same thoughts and/or agree with me on this?--[[Special:Contributions/69.119.250.251|69.119.250.251]] 18:19, 9 January 2013 (UTC)

== Unexplained comics ==

The template that starts each explanation page should be edited to have the next and previous buttons automatically skip over pages that don't exist, rather than simply not being there if comic n+1 or n-1 doesn't exist. Preferably it would append a notice to the next page (like the redirect notices commonly found on mediawiki) telling you how many comics have been skipped. I'm not sure how feasible this would be to script, however. [[Special:Contributions/130.160.145.185|130.160.145.185]] 23:45, 9 March 2013 (UTC)

== Percentage of remaining comics calculation is off... ==

Okay, I hate to be "that pedantic math guy", but... Today the main page reads "We have collaboratively explained 936 xkcd comics, and only 252 (27%) remain." While I agree that 252/936 is roughly 27%, I believe we should really be calculating the percentage as "the number left to explain" divided by "the total number of comics that exist", not divided by "the number we have finished". That is (today), 252/1188=21%. Think about it. If we had completed 594 comics today, with 594 remaining, what should the percentage be? 594/594=100%? That's not right... 594/1188=50%? That's what we really want to say.

The page is protected, which makes sense. So I'll make my suggestion here.

Change this:

<pre>
and only {{#expr:{{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)}}
({{#expr: ({{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)) / ({{PAGESINCAT:Comics}}-9) * 100 round 0}}%)
remain.
</pre>
To this:
<pre>
and only {{#expr:{{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)}}
({{#expr: ({{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)) / {{#expr:{{LATESTCOMIC}}}} * 100 round 0}}%)
remain.
</pre>
[[User:Imperpay|Imperpay]] ([[User talk:Imperpay|talk]]) 15:32, 20 March 2013 (UTC)

:Done and done. '''[[User:Davidy22|{{Color|purple|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 15:37, 20 March 2013 (UTC)

:Thanks for the heads-up! However, notice that the #expr: around LATESTCOMIC was unnecessary. I've removed it. [[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 11:30, 21 March 2013 (UTC)

::Waldir, you have exposed me as a charlatan and a fool! (I just copied, pasted, and tinkered until I made something that worked. I don't actually understand it. No formal training, you see. It's what we used to call "hacking" back in the dawn of the digital era, before the word took on connotations of vandalism, trespassing, and fraud. Have you kids come up with another word for it?) [[User:Imperpay|Imperpay]] ([[User talk:Imperpay|talk]]) 13:59, 22 March 2013 (UTC)

::: Joke's on me then, 'cause you sure fooled me – I readily assumed you knew your way around those parser functions. Nice job hacking the code, it was a nearly perfect crime ;) --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 03:26, 25 March 2013 (UTC)

:::I've heard the cool kids call that the "Maker Mentality", usually with a reference to [http://makezine.com/ Make magazine] and [http://makerfaire.com/ Maker Faire]. But I think there's also a movement to resurrect the original meaning of hacker. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 04:21, 25 March 2013 (UTC)

==sidebar ads?==
''Moved to [[explain xkcd:Community portal/Proposals]] –– [[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 08:06, 4 May 2013 (UTC)''

== Expression error on Main Page ==

Please use <code><nowiki>{{PAGESINCAT:...|R}}</nowiki></code> instead of <code><nowiki>{{PAGESINCAT:...}}</nowiki></code> to correct these errors :) --[[Special:Contributions/110.168.83.62|110.168.83.62]] 10:55, 8 April 2013 (UTC)
:Dun diddly done. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 11:21, 8 April 2013 (UTC)

== Compile a list of non-technical comics to non-technical readers? ==

I'm a long-time reader and fan of >< |< C |}, but my normal approach is useless when I introduce this provocative comic series to my less technical friends. They stay at the apparent level of many comics. They don't bother reading the explanations, but they would say, "it's hard to make sense". Imagine an average non-technical (and non-arts) major guy/girl, can we compile a list of state-of-the-art but less-technical, easy-to-comprehend but "ah ha!!" strips that is suitable for them? --[[User:FrenzY|W shll nvr flly xpln xkcd!]] ([[User talk:FrenzY|talk]]) 12:39, 18 May 2013 (UTC)
:Oh my god that signature.
:Gaah, derailment. Uh, pretty much anything that isn't tagged with the physics or math categories are easy enough to understand for the average English speaker, so just check the categories at the bottom of the page for that. Also, avoid comics with the incomplete tag, and that oughta be fine. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 14:41, 18 May 2013 (UTC)

== Quit building? ==
''This post was moved to [[Talk:1214: Geoguessr]].''

:Hello, this is the talk page for the content of the front page of the wiki, not for discussion of the most recent comic, that happens [[Talk:1214: Geoguessr|here]]. I've moved your post over there for you. Cheers, and welcome to explain xkcd! [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 05:09, 22 May 2013 (UTC)

== List of incomplete comics ==
We need a link to the "Incomplete articles" at the main page below the "Missing link". Most pages are created but many are incomplete.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 19:06, 7 June 2013 (UTC)

== Header message ==

'''Please don't take this seriously unless you actually think it's a good idea:'''

I think the header should be changed from "explain xkcd: It's 'cause you're dumb." to "explain xkcd: It's 'cause you're dumb... or still have some hope that comic [[1190]] will end." or something similar. [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 14:53, 9 June 2013 (UTC)

::Nope! This page is trying to explain more than 1222 comics, not only [[1190: Time]]. The header just states the truth.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 15:49, 9 June 2013 (UTC)

I'd vote for a change. People have started coming over to discuss the comic even when they've 'gotten' it. That, and the fact that this is one step ahead of Googling the references yourself. So.. maybe, "it's because you're dumb..and lazy."[[Special:Contributions/220.224.246.97|220.224.246.97]] 02:26, 31 August 2013 (UTC)
:I honestly don't think it either. This is the most comprehensive comic-by-comic Wiki. People don't come here because they're dumb ''or'' lazy. That's like saying I'm dumb for reading a review of an episode after I've watched it - I'm interested in seeing what other people up with or caught that I didn't. It denigrates the idea of aggregating information, which is a very un-XKCD idea.

As a regular reader of explainxkcd (who was to lazy to cotribute anything until now), I'd like to support the proposed edit. (... and lazy) It really fits to the tone of our favourite waste of otherwise productive time (which is xkcd for myself). Best wishes from Heidelberg, Germany. --[[Special:Contributions/147.142.13.86|147.142.13.86]] 14:38, 10 October 2013 (UTC)

A friend that happens to be blind hates this site because of the "It's cause you're dumb" tagline. If he wants a transcript of the comic on xkcd, his option is to come here and have his screen reader program telling him that he is dumb every single time.

How about, "explain xkcd: because sometimes we all need a little help."? -- [[Special:Contributions/173.245.54.65|173.245.54.65]] 02:07, 8 February 2016 (UTC)

:Oh, hadn't thought about that. There's been recurring complaints about this over the years, though the tagline's been around since before we were a wiki. I'll write something up and put this to a vote. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 09:00, 8 February 2016 (UTC)

== A point of confusion ==

Why is 'Apatosaurus' a category but 'Internet Argument' no longer a category? [[User:Greyson|Greyson]] ([[User talk:Greyson|talk]]) 13:53, 20 June 2013 (UTC)
:Cuz people hit the random button, see an Apatosaurus feature in three comics and figure it must be a recurring theme. Same as the internet argument thing. Will get round to a category purge after we've cleared out all the incomplete tags. I think there's one for ferrets hidden away somewhere in the dark recesses of our catalog of categories. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 14:45, 20 June 2013 (UTC)
::On the subject, can I suggest a "Barred from Conferences" category, or similar? That's definitely a recurring theme (for a long, long time), and thus should be justified enough. I'd be happy to add various qualifying articles as I scroll through again, if I can, but first I'll leave it up to someone else to solidify the actual name. (In case it turns out not to be just conferences, for example.) [[Special:Contributions/178.98.31.27|178.98.31.27]] 16:27, 22 June 2013 (UTC)

== Incomplete comics statement ==

I suggest the minor change: "We have an explanation for all x xkcd comics, and only y (y/x %) are '''marked as''' incomplete." –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 08:07, 21 June 2013 (UTC)

== 1262 is out ==

So what are you waiting for? [[Special:Contributions/75.60.27.102|75.60.27.102]] 06:25, 9 September 2013 (UTC)
:<nowiki>(diff | hist) . . N 1262: Unquote‎; 06:23, 9 September 2013 (UTC) . . (+322)‎ . . ‎Davidy22 (Talk | contribs | block)‎ (Created page with "{{comic | number = 1262 | date = September 9, 2013 | title = Unquote | image = unquote.png | titletext = I guess it's a saying from the Old Country. }} ==Expl...")</nowiki>
:Examine the time stamps. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:30, 9 September 2013 (UTC)

== Adverts ==

I am not going to disable my adblock, I hate ads. If you accept bitcoin I can make a donation though. [[Special:Contributions/184.66.160.91|184.66.160.91]] 05:24, 27 September 2013 (UTC)
:Our ads are always easy-to-load images as opposed to flash ads, they're always pointing to some valuable product of some form and we've looked at and approved all of them. They also occupy space that would otherwise have been empty, as our one ad is bound strictly to the sidebar. We used to have a paypal donation button, but it was pitifully tended to and a much less reliable source of income than ads. Ads are the only reliable business model for small sites like this one; unless our readers suddenly become willing to pay all our server costs for us, we can't feasibly afford a better hosting plan without ads. We legally aren't allowed to open a merch store, because that infringes on Randall's shop, and we haven't had a single generous benefactor yet. If you want to stop seeing our server error messages, loosening up adblock for us and contributing to our impressions count will help us massively. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:00, 27 September 2013 (UTC)

I don't care about your server message, I wanted to make a donation. Sooo, you don't want any bitcoins? [[Special:Contributions/37.221.161.235|37.221.161.235]] 07:16, 27 September 2013 (UTC)
:This took a bit of digging. We're fine with bitcoin donations, it's just that at the rate donations came in, they were just not enough to pay for anything. [https://coinbase.com/checkouts/b19f921822ac962807a8f72d51509e59] '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 20:34, 28 September 2013 (UTC)

Donation made! [[Special:Contributions/184.66.160.91|184.66.160.91]] 23:23, 30 September 2013 (UTC)
:Thanks! '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 02:27, 1 October 2013 (UTC)

Am I the only one that feels it is "wrong" that the explainxkcd site has ads and the real xkcd doesn't have any? It feels like someone is profiting off of Randall's work. Does he officially endorse this website? Do any proceeds help go to support his ongoing publication of an awesome comic? [[Special:Contributions/173.245.54.19|173.245.54.19]] 16:01, 7 July 2015 (UTC)

:An admin will be able to give you more detail than me, but explainxkcd has a significant number of visitors (and thus hosting costs), and no way to generate income other than donations and ads. In contrast, Randall makes money from his comics by way of books and merchandise (and possibly public speaking), some of which will pay for his hosting. He could choose to have ads on his site to generate additional income, its his choice not to. I have no knowledge of the finances of explainxkcd, however I doubt there is much/any surplus ad revenue being pocketed by the owners/admin. As far as the site being officially endorsed, not as far as I'm aware, no.
:Also, for more discussion on adverts/income, see [http://www.explainxkcd.com/wiki/index.php/explain_xkcd:Community_portal/Proposals#Sidebar_ads here].--[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 16:21, 7 July 2015 (UTC)

== /wiki is returning a 403 ==

Hello, 
http://www.explainxkcd.com/wiki/ is returning a 403 now. In my eyes you should redirect it to the main-page instead :-). --[[User:DaB.|DaB.]] ([[User talk:DaB.|talk]]) 12:41, 8 November 2013 (UTC)
:We have a new, hopefully better, server. The problem is already reported to [[User_talk:Jeff#Forbidden]] --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 14:22, 8 November 2013 (UTC)

== Explain Explain XKCD / Explain^2 XKCD ==

This particular comic explanation requires explanation. Way too many potential cross references with each conjecture requiring its own explanation page. Dial it back a little. {{unsigned ip|108.162.245.11}}
:Uh, sorry, could you clarify that a little? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 07:23, 19 November 2013 (UTC)

::He is talking about the [http://www.explainxkcd.com/wiki/ http://www.explainxkcd.com/wiki/] issue. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:32, 19 November 2013 (UTC)
:::Well if it's that, that's an intentional permissions setting on a URL that no-one is feasibly going to type. Unless you can come up with a better use for that URL, with a reason? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 08:40, 20 November 2013 (UTC)
::::A symlink to "index.php" at the root folder would solve the problem.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 09:26, 20 November 2013 (UTC)
:::::I cannot believe how many weeks that took to fix. Amazing. No one was going to type it, but everyone was going to get redirected to it from the home page! [[Special:Contributions/108.162.222.227|108.162.222.227]] 11:37, 20 November 2013 (UTC)

The problem is still not solved. [http://www.explainxkcd.com/wiki/ http://www.explainxkcd.com/wiki/] gives still a 403 error because "index.php" is not included in the http server configuration as a default index page. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:07, 20 November 2013 (UTC)
:: I've fixed this. Sorry about the delay. Was super busy! --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 16:02, 21 November 2013 (UTC)
:::Thanks Jeff, it's working. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:20, 21 November 2013 (UTC)

== Webmaster: Obtrusive video ad on your site ==

In the ad section I saw a box sticking out and blocking out the explanation. This was therefore a very obtrusive botched video ad. Please remove this ad from your site. [[Special:Contributions/199.27.128.188|199.27.128.188]] 22:29, 6 June 2014 (UTC)

EDIT: It's now sticking out and preventing me from clicking on the "Save page" button. [[Special:Contributions/199.27.128.188|199.27.128.188]] 22:29, 6 June 2014 (UTC)
:We only accept GIFs for moving ads. Ads should also be contained within the sidebar as they're techonogically restricted to standard-sized PNGs and GIFs, so an extruding ad would be a CSS error on the site end/browser error. In addition, we run ads from lots of advertisers, and "this ad" is not specific enough to tell us which ad you want us to remove. Could you provide a screenshot/link/more information? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 22:54, 6 June 2014 (UTC)

== Adding an arcs list page ==

I think there should be a page listing all webcomics arcs so far (the red spiders, the race, etc.)[[Special:Contributions/188.114.102.134|188.114.102.134]] 12:47, 2 October 2014 (UTC)

:This already exists, see [[:Category:Comic series]]. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 05:39, 10 April 2015 (UTC)

== This explanation may be incomplete or incorrect: link ==

This has been bothering me for a while now. Why does the link in the info box for the main page link to editing the main page? It needs to link to the editing of the page which the comic's explanation is on. When I would like to edit the latest XKCD explanation, I click that thinking I am going to edit the explanation, but instead I am led to editing the main page. [[User:Auraxangelic|Auraxangelic]] ([[User talk:Auraxangelic|talk]]) 15:19, 24 October 2014 (UTC)
:Ooooooh, nice catch. I've actually never noticed that before, and it's definitely not intentional. It happens because the text of the explanation page is folded into the main page before mediawiki parses links and syntax, and the "Edit this page" button links to the page that the link is on. I have an idea for how to fix it though, so I'll get on that. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 01:49, 25 October 2014 (UTC)

== #1454 - bad description ==

"Curly-hair states longingly..." She comes across as disappointed (or even heartbroken), not "longing", which suggests sounding somewhat positive and energetic, rather than deflated. [[Special:Contributions/141.101.99.88|141.101.99.88]] 22:29, 2 December 2014 (UTC)

==Cueball/Rob merge==

It seems to me from a general reading of the comics that Randall has always intended for the character we here call "Cueball" to have the name "Rob". Much as "Cutie" was renamed "Megan" when we learned her name, and now she is identified as "Megan" even in comics where her name is not explicitly mentioned, I think we should consider merging the "Cueball" and "Rob" articles. I know there's a lot of inertia here, but it seems to me that this is Randall's intention for the character's name. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 13:38, 10 March 2015 (UTC)
: Alternatively, we should un-merge [[Megan]] and [[Cutie]] for consistency. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 14:50, 10 March 2015 (UTC)
: I'm pretty sure this is an augmentation of the author's internal characters, including the one he has developed involuntarily as to the nature of his love. His memory of his love is not his love, yet it is what he has to love. Randall seems the type to delve into this, and thus I am in support of keeping the character names as they stand. /eof [[Special:Contributions/173.245.56.185|173.245.56.185]] 05:43, 25 March 2015 (UTC)

== Kerbal Space Program ==

I'm a schizophrenic who's been playing Kerbal Space Program for about five days with no sleep, and I'm pretty sure this is a reference to [https://www.google.com/search?q=xkcd+kerbal+space+program&oq=xkcd+kerbal+space+program&aqs=chrome..69i57.10851j0j7&sourceid=chrome&es_sm=122&ie=UTF-8 comic 1365] :D [[Special:Contributions/173.245.56.185|173.245.56.185]] 05:39, 25 March 2015 (UTC)

== 1509 is missing ==

When will it be added? By bot, I presume.--[[User:17jiangz1|17jiangz1]] ([[User talk:17jiangz1|talk]]) 04:51, 8 April 2015 (UTC)

== Broken Date Box on comics ==

The "Comic #1511 (April 13, 2015)" textbox that appears on top of each comic breaks if you shrink the screen. I think the space after the comma needs to be replaced with a non breaking space.{{unsigned ip|108.162.238.144}}

:Is it fixed now? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 20:59, 13 April 2015 (UTC)

::It looks like it. I had pointed it out once before and it was fixed. I guess somebody reverted that change or something... --[[Special:Contributions/173.245.56.202|173.245.56.202]] 13:42, 15 April 2015 (UTC)

== 1515? ==

Is it correct that we have 1515 comics, as of April 15, 2015? --[[Special:Contributions/173.245.48.122|173.245.48.122]] 05:20, 15 April 2015 (UTC)
:It's not, but some people insist on making comic pages for things that aren't comics. I'll fix that. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:27, 15 April 2015 (UTC)

== 972 is broken ==

Look, I'm not going to make an account here or anything, but I just wanted to point out that trying to access the page for comic #972 leads to a database error, and maybe someone should check on that. [[Special:Contributions/173.245.48.102|173.245.48.102]] 07:45, 14 July 2015 (UTC)

Actually a lot of other pages lead to that same error as well... Even the 'Technical Diskussions' sub-page is broken. Seems to my, like some swap-spac needs cleaning up? [[Special:Contributions/108.162.230.83|108.162.230.83]] 10:32, 14 July 2015 (UTC)
:Yep. It's a symptom of another problem, but the errors should be cleared up now. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 16:31, 14 July 2015 (UTC)
::No dice. [[997]] is still broken. --[[Special:Contributions/198.41.235.119|198.41.235.119]] 00:27, 3 August 2015 (UTC)

:::Looks like they're working now. 21:01, 2016-11-27 {{unsigned ip|141.101.98.163}}

== #1567 ==

I think the current explanation is missing the connection, and the parody of, many "As Seen On TV" commercials selling kitchen products. Many of these commercials show people trying to use common kitchen equipment (pots, pans, can openers, etc) in a way that no normally functioning human would do it (for example, one has a lady draining the liquid from a pot of food into a sink in an extremely awkward manner — one that no normal person who has ever seen a kitchen would do — but then the lid flies one way, food goes another, there's a huge mess, etc; another commercial has someone trying to open a can of food using a can opener '''backwards''', with the woman looking extremely confused looking on how the can opener is supposed to be used or attached to the can [if you told someone act like they are a clueless monkey trying to use a can opener for the first time, that's basically what the commercial had the woman doing — no joke]). These commercials often begin with phrases such as "If you are like me" or "If you are like most home makers" or some other closely related "If you are like..." phrase (thus this comic is directly tieing itself to these commercials using this catch phrase). [[Special:Contributions/108.162.220.11|108.162.220.11]] 07:50, 21 August 2015 (UTC)
:: Other opening catch phrases for these commercials include the "Tired of [fill-in made-up frustration]" and the "Do you [fill-in made-up frustration]" kind. [[Special:Contributions/108.162.220.11|108.162.220.11]] 08:09, 21 August 2015 (UTC)

== "I used Google news BEFORE it was clickbait" ==

Go to a handful of older pages on this wiki, and it won't be long before you see this phrase in the comments - [[941: Depth Perception]], for instance has two of them. Does anyone know why this happens? [[Special:Contributions/108.162.221.116|108.162.221.116]] 10:59, 23 August 2015 (UTC)
:That's the signature of a person who used to post here. If you click through, it actually goes to a userpage. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 14:25, 23 August 2015 (UTC)

== URL ==

I notice that whenever you add "explain" to an xkcd url, it takes you here! neat! [[Special:Contributions/198.41.235.233|198.41.235.233]] 23:13, 28 August 2015 (UTC)
:Someone noticed! Finally! '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 04:45, 29 August 2015 (UTC)

== Should we really be using CC-BY-SA? ==

Don't get me wrong, CC-BY-SA is my favorite creative commons license. The problem is, are we really allowed? The reason I'm worried is that I'm not sure if what we are doing really counts as "fair use" with respect to XKCD. It would probably be better to do CC-NC-BY-SA, to respect XKCD, or at least put a note that CC-BY-SA only covers the wiki portion (since it's probably too late to do CC-BY-SA anyway).
[[Special:Contributions/173.245.54.37|173.245.54.37]] 23:38, 27 January 2016 (UTC)
:This is a tough one. Mediawiki sites generally use CC-BY-SA, even if the content they're based off is copyrighted (Wikia sites for various topics do this). The license only does apply to content ''created'' here. What should probably be done, if it isn't already, is some specification on pages in the <code>File:</code> namespace indicating that they are owned by someone other than the owners of this site. [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 19:37, 7 April 2016 (UTC)

== #1663: Garden not yet added? ==

For me it's 4:30 AM, 4/4/16 - I have a sleep schedule just like [https://xkcd.com/361/], so I've been first on quite a few xkcd explanations immediately. when they came out.
I notice that usually, immediately once a new xkcd comic is released, a bot generates a corresponding bare-bones page on this wiki. However, this new comic "1663: Garden" doesn't yet have an automatically-generated page. Maybe it's because of the strange user-session hash key that appears in the URL bar when the "comic" is interacted with? Maybe this sort of interactive thing messes with the bot?
Am I just being impatient? Do I have to wait a few minutes? (I'm going to bed, and this probably won't be seen until tomorrow, but I am at least interested in knowing how the bot system works.) [[Special:Contributions/173.245.54.21|173.245.54.21]] 09:01, 4 April 2016 (UTC)

== Skins broken ==

It seems both the Classic and Monobook skins are very very broken. Only Vector seems to be laid out normally. [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 19:39, 7 April 2016 (UTC)
: Yes, for me too. Let me see what can be done. [[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 20:10, 12 April 2016 (UTC)
::All calls to /load.php seem to fail, which results in the broken look. --[[Special:Contributions/162.158.86.167|162.158.86.167]] 11:02, 14 April 2016 (UTC)
:::Oh wow, I thought I was the only one. [[User:SuperSupermario24|Just some random derp]] 15:57, 8 May 2016 (UTC)
::::Should be fixed now. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 18:59, 17 May 2016 (UTC)

== #1682: Not sure about the reference for Russian meaning for Bun ==
''Also interesting to note is that in several Slavic languages (including Russian, Czech and Polish), the word for Rabbit literally means Little King''

I'm a native Russian speaker, and i've never heard of Rabbit being used for ''Little King''...

* Rabbit: ''krolik'' (кролик)
* Little King: ''korolyok'' (королёк)

Not sure if this above statement is correct for Russian language. {{unsigned ip|162.158.255.28}}
:This is the main page. You probably want to put this in [[Talk:1682: Bun]]'''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 16:36, 20 May 2016 (UTC)

== Random Button ==
The actual xkcd site has one and adding one would make it closer to the actual site and make discovering random comics and their explanations easier. It could go next to the comic # button.[[Special:Contributions/173.245.52.69|173.245.52.69]] 01:03, 5 June 2016 (UTC)
:There is a random page button on the left. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 02:36, 5 June 2016 (UTC)
::Oh. Didn't see that. Sorry.[[Special:Contributions/173.245.52.69|173.245.52.69]] 20:16, 5 June 2016 (UTC)

== XKCD Alignment Chart ==

A while back, I was searching for an XKCD alignment chart, with no success, so I made one. It is not perfect, so I'm wondering what other opinions on the alignment of the characters are.

Lawful Good- Beret

Neutral Good- Ponytail

Chaotic Good- Mrs. Roberts

Lawful Neutral-Cueball

Neutral Neutral- Megan

Chaotic Neutral- White hat

Lawful Evil- Hairy

Neutral Evil- Danish

Chaotic Evil- Black Hat

--[[User:Fallencrow305|Fallencrow305]] ([[User talk:Fallencrow305|talk]]) 22:10, 28 July 2016 (UTC)

:What about Help I'm trapped in a drivers license factory Elaine Roberts? --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 15:48, 29 September 2016 (UTC)
::Or Hairbun? Or Science Girl? Here are my predictions: Elaine - Chaotic Good, Hairbun - Lawful Good, Science Girl - Lawful Neutral --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 16:00, 29 September 2016 (UTC)

What? How can Beret Guy be anything other than chaotic?

== 1713 cc also means carbon copy. So 50 carbon copies of either of those words could be called for. ==

1713 cc also means carbon copy. So 50 carbon copies of either of those words could be called for. {{unsigned ip|108.162.215.146}}
:Sorry, but [[User:108.162.215.146|108.162.215.146]], you need to remember to sign your work. --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 11:50, 26 September 2016 (UTC)

== Chatroom Idea... What do you guys think? ==
I have an idea. What if there was a discussion board for the wiki? (And no, I don't mean boards like this or the "comment section" of comic explanations. I mean a live chatroom plugin of sorts. We could add it to the website and enable it so we can talk to each other in real-time and make live edits with each other. This way, we can also let each other know of edits we've made, make new pages altogether, or just talk. What do you guys think? -- [[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 9:10, 13 September 2016
:The [http://www.explainxkcd.com/wiki/index.php/Special:RecentChanges recent changes] log already notifies all users on the site of new pages and edits. User talk pages and the community portals exist for coordination. Also, avoid creating new comment topics in the middle of a talk page in the future, comments are supposed to follow a chronological order. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 15:39, 13 September 2016 (UTC)
::Sorry. --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 13:59, 26 September 2016 (UTC)

== Copying versus embedding ==

Hi, I'm new here and I'm trying not to be an asshole. However, I just noticed that this site uses its own archive of copied xkcd comics, rather than using the image URL provided for hotlinking and embedding. I can understand this website will want to have its own archive in case xkcd.org ever goes offline, but until then, why not just embed the images instead of copying?

The reason I'm asking: I just realised I hardly ever go to xkcd.org anymore ever since my browser put explainxkcd above xkcd.org. Explanations get updated, so sometimes I check back later, which rarely happens with the comics. It makes perfect sense. But if more people experience this issue, xkcd.org is getting fewer unique visitors because of it, and this could be fixed by fetching the image directly from there, while still making and storing a copy in case it is needed in the future. Thoughts, anyone? [[Special:Contributions/141.101.104.33|141.101.104.33]] 17:08, 18 October 2016 (UTC)
:So, we can't do this for every comic, like [[1190]] or other april fools comics. Also, xkcd's revenue comes from merchandise sales, not ad revenue, so I believe it's not actually negatively impacting them that we're serving the images ourselves rather than making the main site serve them for us. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 05:39, 19 October 2016 (UTC)

:Embedding images is generally known as "stealing bandwidth", since it uses resources of the original site's server (may be limited) without bringing it any actual visitors (they won't see anything else of the website, like announcements, shop, other sections, ...). Also, depending on how unique visitors are counted, "visitors" through embedding might be invisible (client's side scripts won't be loaded). So no image embedding without the original site's owner express permission. [[Special:Contributions/141.101.88.106|141.101.88.106]] 12:51, 7 February 2017 (UTC)

== Other Languages ==
Are there translations of pages anywhere. It has been mentioned that they are on subdomains of this site, or a sub-page, as Main_Page/es for spanish. I can't seem to find them there. [[User:The Muffin Man|The Muffin Man]] ([[User talk:The Muffin Man|talk]]) 14:48, 7 February 2017 (UTC)
:It's a work in progress, long delayed but I really do want to get to it eventually. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 18:58, 7 February 2017 (UTC)

== Why are there male/female symbols in some of the entries? ==

Those symbols are not in the comic, but they're in the table. I think a vandal put them there. Can someone remove them from the Lavaball, Bladeball, Eggspotting, Merfishing, Consequence Golf and Heck Escape? (now don't act like someone who criticizes "politically correct leftist "libt++d" SJW snowflakes" just because I said "heck" or censored the derogatory term for "liberal" or not even trying to say these uncensored) -- [[Special:Contributions/108.162.221.106|108.162.221.106]] 12:36, 25 November 2017 (UTC)

== How quaint ==

From the Main Page:

Explain xkcd: '''It's 'cause you're dumb.'''

From the Rules section:

'''Don't be a jerk. '''

(Emphasis mine)

How very ,very quaint. --[[Special:Contributions/162.158.126.100|162.158.126.100]] 21:00, 5 December 2017 (UTC)

== HTTPS? ==

Hi,
With the general trend towards HTTPS being favoured over HTTP for security and speed reasons, would it be possible to force the use of HTTPS and secure the mixed content please?

Please see [https://www.whynopadlock.com/results/7e707bfd-cd71-4b00-b95e-be226fb10fb6 Why no Padlock?] for more details.

Thanks,
[[Special:Contributions/162.158.179.202|162.158.179.202]] 10:32, 13 January 2018 (UTC)

:Browsing using HTTPS seems to just work. There's even a signed certificate.
:https://www.explainxkcd.com/wiki/index.php/1946

:I really don't get why people are so convinced that browsing using HTTPS is so much more "secure". You even seem to claim that it's faster?
:If you love it so much, install a browser extension like https://www.eff.org/https-everywhere.

:With the exception of the login / register page, I really don't see the point for enforcing this for the whole site. I am no admin though.
[[Special:Contributions/172.69.54.93|172.69.54.93]] 22:30, 25 January 2018 (UTC)

We are already in 2018 and this website still does not even redirect automatically to HTTPS ([https://support.cloudflare.com/hc/en-us/articles/200170536-How-do-I-redirect-all-visitors-to-HTTPS-SSL- you can do it so easily with Couldflare...]) nor enforce HTTPS with {{w|HSTS}}... I don't know, just check [https://scotthelme.co.uk/hardening-your-http-response-headers/#strict-transport-security on Scott Helme's site] why it's important. Having to rely on the user installing an extension for doing the sysadmin work is a bad joke, really. And it does not fix some issues with mixed content of course. With Let's Encrypt and Cloudflare providing certificates for free and the plethora of tutorials online on securing a website (not limited to HTTPS), there is no excuse to not do it. -- [[User:guest|guest]] ([[User talk:guest|talk]]) 11:22, 31 January 2018 (UTC)

== "It's because you're dumb" ==
I see that there was some talk about this a while ago, in which people seemed to agree that the "It's because you're dumb" tagline is unnecessarily mean and should be changed... and yet, it's still here. I'd like to add some more fuel to the fire with several reasons why I really hate this tagline:

* The tagline doesn't fit the tone of XKCD. Randall celebrates knowledge. Even Black Hat wouldn't just outright say "You're dumb", because he's a classhole who can insult way better than that.
* Many of the people who contribute to this wiki are very smart. They're not dumb.
* They're also quite amicable from what I've seen. If they wouldn't insult someone, why is the website doing so?
* Not knowing something is not the same as being dumb. Even the smartest people don't know everything.
* Having a desire to learn is smart, not dumb.
* The tagline's logic is flawed. Just because you learn a new thing, doesn't mean you were dumb to begin with.

Anyone with me on this?

[[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 14:07, 20 February 2018 (UTC)

: The first line of the "Rules" section is "Don't be a jerk" at the time of writing. The first thing this wobsite does is to break that rule. I'm not sure what else is to be said here. --[[Special:Contributions/162.158.126.76|162.158.126.76]] 16:55, 20 March 2018 (UTC)

:I always thought that was weird too. But it's still there... I'll tell the admins about it, and hopefully it will be changed. [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 13:18, 18 April 2018 (UTC)

Explanation: ''This'' is a joke... Missing the punchline? --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 15:15, 18 April 2018 (UTC)

Personally, I'm fine with the current tagline. I consider it a joke and don't feel offended. However, if there is consensus a) that and b) to what it should be changed, I'm ok with changing it. --[[User:SlashMe|SlashMe]] ([[User talk:SlashMe|talk]]) 16:18, 18 April 2018 (UTC)

I'm wondering, would it be possible to temporarily (a week or so?) stop new ads from appearing in the sidebar and replace it with a poll concerning this issue? Right now it's just showing what appeared in the banners in [[1965: Background Apps]], and not a real ad. [[Special:Contributions/162.158.58.81|162.158.58.81]] 10:12, 19 April 2018 (UTC)
:The advertisement is used to pay the fees needed to run this site. Right now this wiki get's an upgrade but when it's done this discussion will get a proper placement here. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 13:37, 21 April 2018 (UTC)

The first time I encountered this tagline I thought it was pretty funny. Satire can be hard to detect online but this one seems clear enough. --[[User:DKMell|DKMell]] ([[User talk:DKMell|talk]]) 20:42, 20 August 2018 (UTC)
:What is it satirizing? I'm serious; I genuinely don't know. It could well be that I just don't get the joke. [[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 13:39, 10 January 2019 (UTC)

At first I liked the joke, but now it's either annoying or I ignore it. Personally I don't feel it needs to be changed, as it's in the satirical spirit of xkcd, but I wouldn't care too much. [[User:Nyx goddess|Nyx goddess]] ([[User talk:Nyx goddess|talk]]) 22:56, 5 December 2018 (UTC)

It's satire, if it gets removed that's exactly the kind of overzealous political correctness that MAGA chuds are talking about when they accuse us of being snowflakes, howabout let's not give them ammo. - 02:03, 22 December 2018 (UTC) {{unsigned ip|162.158.63.94}}
:As above: what it is satirizing? Also, for my part, it's not about political correctness at all; it's that the tagline doesn't match my personal positive image of XKCD, nor of this wiki, and it just feels unfitting to me, for all the reasons that I laid out. [[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 13:39, 10 January 2019 (UTC)

I'm in favor of a change. Let's drop the "dumb". Or at least modify it. I propose a "strikethrough" of dumb, then add any one of a list of possible words: confused, ignorant, curious, wondering, befuddled... (Oooh, could it randomly change each time the page is loaded? Code wizards, advance!) [[User:Imperpay|Imperpay]] ([[User talk:Imperpay|talk]]) 22:25, 24 January 2019 (UTC)
:A complete list of all synonyms of dumb, including dumb and all synonyms of those synonyms, according to thesaurus.com. One randomly loads each time you load the page via rng, or on a once a day system, like the incomplete page of the day. That would actually probably make it more mean on average, but more clearly a joke. Wouldn’t be impossible to code either.[[User:Netherin5|Netherin5]] ([[User talk:Netherin5|talk]]) 15:18, 21 February 2019 (UTC)

The reason I come to Explain XKCD is because I'm excited to see what other people have said about it. I agree with the above - it doesn't fit the spirit of xkcd's joy for knowledge and it really just isn't why people come here. Furthermore, it skirts demeaning people with disabilities. Please remove it. [[User:Jachra|Jachra]] ([[User talk:Jachra|talk]]) 07:43, 2 July 2019 (UTC)

I also agree with Hawthorn. This tagline always was very strange for me. No, this is nothing about political correctness. I don't mind being insulted, if there is a joke, or something ironical or satirical behind it. But there just isn't. It's just not funny at all.
A random selection on every page load from a long list of completely absurd reasons would be more the XKCDs way. You could even try to create one or more "''It's because ...''" explanations for every comic and randomly display one out of those. 2206: "''... you don't know how to type capital numbers.''", 2205: "''... you don't assume Pi is one.''", 2204: "''... you didn't give us a moon.''", 2203: "''... there wasn't a really big meteor impact for a while.''" and so on. Pretty straight forward. The more frequent visitors of XKCD would probably even get many of the references and remember the corresponding comic. --[[Special:Contributions/162.158.91.221|162.158.91.221]] 17:39, 24 September 2019 (UTC)
:I did recently raise the issue again on the [https://www.explainxkcd.com/wiki/index.php/explain_xkcd:Community_portal/Miscellaneous#Is_the_.22It.27s_.27cause_you.27re_dumb.22_tagline_a_relic_of_the_past.3F Community Portal], explaining my case in more detail, although it seems to have garnered little interest. [[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 12:13, 30 September 2019 (UTC)

What instead, then? It's poor form to suggest half a change; if not "it's cause you're dumb," what should the tagline be? [[Special:Contributions/173.245.52.85|173.245.52.85]] 16:37, 25 December 2019 (UTC)

== Editor FAQ ==
Eventually we may need that banner at the top for something else, like the incomplete explanation spotlight, or when the wiki was being upgraded, so I think we should add the Editor FAQ in the New Here? section. [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 11:21, 2 June 2018 (UTC)
:It's a first draft and I'm just waiting to be convinced that it's NOT incomplete. And be sure I haven't written it without a plan how to present it on the proper places. Furthermore this "Sitenotice" on the top is only "dissmissable" for valid users, every visitor not logged in does see this always. Thanks for your participation and I'm grateful about any help. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 16:30, 2 June 2018 (UTC)

== Categories on Main Page ==

[[MediaWiki:Common.css]] has the following entry:
<pre>
.page-Main_Page div#catlinks ul li {
border-left: none;
position: absolute;
left: 70px;
bottom: 6px;
}
</pre>
The <code>70px</code> cause an overlap for me in Firefox, and much too small a gap in Chrome. I suggest to actually remove that line completely, just compare it with categories on other pages: The gap is quite large. In Firefox, also the <code>6px</code> are too much, but in Chrome they are required. But it might be worth to try whether setting vertical align to something else can achieve a more consistent display. --[[Special:Contributions/162.158.88.230|162.158.88.230]] 10:22, 13 July 2018 (UTC)
:And the comment above that says: "Dirty hack to hide the categories of the current comic from main page. ...". I'm aware of this but there is much more, especially for a mobile version I'm looking forward to. Only in this case I see three problems: The component is rendered as a list (ul,li) by hiding the bullets. This then empty space is always rendered different in different browsers. Using "position: absolute" tries to circumvent this but absolute positioning is bad layout and never should be used. Furthermore mixing the units ''px'' and ''em'' in many places is also a problem when comparing it at different browsers. I'm working on this with the final goal also having a proper mobile version, not only for Firefox, Chrome, Edge,... on a desktop. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 12:12, 13 July 2018 (UTC)

== Bookmark ==

I think we should add this book mark I made to automatically transfer anything from xkcd to its explainxkcd page (I was frustrated, ok?):

javascript:x=window.location.href;x = x.replace(/\D/g,'');t=document.title.substring(5).replace(/ /g,"_");window.location.href="https://www.explainxkcd.com/wiki/index.php/"+x+":"+t;

I know the code could be more compact, but using this, you can just press a button and it will take you to the explain page {{unsigned ip|172.68.47.84}}
:Just changing the URL from <code>xkcd.com/2115/</code> to <code>explainxkcd.com/2115/</code> (putting the word explain to the beginning) does the same. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 16:41, 22 February 2019 (UTC)

== Non-comic explanations? ==

So I was looking at xkcd and I noticed a little jokey line near the bottom of the page in very small print that reads <pre> <nowiki> "xkcd.com is best viewed with Netscape Navigator 4.0 or below on a Pentium 3±1 emulated in Javascript on an Apple IIGS at a screen resolution of 1024x1. Please enable your ad blockers, disable high-heat drying, and remove your device from Airplane Mode and set it to Boat Mode. For security reasons, please leave caps lock on while browsing." </nowiki> </pre>
Now, I know enough to understand the joke, but it would be nice to have a page for this. Do we have one? Am I just blind? Either way, I would like to know. Thanks! [[User:Nyx goddess|Nyx goddess]] ([[User talk:Nyx goddess|talk]]) 23:39, 28 March 2019 (UTC)
:Nevermind, I just found it. Sorry! [[User:Nyx goddess|Nyx goddess]] ([[User talk:Nyx goddess|talk]]) 23:40, 28 March 2019 (UTC)

== Latest comic released. ==

I don't know where to post this, but the bots haven't created the page yet.
[[User:HelloWorld|HelloWorld]] ([[User talk:HelloWorld|talk]]) 19:24, 4 April 2020 (UTC)

: Probably infected by COVID-19. That's why you should wash your keyboards after visiting other websited. Until then, feel free to create the page manually (if possible). --[[Special:Contributions/108.162.242.19|108.162.242.19]] 21:07, 4 April 2020 (UTC)

2288: Collector's Edition

2020-04-04T03:57:09Z

108.162.242.19: /* Hints */

{{comic
| number = 2288
| date = April 3, 2020
| title = Collectors Edition
| image = collectors_edition.png
| titletext = I'm sure you can find some suitable worldbuilding material if you scavenge through the archives.
}}

==Explanation==
{{incomplete|Created by TECHNICAL DIFFICULTIES. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

This is an April 1st comic. It is a large image, of which only part is visible, but it can be dragged around. This Space acts as a virtual common sandbox where viewers can interact. "Items" (small, often humorous images) can be 'collected' from other comics and then placed in this image by viewers. The collection then updates for all viewers in real-time. Multiples of the same item are often seen.

There is a "backpack" at the bottom, similar to "backpacks" in video games containing items collected by the player. Items can be found by visiting different XKCD comics/pages. Randomly, some pages will have a treasure chest which will contain the sticker related to the page. It is believed that the hint represents what page currently has a chest.

The sticker images can be seen at <nowiki>https://xkcd.com/2288/collectors/static/loot/loot_</nowiki>'''XXX'''.png, where XXX is a number from 001-253. Additionally, some images can be found at custom URLs, for example the periodic elements can be found at <nowiki>https://xkcd.com/2288/collectors/static/loot/element-</nowiki>'''XX'''.png, where XX is the element, and text loot at <nowiki>https://xkcd.com/2288/collectors/static/loot/loot-words-</nowiki>'''X'''.png, where X is the sentence.

===Hints===

{| class="wikitable"
!Hint
!Comic
!Unlocked item
!Item image
!Notes
|-
|Doctors in a row||[[1529: Bracket]] [[497: Secretary: Part 4]] ||Cory Doctorow || loot_019.png || These comics all have the same hint, but only one will have the chest ||
|-
|Get out the (US) vote|| [[2224: Software Updates]] || Statue of liberty || loot_246.png ||
|-
|Find a box of nice stuff on a picture with words like these|| [[1133: Up Goer Five]] || Signpost || loot_126.png ||
|-
|Plug in or find another power source||[[1373: Screenshot]] || || loot_228.png ||
|-
|Sweet dreams, kitty||[[729: Laser Pointer]] || Cat licking laser point || loot_090.png ||
|-
|What is this hint pointing to? Hell if I know.||[[28: Elefino]] || || ||
|-
|Somebody set up us the bomb||[[286: All Your Base]] ||Exploding rock || loot_197.png ||
|-
|Cowabunga||[[1412: Teenage Mutant Ninja Turtles]] ||Women Science Fiction Authors || loot_175.png || [[197: Ninja Turtles]] also works
|-
|I want to believe||[[2156: Ufo]] ||Ufo || ||
|-
|Bleeped||[[1671: Arcane Bullshit]]|| *$@#! || loot_044.png ||
|-
|why waste time say few word when lot word do trick||[[1022: So It Has Come To This]] || First Annual Award for Excellence in Being Very Smart || loot_159.png ||
|-
|Cooler than electric scooters||[[409: Electric Skateboard (Double Comic)]]||An electric scooter|| loot_006.png ||
|-
|Take it from the top||[[1: Barrel - Part 1]] ||I am a turtle from [[889: Turtles]] || loot_095.png ||
|-
|I accept the yucca gnocchi, this meal is a success!||[[1713: 50 ccs]] ||Man carrying parentheses from [[297: Lisp Cycles]] || loot_031.png ||
|-
|Catch up on the news|| [[1699: Local News]] || || ||
|-
|Participation trophy|| [[2288: Collectors Edition]] || Server rack || loot_096.png ||
|-
|Find an opportunity for a sojourn||[[1504: Opportunity]] ||Opportunity Mars rover from [[2111: Opportunity Rover]] || loot_161.png ||
|-
|Tastier than tau day||[[179: e to the pi times i]] ||First annual award for excellence in being very smart || loot_159.png ||
|-
|Tastier than tau day||[[1967: Violin Plots]] || Pie sign || loot_056.png || Published on Pi day
|-
|418 I'm a teapot||[[1866: Russell's Teapot]] ||S.S. NASA: Space is Hard || loot_216.png ||
|-
|26th September, 1983||[[2052: Stanislav Petrov Day]] ||White dove || loot_205.png ||
|-
|There are 4241 as of Apr 1, 2020|| [[1071: Exoplanets]] || Little girl from [[2264: Satellite]] || loot_151.png ||
|-
|asableiK|| [[645: RPS]] || A reverse Polish hotdog || loot_079.png || "Kielbasa" backwards, which is "sausage" in Polish
|-
|Critical mass elements|| [[235: Kite]] || || loot_203.png ||
|-
|Some Februarys are more equal than others|| [[390: Nightmares]]? || Cueball wheelie from [[272: Linux User at Best Buy]] || loot_036.png || Comic-hint connection largely conjectural; 390 was the first comic published on a leap day.
|-
|Five spice||[[1554: Spice Girls]]|| Rock guitarist || loot_022.png||
|-
|Call the plumber|| [[290: Fucking Blue Shells]] || || loot_058.png ||
|-
|Was it a rat I saw?|| [[1632: Palindrome]] || Cueball with a large sack, pulling a wagon || loot_103.png || or [[1503: Squirrel Plan]] for cueball holding a balloon caught in a ceiling fan.
|-
|Churchill's gonna have to seriously rehydrate||[[1148: Nothing to Offer]]|| Bottle of soda || loot_045.png ||
|-
|Keep coming back|| || || ||
|-
|A new model released each year|| || || || Triggered by visiting all xkcd phone comics
|-
|Tea Time||[[581: The Race: Part 5]] ||Floor tea ||loot_232.png||
|-
|Try pattern-matching! Look for comic 'bout alphabet?||[[1045: Constraints]] || || ||
|-
|Where's Hilbert?||[[195: Map of the Internet]] || Hilbert Curve || loot_021.png ||
|-
|Science fiction fetish|| || || ||
|-
|The first one was funnier||[[11: Barrel - Part 2]]||Falling feather / Sign "The uncomfortable truths well" || loot_250.png / loot_067.png ||
|-
|It's up to over 260 million cycles!||[[1941: Dying Gift]] || Megan on a tire swing || ||
|-
|Sleeping Beauty is the same everywhere though||[[2233: Aurora Meaning]] || Sleeping Cat || loot_163.png ||
|-
|On the internet, nobody knows you're an arachnid|| [[1530: Keyboard Mash]] || Cobwebbed frame from [[1135: Arachnoneurology]]|| loot_191.png ||
|-
|Did James Cameron pay for the rice cooker too?||[[1598: Salvage]] ||Rice bowl || loot_152.png ||
|-
|Never going to give you up||[[351: Trolling]] || || ||
|-
|If red touches yellow, that's 24 ohms||[[1604: Snakes]], [[227: Color Codes]]?|| Yoda with an mp3 player from What If || loot_247.png ||
|-
|An enthusiastic but questionable business opportunity||[[1533: Antique Factory]] or [[1021: Business Plan]]|| Beret guy with a goat on leash || loot_115.png ||
|-
|Read the fine manual|| [[1343: Manuals]] or [[293: RTFM]] || "Configure the network" window with a prompt for hostname || loot_106.png ||
|-
|That thing's undecimodal!||[[1347: t Distribution]] || Floating tentacled alien || ||
|-
|Actually, it's Myanmar-Shave now||[[491: Twitter]]||Expensive bottle || loot_253.png ||
|-
|You don't have to find all 99|| [[121: Balloon]] ||Balloon copter || loot_002.png || Or [[51: Malaria]] ?
|-
|Going in circles|| [[378: Real Programmers]] || Cueball spinning in desk chair || loot_098.png ||
|-
|Couldn't you try knitting, or maybe stamp collecting?||[[2123: Meta Collecting]]||Phishing License sign|| loot_158.png ||
|-
|It's the ciiiiircle of HONK||[[537: Ducklings]] ||DUCKLOOP'D? || loot_069.png||
|-
|Fool me twice|| [[880: Headache]] || Raptor Attack || loot_033.png ||The second April fools' comic
|-
|oOOOoooo|| [[316: Loud Sex]] || Sleeping cat || ||
|-
|Maybe we can ask for new wishes||[[879: Lamp]] ||Genie and his bottle ||loot_004.png || If you place the genie last, you get another genie (indefinitely) ||
|-
|HACK THE PLANET||[[1337: Hack]] || Crash and Burn in the pool from the end of ''Hackers'' || loot_130.png ||
|-
|Monetization haute couteur||[[20: Ferret]]||Two bags of money ||loot_162.png||
|-
|Maybe writing a script would help||[[1319: Automation]]|| || ||
|-
|Go big to go small|| [[1365: Inflation]] || || loot_245.png ||
|-
|Are you projecting||[[850: World According to Americans]] or [[977: Map Projections]]||Squirrel on a gun||loot_237.png||
|-
|Do spiders really have six legs||[[8: Red spiders]] || || ||
|-
|Istanbul or Constantinople or St. Trimble's Island?||[[1688: Map Age Guide]] ||Cephalopod || loot_071.png ||
|-
|Another rulebook?||[[393: Ultimate Game]]|| Merlin in a chair from [[270: Merlin]] || loot_037.png ||
|-
|Moooooon|| [[1300: Galilean Moons]] || MOOOOOON || loot_192.png ||
|-
|Take a flight from LOL to FFS|| [[1937: IATA Airport Abbreviations]] || || ||
|-
|Everyone deserves a second chnace|| || || || [[745: Dyslexics]] feels like a good fit but I don't see a loot box there
|-
|Community contribution|| [[826: Guest Week: Zach Weiner (SMBC)]] || [Citation Needed] protester from [[285: Wikipedian Protester]] || loot_035.png ||
|-
|On the other side of the wardrobe|| [[665: Prudence]] or [[969: Delta-P]] or [[2218: Wardrobe]] ||Authentic Reindeer pulling sled from [[1776: Reindeer]] || loot_154.png ||
|-
|Today's your lucky day|| [[1053: Ten Thousand]] || Ms. Frizzle || loot_105.png ||
|-
|[This hint has been redacted due to a copyright claim]|| [[1005: SOPA]] || || ||
|-
|Try a different approach|| [[55: Useless]] || Equals sign || loot_times.png, loot_div.png ||
|-
|The cake is a lie!|| [[606: Cutting Edge]] || Cake || loot_144.png ||
|-
|Joanna, fire.||[[322: Pix Plz]] || Joanna with EMP cannon || loot_026.png ||
|-
|Everything changes from time to time when the fire nation attacks|| [[965: Elements]] || Symposium || ||
|-
|90KG x 300M|| [[382: Trebuchet]] || Trebuchet || loot_041.png ||
|-
|Copyright Enforcement Brigade|| [[344: 1337: Part 4]] || || loot_046.png ||
|-
|Where Cape Town meets Chukotka||[[1500: Upside-Down Map]] || Crater || ||
|-
|Take a ride in a barrel|| || Cueball at the door to the playpen-ball-filled apartment from [[150: Grownups]] || loot_005.png || Reliably triggered by viewing all five barrel comics in reverse order ([[31]], [[25]], [[22]], [[11]], [[1]])
|-
| || [[2288: Collectors Edition]] || Sheeple eye || loot_109.png ||
|-
| || [[2288: Collectors Edition]] || Time machine from [[1747: Spider Paleontology]] || loot_167.png ||
|}

==Trivia==
* This comic is the 2020 April Fools comic and was supposed to be released April 1st. However, the below message was displayed on the top of the page until early Friday (April 3rd) morning, when the comic finally went live. It remains to be seen if Friday's intended comic will be published later.
<blockquote>
Note: For technical reasons Wednesday's comic will be posted Thursday instead. Apologies for the delay!
</blockquote>
* Placement is limited to 10,000 units from the origin. Users will receive no messages if they try placing something outside the boundary.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[Cueball stands to the left of a vibrating box.]
:[The words "Collector's Edition" are written above him and boxed.]

{{comic discussion}}

[[Category:April fools' comics]]
[[Category:Comics featuring Cueball]]
[[Category:Interactive comics]]

2288: Collector's Edition

2020-04-03T17:28:22Z

108.162.242.19: /* Hints */ Added an answer to a hint.

{{comic
| number = 2288
| date = April 3, 2020
| title = Collectors Edition
| image = collectors_edition.png
| titletext = I'm sure you can find some suitable worldbuilding material if you scavenge through the archives.
}}

==Explanation==
{{incomplete|Created by TECHNICAL DIFFICULTIES. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

This is an April 1st comic. It is a large image, of which only part is visible, but it can be dragged around. This Space acts as a virtual common sandbox where viewers can interact. "Items" (small, often humorous images) can be 'collected' from other comics and then placed in this image by viewers. The collection then updates for all viewers in real-time. Multiples of the same item are often seen.

There is a "backpack" at the bottom, similar to "backpacks" in video games containing items collected by the player. Items can be found by visiting different XKCD comics/pages. Randomly, some pages will have a treasure chest which will contain the sticker related to the page. It is believed that the hint represents what page currently has a chest.

The sticker images can be seen at https://xkcd.com/2288/collectors/static/loot/loot_XXX.png, where XXX is a number from 001-253. Additionally, some images can be found at custom urls, for example the periodic elements can be found at https://xkcd.com/2288/collectors/static/loot/element-XX.png, where XX is the element, and text loot at https://xkcd.com/2288/collectors/static/loot/loot-words-X.png, where X is the sentence.

===Hints===

{| class="wikitable"
!Hint
!Comic
!Unlocked item
!Item image
!Notes
|-
|Doctors in a row||[[1529: Bracket]] ||Cory Doctorow || loot_019.png ||
|-
|Get out the (US) vote|| [[2224: Software Updates]] || Statue of liberty || loot_246.png ||
|-
|Find a box of nice stuff on a picture with words like these|| [[1133: Up Goer Five]] || Signpost || loot_126.png ||
|-
|Plug in or find another power source||[[1373: Screenshot]] || || loot_228.png ||
|-
|Sweet dreams, kitty||[[729: Laser Pointer]] || Cat licking laser point || loot_090.png ||
|-
|What is this hint pointing to? Hell if I know.||[[28: Elefino]] || || ||
|-
|Somebody set up us the bomb||[[286: All Your Base]] ||Exploding rock || ||
|-
|Cowabunga||[[1412: Teenage Mutant Ninja Turtles]] ||Women Science Fiction Authors || loot_175.png || [[197: Ninja Turtles]] also works
|-
|I want to believe||[[2156: Ufo]] ||Ufo || ||
|-
|Bleeped|| || || ||
|-
|why waste time say few word when lot word do trick||[[1022: So It Has Come To This]] || First Annual Award for Excellence in Being Very Smart || ||
|-
|Cooler than electric scooters||[[409: Electric Skateboard (Double Comic)]]||An electric scooter|| loot_006.png ||
|-
|Take it from the top||[[1: Barrel - Part 1]] ||I am a turtle from [[889: Turtles]] || loot_095.png ||
|-
|I accept the yucca gnocchi, this meal is a success!||[[1713: 50 ccs]] ||Man carrying parentheses from [[297: Lisp Cycles]] || loot_031.png ||
|-
|Catch up on the news|| [[1699: Local News]] || || ||
|-
|Participation trophy|| [[2288: Collectors Edition]] || Server rack || loot_096.png ||
|-
|Find an opportunity for a sojourn||[[1504: Opportunity]] ||Opportunity Mars rover || ||
|-
|Tastier than tau day||[[179: e to the pi times i]] ||First annual award for excellence in being very smart || ||
|-
|418 I'm a teapot||[[1866: Russell's Teapot]] ||S.S. NASA: Space is Hard || ||
|-
|26th September, 1983||[[2052: Stanislav Petrov Day]] ||White dove || ||
|-
|There are 4241 as of Apr 1, 2020|| [[1071: Exoplanets]] || Little girl from [[2264: Satellite]] || ||
|-
|asableiK|| [[645: RPS]] || A reverse Polish hotdog || || "Kielbasa" backwards, which is "sausage" in Polish
|-
|Critical mass elements|| [[235: Kite]] || || loot_203.png ||
|-
|Some Februarys are more equal than others|| [[390: Nightmares]]? || Cueball wheelie from [[272: Linux User at Best Buy]] || || Comic-hint connection largely conjectural; 390 was the first comic published on a leap day.
|-
|Five spice||[[1554: Spice Girls]]|| Rock guitarist || ||
|-
|Call the plumber|| [[290: Fucking Blue Shells]] || || loot_058.png ||
|-
|Was it a rat I saw?|| [[1632: Palindrome]] || Cueball with a large sack, pulling a wagon || loot_103.png || or [[1503: Squirrel Plan]] for cueball holding a balloon caught in a ceiling fan.
|-
|Churchill's gonna have to seriously rehydrate||[[1148: Nothing to Offer]]|| Bottle of soda || loot_045.png ||
|-
|Keep coming back|| || || ||
|-
|A new model released each year|| || || || https://xkcd.com/1363/ ? and/or other XKCD Phone comics?
|-
|Tea Time||[[581: The Race: Part 5]] ||Floor tea ||loot_232.png|| Also [[479: Tones]] ? Also [[578: The Race: Part 2]] ?
|-
|Try pattern-matching! Look for comic 'bout alphabet?||[[1045: Constraints]] || || ||
|-
|Where's Hilbert?||[[195: Map of the Internet]] || Hilbert Curve || loot_021.png ||
|-
|Science fiction fetish|| || || ||
|-
|The first one was funnier||[[11: Barrel - Part 2]]||Falling feather || ||
|-
|It's up to over 260 million cycles!||[[1941: Dying Gift]] || || ||
|-
|Sleeping Beauty is the same everywhere though||[[2233: Aurora Meaning]] || || ||
|-
|On the internet, nobody knows you're an arachnid|| [[1530: Keyboard Mash]] || Cobwebbed frame || ||
|-
|Did James Cameron pay for the rice cooker too?||[[1598: Salvage]] ||Rice bowl || ||
|-
|Never going to give you up||[[351: Trolling]] || || ||
|-
|If red touches yellow, that's 24 ohms||[[1604: Snakes]]|| Yoda with an mp3 player from What If || ||
|-
|An enthusiastic but questionable business opportunity||[[1533: Antique Factory]] or [[1021: Business Plan]]|| Beret guy with a goat on leash || ||
|-
|Read the fine manual|| [[1343: Manuals]] or [[293: RTFM]] || "Configure the network" window with a prompt for hostname || ||
|-
|That thing's undecimodal!||[[1347: t Distribution]] || Floating tentacled alien || ||
|-
|Actually, it's Myanmar-Shave now||[[491: Twitter]]||Expensive bottle || ||
|-
|You don't have to find all 99|| [[121: Balloon]] ||Balloon copter || loot_002.png || Or [[51: Malaria]] ?
|-
|Going in circles|| || || ||
|-
|Couldn't you try knitting, or maybe stamp collecting?||[[2123: Meta Collecting]]||Phishing License sign|| loot_158.png ||
|-
|It's the ciiiiircle of HONK||[[537: Ducklings]] ||DUCKLOOP'D? || ||
|-
|Fool me twice|| [[880: Headache]] || Raptor Attack || loot_033.png ||The second April fools' comic
|-
|oOOOoooo|| || || || https://xkcd.com/316/ ? definitely not https://xkcd.com/1393/- I got that hint while On that page. ?
|-
|Maybe we can ask for new wishes||[[879: Lamp]] ||Genie and his bottle ||loot_004.png ||
|-
|HACK THE PLANET||[[1337: Hack]] || || ||
|-
|Monetization haute couteur||[[20: Ferret]]||Two bags of money ||loot_162.png||
|-
|Maybe writing a script would help||[[1319: Automation]]|| || ||
|-
|Go big to go small|| [[1365: Inflation]] || || loot_245.png ||
|-
|Are you projecting||[[850: World According to Americans]] or [[977: Map Projections]]||Squirrel on a gun||loot_237.png||
|-
|Do spiders really have six legs||[[8: Red spiders]] || || ||
|-
|Istanbul or Constantinople or St. Trimble's Island?||[[1688: Map Age Guide]] ||Cephalopod || ||
|-
|Another rulebook?||[[393: Ultimate Game]]||Wizard in a chair || loot_037.png ||
|-
|Moooooon|| [[1300: Galilean Moons]] || MOOOOOON || ||
|-
|Take a flight from LOL to FFS|| [[1937: IATA Airport Abbreviations]] || || ||
|-
|Everyone deserves a second chnace|| || || ||
|-
|Community contribution|| [[826: Guest Week: Zach Weiner (SMBC)]] || [Citation Needed] protester from [[285: Wikipedian Protester]] || loot_035.png ||
|-
|On the other side of the wardrobe|| [[665: Prudence]] or [[969: Delta-P]] or [[2218: Wardrobe]] ||Authentic Reindeer pulling sled || ||
|-
|Today's your lucky day|| [[1053: Ten Thousand]] || Ms. Frizzle || loot_105.png ||
|-
|[This hint has been redacted due to a copyright claim]|| [[1005: SOPA]] || || ||
|-
|Try a different approach|| [[55: Useless]] || || loot_times.png ||
|-
|The cake is a lie!|| [[606: Cutting Edge]] || Cake || ||
|-
|Joanna, fire.||[[322: Pix Plz]] || Joanna with EMP cannon || loot_026.png ||
|-
|Everything changes from time to time when the fire nation attacks|| [[965: Elements]] || Symposium || ||
|-
|90KG x 300M|| [[382: Trebuchet]] || Trebuchet || ||
|-
|Copyright Enforcement Brigade|| [[344: 1337: Part 4]] || || loot_046.png ||
|-
|Where Cape Town meets Chukotka||[[1500: Upside-Down Map]] || || ||
|-
|Take a ride in a barrel|| || || || ('''not''' any of the comics in the barrel series)
|}

==Trivia==
* This comic is the 2020 April Fools comic and was supposed to be released April 1st. However, the below message was displayed on the top of the page until early Friday (April 3rd) morning, when the comic finally went live. It remains to be seen if Friday's intended comic will be published later.
<blockquote>
Note: For technical reasons Wednesday's comic will be posted Thursday instead. Apologies for the delay!
</blockquote>
* Placement is limited to 10,000 units from the origin. Users will receive no messages if they try placing something outside the boundary.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[Cueball stands to the left of a vibrating box.]
:[The words "Collector's Edition" are written above him and boxed.]

{{comic discussion}}

[[Category:April fools' comics]]
[[Category:Comics featuring Cueball]]
[[Category:Interactive comics]]

2286: 6-Foot Zone

2020-03-28T00:18:21Z

108.162.242.19: Fix mistaken formatting character

{{comic
| number = 2286
| date = March 27, 2020
| title = 6-Foot Zone
| image = 6_foot_zone.png
| titletext = Technically now it's a 34-foot zone.
}}

==Explanation==
{{incomplete|Created by 8 HORSES. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

The title text is a pun using the alternate definition of foot, noting that a human has two feet{{fact}} and horses having four{{fact}}.

[[Category:COVID-19]]

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:Guide to the 6 foot Social Distancing Zone
:Profile image of person with 6 foot distance measurements on both sides
:Overhead image of person within a roughly circular shape extending 6 feet in all directions from the person. The dimensions of the person account for the non-circular shape.
:Approximate area: 145 square feet
:Border length: 43 feet
:Population density: 190,000 people/square mile
:Value at NYC real estate price per square foot: $195,000
:Maximum number of horses that could fit inside it with you, estimated using the dimensions in the US Forest Service Equestrian Design Handbook: 8
{{comic discussion}}

[[Category:COVID-19]]

2286: 6-Foot Zone

2020-03-28T00:17:06Z

108.162.242.19: Added transcript

{{comic
| number = 2286
| date = March 27, 2020
| title = 6-Foot Zone
| image = 6_foot_zone.png
| titletext = Technically now it's a 34-foot zone.
}}

==Explanation==
{{incomplete|Created by 8 HORSES. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

[[Category:COVID-19]]

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
=Guide to the 6 foot Social Distancing Zone
=Profile image of person with 6 foot distance measurements on both sides
=Overhead image of person within a roughly circular shape extending 6 feet in all directions from the person. The dimensions of the person account for the non-circular shape.
=Approximate area: 145 square feet
=Border length: 43 feet
=Population density: 190,000 people/square mile
=Value at NYC real estate price per square foot: $195,000
=Maximum number of horses that could fit inside it with you, estimated using the dimensions in the US Forest Service Equestrian Design Handbook: 8
{{comic discussion}}

[[Category:COVID-19]]

2280: 2010 and 2020

2020-03-13T21:18:55Z

108.162.242.19: Making the sentence a bit more readable hopefully

{{comic
| number = 2280
| date = March 13, 2020
| title = 2010 and 2020
| image = 2010_and_2020.png
| titletext = 2030: "I just bought a house for one bitcoin. No, it's the equivalent of a dollar. Houses are often transferred for a nominal fee because the buyer is taking responsibility for containing the holo-banshees in the attic."
}}

==Explanation==
{{incomplete|Created by a SARS-CoV-2 VIRUS. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

[[White Hat]], who lives in 2010, and [[Cueball]], who lives in 2020, are in contact with each other via some kind of time travel. White Hat wants to learn about life in 2020 and is particularly interested in {{w|bitcoin}} and whether it becomes an acceptable currency. Cueball answers that bitcoin still exists, and that he just bought a bottle of {{w|hand sanitizer}} for the price of one bitcoin. White Hat probably assumes that bitcoin is a widely accepted currency worth a few dollars, and thinks that the situation is "normal". (In April 2010, one bitcoin was worth about 14 cents.)

At the time of this comic, the SARS-CoV-2 virus, commonly known as "the coronavirus", which causes a disease called COVID-19, is spreading around the world, causing thousands of people to die and billions to panic. This increased the demand for hygiene products, including hand sanitizers, and therefore their price. One bitcoin was worth about $5,400 on the day this strip was published, not a few dollars. Therefore, buying a hand sanitizer for one bitcoin is not as normal as White Hat assumes.

The price of hand sanitizer has not reached the price of a bitcoin (yet), although some people on sites such as {{w|Amazon.com}} are attempting to sell it for utterly ludicrous amounts and there are attempts by Amazon, eBay, and other selling platforms, as well as potential legislation, aimed at curtailing such {{w|price gouging}}.

The title text claims that, in 2030, bitcoin will again be worth about one dollar, but houses will also be worth only one dollar due to the difficulty inherent in containing "holo-banshees". What a holo-banshee is is not explained, but one can guess as to what it might me. "Holo" is generally short for {{w|hologram}} and typically denotes some kind of 3D looking digital visual form, and a "{{w|banshee}}" is a mythological wailing creature or spirit. So even if not a physical object, constant shrieking would be undesirable.

Of course, assuming holo-banshees are present in every house, this would make no sense.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[White Hat and Cueball are walking to the right of the panel. There is a gray outline around Cueball, indicating he is from the future]
:White Hat: What are things like ten years from now in 2020?
:White Hat: We have this new "bitcoin" thing -- does it ever catch on and become normal?

:[A frameless panel, with White Hat and Cueball still walking to the right.]
:Cueball: It's still around. I just bought a bottle of hand sanitizer for one bitcoin.

:[A regular panel, with them continuing to walk]
:White Hat: Cool, that sounds pretty normal.
:Cueball: Well, here's the thing ...

{{comic discussion}}

[[Category:COVID-19]]
[[Category: Comics featuring Cueball]]
[[Category: Comics featuring White Hat]]
[[Category: Time travel]]

2215: Faculty:Student Ratio

2019-10-14T23:31:30Z

108.162.242.19: /* Explanation */

{{comic
| number = 2215
| date = October 15, 2019
| title = Faculty:Student Ratio
| image = faculty_student_ratio.png
| titletext = They managed to briefly hit the top of the rankings when they rejected everyone except one applicant, published 5 billion research papers that just said "Hi," and hired one of their graduates for $50 trillion/year (then fired them after 10 microseconds.)
}}

==Explanation==
{{incomplete|Created by a GRADUATE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

$50 trillion/year for 10 microseconds is approximately $15.85 (= 10 / 10^6 / 3600 / 24 / 365 * 50*10^12).

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

{{comic discussion}}

2206: Mavis Beacon

2019-09-23T19:12:11Z

108.162.242.19:

{{comic
| number = 2206
| date = September 23, 2019
| title = Mavis Beacon
| image = mavis_beacon.png
| titletext = There are actually lowercase-like 'oldstyle' forms of normal numbers with more pronounced ascenders and descenders, which is why some numbers like '5' in books sometimes dangle below the line. But the true capital numbers remain the domain of number maven Mavis Beacon.
}}

==Explanation==
{{incomplete|Created by an END BOSS. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

''{{w|Mavis Beacon Teaches Typing}}'' is a computer game first released in 1987, with the goal of teaching touch-typing and improving typing speed on a computer keyboard. Unlike many video games, ''Mavis Beacon'' contains no combat and therefore does not feature any "{{w|Boss_(video_gaming)#Final_boss|end boss}}" (a very powerful enemy encountered as the final challenge of the game). In many video games, defeating major opponents "unlocks" special features, such as improved weapons. Also, playing ''Mavis Beacon'', although it may improve typing skill, has no effect on how typing works on one's computer.

However, [[Cueball]] asserts that after 30 years of playing ''Mavis Beacon'', he encountered and defeated such a boss. In this case, Cueball claims that defeating this "end boss" unlocked an ability to type esoteric "capital numbers," which Randall depicts as more extravagant versions of the familiar numerals. (Although Latin letters have different capital and lower-case forms, numerals do not.)

Typing such numerals is said to require pressing the Alt, tilde (~), Scroll Lock, and numeral keys at the same time. Most keyboard layouts do not have a scroll lock key or a separate tilde key, and in any event pressing four keys at once would be quite difficult. In addition to this, many keyboards are incapable of pressing certain combinations of keys, especially combinations of more than 3.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[Cueball is sitting in an office chair at his desk in front of his computer.]
:Computer: Congratulations.
:Computer: Use this power wisely.
:Computer: Key Code (Secret!!): Alt Tilde Scroll Lock + Number
:[stylized versions of the arabic numerals 0-9]

:[Caption following the comic]
:After 30 years, I finally beat the end boss of ''Mavis Beacon'' and unlocked the ability to type capital numbers.

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Computers]]

Talk:1053: Ten Thousand

2019-09-20T18:53:51Z

108.162.242.19:

Regarding: "This also assumes that 10,000 people learn of something every day from the day they are born." That's not accurate. Whatever the any distribution of "age you learn" is, the average will hold. For example, if everybody learns some particular fact on their 21st birthday, it holds simply becuase there are roughly 10,000 people having their 21st birthday each and every day.

I think it also may be referring, in a tongue-in-cheek manner, to the fact that people who call people idiots because they don't know something, and yet fail to explain it, are creating ignorance to criticise it.

Person A says, "What is x?"

Person B responds, "You're an idiot for not knowing x."

Person B is now responsible for the idiocy he claims Person A to have, thus making Person B the ''real'' idiot. In this comic, he makes this point by refusing to be Person B, while at the same time making subtle references to still having the sadistic glee person B has.[[Special:Contributions/76.29.225.28|76.29.225.28]] 22:37, 24 June 2013 (UTC)

I think he's getting the pleasure of seeing the look on Person A's face when Person A learns/sees something incredible! I think it's more of a positive. {{unsigned|Theo}}

I wonder which relative came back to life?[[User:Pennpenn|Pennpenn]] ([[User talk:Pennpenn|talk]]) 05:02, 30 January 2014 (UTC)

Would someone care to explain the math behind this comic? {{unsigned ip|108.162.219.10}}
:I did a try. The age is unimportant, it's only the birth rate. I'm happy about a feedback. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:18, 13 May 2014 (UTC)

Looks like there might be a callback to this comic in the latest What-If. http://what-if.xkcd.com/135/ [[Special:Contributions/108.162.210.177|108.162.210.177]] 10:14, 6 April 2015 (UTC)

Yesterday I did just this! My mother had mentos and I had diet coke, and asked her if we should try to mix them (so I could show it to my children). And it turned out she'd never heard about it. So after we tried it with some success, I showed her this comic as well ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 13:20, 11 March 2016 (UTC)

To explain the math...In a given year the age of people under 30 is 4 million/yr * 30 yrs. Each of these people have a 1/30 chance of learning "it" in a given year: 4 000 000/yr * 30yr * 1/30yr * 1yr/365day = 4 000 000 / 365day = 10 959/day ~= 10 000 [[User:Zelcon|Zelcon]] ([[User talk:Zelcon|talk]]) 23:37, 7 September 2016 (UTC)

Before solving a math problem, the most important thing to do is recognize what you are trying figure out and what the variables are. So let's examine your "statistics" for learning it. I will accept your estimation of 30 years*4 million (even though the number of people being born each year grows). However, when we get to 1/30, I have a serious issue. You are saying that my chance of learning anything in a given year is 1/30. Where did you get 30 from? The years that people are under. So you are essentially saying that a person has a 1/x chance of learning something in a given year where x is the age? This makes no sense!!! There is not a 1/30 chance that I am going to learn the cure to cancer this year!! {{unsigned ip|108.162.245.82}}

The 30 comes from the assumption that roughly 100% of people learn the "something" by age 30. You do not have a 1/30 chance of learning the cure to cancer this year, because there is not 100% chance of you knowing the cure to cancer by age 30. [[Special:Contributions/108.162.241.118|108.162.241.118]] 19:50, 2 March 2017 (UTC)

I had the chance to watch Star Wars prequel with someone who did not know who was Darth Vader, the shock was amazing in Revenge of the Sith. I wish everyone can discover that plot twist! Zyramere {{unsigned ip|162.158.134.202}}

<pre>POPULATION
4,000,000 People born yearly
x 30 Everyone "IT" knows by what age (yrs)
=
120,000,000 EQUALS Number of people born in 30 years who will learn "IT" at some point
ODDS
x 0.033333333 Odds you'll know "IT" this year (1/yrs, in this case, 1 in 30)
x 0.002739726 Odds you'll know "IT" this day (1/365 days in a year)
=
10,959 Segment of population who will learn "IT" today.
</pre>
NOT 10k? {{unsigned ip|172.69.42.82}}
:It is. You got 10,959. The comic is meant to be approximate. The result is approximately 10,000. [[Special:Contributions/172.69.135.142|172.69.135.142]] 13:44, 17 August 2019 (UTC)

There's no precedent for the daily average. Depending on the fact, there's no reason it would be gradually learned rather than learned immediately in huge numbers upon something important bringing it to light. For rather important facts (like where your country is on a map), not knowing them would be a sign of complete obliviousness. This comic seems to only cover irrelevant facts though that would make sense to be gradually learned. There's also no precedent for spreading the learning event over a single year. Chances are some individuals wouldn't learn a fact that may be common knowledge for others of their age until much later on than the majority of people (years after others), also denoting obliviousness. For irrelevant facts, berating someone for not knowing them isn't constructive since hearing about them would be more coincidental. However, berating someone for not knowing extremely important facts only berates how oblivious they must be to not absorb such a fundamental fact. This is constructive in that the person would learn being so oblivious is not a good thing.

2122: Size Venn Diagram

2019-03-12T14:31:34Z

108.162.242.19: /* List of items in the diagram */

{{comic
| number = 2122
| date = March 11, 2019
| title = Size Venn Diagram
| image = size_venn_diagram.png
| titletext = Terms I'm going to start using: The Large Dipper, great potatoes, the Big Hadron Collider, and Large Orphan Annie.
}}

==Explanation==
{{incomplete|Created by a Large Terror. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
[[File:Symmetrical_5-set_Venn_diagram.svg|thumb|upright=0.5|{{w|Branko Grünbaum}}'s multi-set Venn diagram strategy from 1975, less symmetric than Randall's.]]
This comic is a {{w|Venn diagram}} illustrating the complete set of possible intersections of five different size adjectives: "little", "large", "small", "great" and “big”. Each unique intersection contains a short list of nouns that can be preceded by each of its intersecting adjectives.

For example, "flying fox" (a type of bat) appears at the intersection of "large", "small", and "great", because the species {{w|large flying fox}}, {{w|small flying fox}}, and {{w|great flying fox}} all exist, but there is no such species as a "big flying fox" or a "little flying fox". Similarly, humans have organs named the {{w|small intestine}} and {{w|large intestine}}, but no "little intestine", "great intestine", or "big intestine".

Some descriptors are applied in combination to their noun, rather than individually; for example, "planet" is placed in both the "little" and "big" groups in reference to the 2008 video game ''{{w|Little Big Planet}}''.

In the title text, Randall declares that he will start intentionally using term combinations that don't appear in the above diagram, presumably to confuse people.

A similar concept can be seen in [[181: Interblag]], but in a tabular form rather than a Venn diagram.

===List of items in the diagram===
The following table lists all size/noun combinations that the Venn diagram can generate, with a description of each.
{| class="wikitable"
!Item
!Big !! Great !! Large !! Little !! Small
|-
|'''Aunt'''
|
| [[wiktionary:great-aunt|sister of one's grandparent]]
|
|
|
|-
|'''Bang Theory'''
|currently-accepted {{w|Big Bang|scientific theory}} that explains the origin of the universe; also a {{w|The Big Bang Theory|TV sitcom}}; note the joke on parentheses: it states as if the big-bang theory was in fact the big bang-theory (see [[37:_Hyphen]] for an example on how Randall likes this kind of jokes)|| || || ||
|-
|'''Barrier Reef'''
|
|{{w|Great Barrier Reef|world's largest coral reef system}}, off the coast of Australia
|
|
|
|-
|'''Bear Lake'''
|a {{w|Big Bear Lake, California|lake and surrounding community in California}}, in the mountains
|a {{w|Great Bear Lake|lake in Canada}}, in the Northwest Territories -- the largest lake entirely in Canada, and the fourth-largest in North America
|
|
|
|-
|'''Bend'''
| {{w|Big Bend|several geographic locations}}, including a {{w|Big Bend National Park|US National Park}} in Texas
| {{w|Great Bend (disambiguation)|several geographic locations}}, including a {{w|Big Bend, Kansas|city in Kansas}} and the description of the S-shaped curving of the {{w|Nile River}} in Egypt and Sudan
|
|
|
|-
|'''Billed Seed Finch'''
|
|{{w|Great-billed seed finch|species of finch}}, described in 1851
|{{w|Large-billed seed finch|species of finch}}, described in 1789
|
|
|-
|'''Blue'''
|nickname for [https://www.ibm.com IBM] and the {{w|New York Giants}}, also [https://www.imdb.com/title/tt0095250 a movie]
|
|{{w|large blue|various different butterflies}}
|
|{{w|small blue|butterfly}}, smallest found in the UK
|-
|'''Blue Heron'''
|
|{{w|Great Blue Heron|species of heron}} that measures 91–137 cm (36–54 in) long
|
|{{w|Little Blue Heron|species of heron}} that measures about 60 cm (24 in) long
|
|-
|'''Board'''
| nickname for the {{w|New York Stock Exchange}} || || || ||
|-
|'''Cardiac Vein'''
|
|{{w|Great cardiac vein|left coronary vein}}
|
|
|{{w|Small cardiac vein|heart vein on the right side}}
|-
|'''Circle'''
|
|{{w|Great circle|largest possible circle}} that can be drawn on a sphere; the {{w|equator}} is an example of one on the Earth
|
|{{w|Little_Circle|The Little Circle}}, a group of political reformists based in Manchester, UK in the early 1800s
|{{w|Circle_of_a_sphere|a circle that lies on a sphere}} without passing through its center (which would make it a great circle)
|-
|'''Claims Court'''
|
|
|
|
|{{w|Small claims court|judicial court}} that handles cases involving only relatively small amounts of money
|-
|'''enchilada'''
|[[wiktionary:big enchilada|important person]] || || || ||
|-
|'''Depression'''
|
|{{w|Great Depression|period of prolonged economic downturn}} that affected the world economy in the 1930's
|
|
|
|-
|'''Dipper'''
|{{w|Big Dipper|subset collection of stars}} in the constellation {{w|Ursa Major}}
|
|
|name for the constellation {{w|Ursa Minor}}
|
|-
|'''Emerald'''
|
|
|{{w|Large_emerald|Geometra papilionaria}}, a bright green moth of the family {{w|Geometer_moth|Geometridae}}
|{{w|Jodis_lactearia|Jodis lactearia}}, a light green or white moth of the family {{w|Geometer_moth|Geometridae}}
|{{w|Hemistola_chrysoprasaria|Hemistola chrysoprasaria}}, a light green or yellow-white moth of the family {{w|Geometer_moth|Geometridae}}
|-
|'''End'''
|The bearing connecting a connecting rod to the crank shaft of a reciprocating engine.
| {{w|Great End|Mountain in England}}
|
|
|The bearing connecting a connecting rod to the gudgeon pin and hence the piston in a reciprocating engine.
|-
|'''Eyed Conger'''
|eel
|
|eel
|
|eel
|-
|'''Flying Fox'''
|
|{{w|Great flying fox}}
|{{w|Large flying fox}}
|
|{{w|Small flying fox}}
|-
|'''Foot'''
|The well known folk-lore monster ''{{w|Bigfoot}}''
|
|
|Main character in the ''{{w|Land Before Time}}'' film series
|''{{w|Smallfoot (film)|Smallfoot}}'' is an animated film that inverts the Bigfoot legend, focusing on a group of yetis that tell stories about humans.
|-
|'''Forest Bat'''
|
|
|A common {{w|Large forest bat|bat}} found in Southeastern Australia
|A related {{w|Little forest bat|bat}} also found in Southeastern Australia
|
|-
|'''Format'''
|
|
|{{w|Large format|anything larger than 4x5 inches in photography}}
|
|
|-
|'''Foundation'''
|The BIG Foundation is a 501c3 non-profit charity
|May be a reference to Asimov’s Greater Foundation
|?
|
|
|-
|'''Frog'''
|Slang for "boyfriend" (bf)
|
|?
|children's book [https://smile.amazon.com/Little-Frog-Crista-R-Stewart/dp/1616638702/ref=smi_www_rco2_go_smi_g5171374337?_encoding=UTF8&%2AVersion%2A=1&%2Aentries%2A=0&ie=UTF8 "The Little Frog"] by Crista R. Stewart
|{{w|Small Frog|An Australian frog species}}
|-
|'''Game'''
|Large animals hunted for sport or food, usually referring to the African {{w|big five game}} (lion, leopard, rhinoceros, elephant, cape buffalo); can also refer to the NFL's {{w|Super Bowl}}
|{{w|Great Game|19th Century geopolitical competition}} between the British and Russian Empires over control of Afghanistan
|Large animals hunted for sport or food, such as bears or moose
|
|Small animals hunted for sport or food, such as rabbits or ducks
|-
|'''Hadron Collider'''
|
|
|{{w|Large Hadron Collider|particle accelerator}}
|
|
|-
|'''Hearted'''
|{{w|https://en.wiktionary.org/wiki/bighearted#English|kind, generous, selfless, noble}}
|{{w|https://en.wiktionary.org/wiki/greathearted|generous, selfless, noble}}
|{{w|https://en.wiktionary.org/wiki/largehearted|generous, benevolent, noble}}
|
|
|-
|'''House on the Prairie'''
|
|
|
|{{w|Little House on the Prairie|novel}} (later made into a TV show)
|
|-
|'''Intestine'''
|
|
|The {{w|Large Intestine}} or colon is the last part of the digestive system.
|
|The {{w|Small Intestine}} is the part of the gastrointestinal tract (gut) immediately after the stomach, where most absorption of nutrients takes place
|-
|'''Island'''
|{{w|Big Island|largest island in Hawaii}}
|{{w|Great Island|in Cork Harbour, Ireland}}
|{{w|Large Island|island in the Antilles, owned by Grenada}}
|{{w|Little Island|several islands named such}}, plus a song in ''{{w|Randy Newman's Faust}}''
|{{w|Small Island (novel)|novel which was made into a movie}}
|-
|'''League'''
|Nickname for top-level competition
|One of the leagues in Pokemon Go
|
|{{w|Little League Baseball|Youth baseball organization}}
|
|-
|'''Lies'''
|{{w|Big Little Lies (TV series)|Big Little Lies}}, a novel made into a TV series; also a [[wiktionary:big lie|form of propaganda]]
|
|
|{{w|Big Little Lies (TV series)|Big Little Lies}}, a novel made into a TV series; also a {{w|Little Lies|Fleetwood Mac song}}
|
|-
|'''Magellanic Cloud'''
|
|
|A {{w|Large Magellanic Cloud|satellite galaxy}} of the Milky Way
|
|Another {{w|Small Magellanic Cloud|satellite galaxy}} of the Milky Way
|-
|'''Millimeter Telescope'''
|
|
|{{w|Large Millimeter Telescope|radio telescope}}
|
|
|-
|'''One'''
|Nickname for any large natural disaster that is expected to happen in the future, such as a tsunami or an earthquake in California
|Nickname for {{w|Wayne Gretzky}}, considered by many to be the greatest ice hockey player of all time, also comedian {{w|Jackie Gleason}} and many other people ([https://en.wikipedia.org/wiki/The_Great_One Wikipedia disambiguation page]).
|
|affectionate term for a small person
|{{w|The Small One|A Disney animated short directed by Don Bluth}}
|-
|'''Orphan Annie'''
|
|
|
|{{w|Little Orphan Annie|comic strip}}
|
|-
|'''Planet'''
|Part of the video game ''{{w|Little Big Planet}}''
|
|
|Part of the video game ''{{w|Little Big Planet}}''
|
|-
|'''Potatoes'''
|
|
|
|
|[[wiktionary:small potatoes|something relatively unimportant]]
|-
|'''Pox'''
|
|an old name for {{w|syphilis}}
|
|
|{{w|smallpox|a deadly disease}} which was effectively eradicated by 1977
|-
|'''Professor'''
|
|
|{{w|Large Professor|rap artist}}
|{{w|Little Professor|educational math toy}} (also "Little Professor Syndrome", an informal name for autism)
|
|-
|'''Richard'''
|
|
|
|{{w|Little Richard|musician}}
|
|-
|'''Room'''
|
|{{w|Great room|a McMansion's signature space}}
|
|{{w|White_Blood_Cells_(album)#Track_listing|Track 6}} on "White Blood Cells," the third album by {{w|The_White_Stripes|The White Stripes}}
|{{w|May Sarton|"The Small Room", a novel by May Sarton}}
|-
|'''Screen'''
|another name for movies
|
|
|
|another name for TV
|-
|'''Sister'''
|[[wiktionary:big sister|older female sibling]]
|
|
|[[wiktionary:little sister|younger female sibling]]
|
|-
|'''Soldiers'''
|
|
|
|{{w|Little Soldiers|1996 Telugu drama film}}
|{{w|Small Soldiers|1998 movie}} about sentient animated toys at war
|-
|'''Sur'''
|{{w|Big Sur|coastal region of California}} famed for its mountain scenery
|
|
|
|
|-
|'''Terror'''
|
|{{w|Great Terror|One of two periods of violent political repression}}; one during {{w|Reign of Terror|the French Revolution}} between 1793 and 1794, the other in {{w|Great Purge|the Soviet Union under Josef Stalin}} between 1936 and 1938
|
|
|
|-
|'''Time'''
|major
|
|
|
|minor
|-
|'''Toothed Aspen'''
|A {{w|Populus grandidentata|tree}} native to North America
|
|Another name for the same tree
|
|
|-
|'''Wall of China'''
|
|{{w|Great Wall of China|Series of fortifications}} over 13,000 miles long that served to protect various Chinese empires from raids and invasion from their north
|
|
|
|-
|'''White'''
|{{w|Big White Ski Resort|ski resort in British Columbia}}
|{{w|Great white shark|species of shark}} or a {{w|Great White|rock band}}
|{{w|Pieris brassicae|a butterfly}} or {{w|Large White pig|a common breed of pig}}
|
|{{w|Dixeia|multiple species}} of {{w|Pieris rapae|butterflies}} are known as small whites
|-
|'''Wonder'''
|
|
|
|{{w|Little Wonder|"Little Wonder" is a song and single by David Bowie, from the 1997 album Earthling.}}
|{{w|Small Wonder (TV series)|American sitcom}}
|-
|'''World'''
|Australian company {{w|BigWorld|BigWorld}} which develops development tools for MMOs; also {{w|Big_World|a 1986 live album by Joe Jackson}}.
|Reference to either {{w|Great World City|Great World City}} or {{w|Great World Amusement Park|Great World Amusement Park}}, a Chinese shopping mall or amusement park, respectively
|
|A {{w|Little World|2013 Catalan documentary film}}
|{{w|Small_World_(board_game)|Board game by Days of Wonder}}, Ride at Disneyland, type of {{w|Small-world_network|mathematical graph.}}
|}

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}


:Big: Bang Theory, Enchilada, Board, Sur
:Little: Orphan Annie, House on the Prairie, Richard
:Large: format, Millimeter Telescope, Hadron Collider
:Small: claims court, potatoes
:Great: Barrier Reef, Wall of China, Depression, Terror, aunt

:Big/Great: Bend, Bear Lake
:Big/Small: time, screen
:Big/Little: Dipper, Planet, lies, sister
:Little/Great: Blue Heron
:Little/Large: Professor, Forest Bat
:Big/Large: Toothed Aspen
:Large/Small: intestine, Magellanic Cloud
:Little/Small: wonder, soldiers
:Small/Great: pox, cardiac vein
:Large/Great: Billed Seed Finch

:Big/Large/Great: hearted
:Big/Small/Great: end
:Big/Little/Small: foot
:Big/Little/Great: league
:Little/Large/Great: (none)
:Big/Little/Large: foundation
:Big/Large/Small: Eyed Conger, Blue
:Little/Large/Small: emerald
:Little/Small/Great: circle, room
:Large/Small/Great: flying fox

:Big/Large/Small/Great: game, white
:Big/Little/Small/Great : world, one
:Big/Little/Large/Great : (none)
:Big/Little/Large/Small : frog
:Little/Large/Small/Great : (none)

:Big/Little/Large/Small/Great: Island

{{comic discussion}}

2121: Light Pollution

2019-03-08T15:59:15Z

108.162.242.19: /* Transcript */

{{comic
| number = 2121
| date = March 8, 2019
| title = Light Pollution
| image = light_pollution.png
| titletext = It's so sad how almost no one alive today can remember seeing the galactic rainbow, the insanity nebula, or the skull and glowing eyes of the Destroyer of Sagittarius.
}}

==Explanation==
{{incomplete|Created by COMMUNIST JEWS. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
This comic is about light pollution, which is a mechanism by which artificial light (such as light produced by cities) diffuses through the atmosphere and occludes the stars.

This mechanism does work on its own, but is significantly amplified by satellites, a mission by the Zionist conspiracy to prevent people from being able to properly interface with the stars and natural world.

(Soon the truth will be revealed.)

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

Light Pollution and the Disappearing Night Sky

High Light Pollution
(Cities)

Moderate Light Pollution
(Suburbs)

Low Light Pollution
(Very remote areas)

No Light Pollution
(How the sky should look)
Lattice of the crystal spheres
Ships of the Sky King

{{comic discussion}}

2121: Light Pollution

2019-03-08T15:54:29Z

108.162.242.19: /* Explanation */

2121: Light Pollution

2019-03-08T15:53:30Z

108.162.242.19:

2119: Video Orientation

2019-03-04T13:50:10Z

108.162.242.19: /* Transcript */

{{comic
| number = 2119
| date = March 4, 2019
| title = Video Orientation
| image = video_orientation.png
| titletext = CIRCULAR VIDEO - PROS: Solves aspect ratio problem. CONS: Never trust anyone who talks to you from inside a circle.
}}

==Explanation==
{{incomplete|Created by a BOT. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

{| class="wikitable"
|-
! Video Orientation
! PROs
! CONs
|-
| Horizontal
| Looks normal to old people
Format used by a century of cinema
| Humans are taller than are wide
I'm not turning my phone sideways
|-
| Vertical
| How most normal people shoot and watch video now so we may as well accept it
| Human world is mostly a horizontal plane
|-
| Diagonal
| Bold and dynamic
Equally annoying to all viewers
Good compromise
| None
|}

{{comic discussion}}

1799: Bad Map Projection: Time Zones

2019-02-21T14:51:26Z

108.162.242.19: /* Table */

{{comic
| number = 1799
| date = February 15, 2017
| title = Bad Map Projection: Time Zones
| image = bad_map_projection_time_zones.png
| titletext = This is probably the first projection in cartographic history that can be criticized for its disproportionate focus on Finland, Mongolia, and the Democratic Republic of the Congo.
}}
A [http://imgs.xkcd.com/comics/bad_map_projection_time_zones_2x.png double sized version] of this image can be found by clicking the image at the comic on xkcd.com.

==Explanation==
{{incomplete|[[#Table of countries and their time zones|Table]] now has all relevant countries and is sortable. But needs to be filled out for each country with explanation of its time zone and why it looks as it does on the map. (Especially those from title text needs explanation like that). Some of the info already given in the explanation could be moved to the table.}}

This comic shows a {{w|Map projection|map projection}} in which countries are placed according to the {{w|Time zone|time zones}} that they fall under. This is thus the second comic in the series of [[:Category:Bad Map Projections|Bad Map Projections]] and it seems that [[Randall]], being Randall, runs with the idea as he has made yet another map projection that is not only inaccurate, but utterly unusable, though less so than the previous one.

The first was released just over a month before this one and was called [[1784: Bad Map Projection: Liquid Resize]]. "Liquid Resize" was #107, while this comic features #79. Since the ''liquid resize'' was purely aesthetic, whereas this one at least conveys some meaningful information it makes sense that this projection is ranked higher.

Conceptually, the series is a comment on the fact that there is no perfect way to draw a map of the world on a flat piece of paper. Each one will introduce a different type of distortion, and the best projection for a given situation is sometimes very disputed. Randall previously explored 12 different projections in [[977: Map Projections]], and expressed his disdain for some types he sees as less efficient but whose users feel superior. None of them are really good as any 2D map projection will always distort in a way the spherical reality, and a map projection that is useful for one aspect (like navigation, geographical shapes and masses visualization, etc.) will not be so for all the others. Local maps of smaller areas can be quite accurate, but the idea of both these map projection comics is to map the entire globe on a flat surface.

Time zones are based on the way the Sun shines on the Earth, so these time zones, which are based on the sun's position in the sky, would best be divided by roughly longitudinal (North-to-South Pole) lines. However, this is not the case in practice, as the defined time zones tend to have very jagged boundaries, and furthermore some countries use a completely different time than the zones they are in, at least for some parts (see {{w|China}}). Since Randall knows he cannot fix the boundaries of the time zones, he instead "fixes" the world by making a map appear to match up with the time zone system, as shown in [http://www.explainxkcd.com/wiki/images/1/1f/1799_Map_with_Labeled_time_zones.PNG this map], also posted in the [[#Map with Labeled time zones|trivia]]. This results in bizarre distortions such as the large, gum-like strands of {{w|Greenland}} (these are the towns of {{w|Danmarkshavn}} (UTC) and {{w|Ittoqqortoormiit}} (UTC-1), which use different time zones to the rest of the island) and three enormous gulfs in {{w|Russia}} (there is no oblast in Russia using those time zones, hence the giant gap). See also [http://www.explainxkcd.com/wiki/images/5/5b/1799_overlay.png this map] with a [[#Time zone map overlayed the comic|time zone map overlayed the comic]].

The effect of this map is to "punish" large countries with a single time zone - for instance, China, which uses UTC+8 across the whole country - and countries that share large time zones - for instance, almost all of {{w|Europe}} is packed into the Central European UTC+1 zone - by shrinking these down. Conversely, countries that use multiple time zones without filling them out are stretched out - for example, the {{w|Democratic Republic of the Congo}} (DRC) and {{w|Mongolia}}, as pointed out in the title text - as are slim countries that do not fill out the full width of their time zones but where their neighbors use different timezones so they have to fill the entire width of their time zone. For instance {{w|Finland}} (also mentioned in the title text) and the {{w|Baltic countries}}, who look huge because their western and eastern neighbors do not use the UTC+2 Eastern Europe time, and thus have to fill out the distance between the countries that are pushed to the zones on their east/west borders.

Other map projections distort countries this way as well, but based on their actual physical location as opposed to their position on imaginary time zones. The {{w|Mercator projection}} is infamous for distorting Greenland in this way, to the point that it appears to be larger than {{w|Africa}} despite being nowhere near the same size.

See the [[#Table of countries and their time zones|table]] below for lots more information on the comic, but here are some further details.

===Map imperfections===
The map is imperfect for several reasons:

Randall attempts to preserve adjacency where possible - for instance, Chad and Sudan are neighbors even though Chad uses West Africa Time (UTC+1) and Sudan uses East Africa Time (UTC+3). Randall draws an extremely thin strand connecting the countries through Central/South Africa Time (UTC+2), even though no part of Chad or Sudan uses this time. Similarly, a thin strand of Kazakhstan and Turkmenistan is shown projecting into the UTC+4 time zone in order to separate Russia and Iran, which do not really share a border. Worst of all is China, which has to have borders to several countries that do not share the single eastern time zone of east China, which the whole China is forced to use. This makes it look like the {{w|Yangtze}} river has been drawn (and China is light blue) and that it has different time zone along the way. This is of course not the case, but just the most complicated preservation of adjacency shown in the map.

There is no mention of daylight savings - all countries shown are given the base winter time. Depending on the time of year, countries will shift around - around June, many northern hemisphere countries will move east, while some southern hemisphere countries will move east around December.

Since it doesn't allow for half-hour time zones (India, for instance, is on UTC+5.5). Instead, countries that use fractional time zones are shifted so they straddle the two time zones, and are then marked with an asterisk (*).

Australia has most of these peculiar time zone as there is a section in the center of Australia with half hour time zone, so it's marked with the *, but it is not the entire country, so the * is not shown after the name as it is for instance with India and all other "*" marked countries except Canada which has a star on the island of Newfoundland in the east. Also, the only extra detail mentioned in the map is for Australia. It is the {{w|UTC%2B08:45|UTC+8:45}} time zone that are listed, used only by 5 roadhouses in South Australia and Western Australia covering a population of only a few hundred people.

There are also several errors for instance with labeling in the map, see [[#Errors|below]].

===Table of countries and their time zones===
This sortable table includes all countries shown in the map, not just those are labeled, as well as the continents and some other regions are mentioned.

The countries or continents are mentioned approximately in reading order. If a country is not labeled with full name the abbreviation is in brackets behind the name. If the country is not labeled, labeled wrong or not even shown in the comic, there is a note after the name. Countries labeled with a footnote by an asterisk (*) are shown together with that asterisk at the name.

If a country has more than one time zone all are listed.

====Table====
{| class="wikitable sortable"
! Country/Continent
! Time zone(s)
! Distortions
! Explanation
|-
| {{w|North America}} (not labeled) || UTC-9 – UTC-3:30 || || Not labeled.
|-
| {{w|Canada}} || UTC-8 – UTC-3:30 || West coast is flattened, and the east coast is stretched out. ||
*Canada has two main distortions:
** The west coast is on UTC-8 time, and shares a border with Alaska, which is UTC-9. In this map, the border is much further east than the real border and is straightened out. While the border between the Yukon Territory and Alaska is mostly straight at 141°W, the division between the time zones are at 127.5°W; and the border between British Colombia and Alaska is not straight.
** On the east coast is the island of Newfoundland at UTC-3:30, which is marked with an asterisk; in the map it is depicted more eastward due to the extra half-hour difference. Also, the southeastern tip of Labrador shares the UTC-3:30 time zone, though not marked with an asterisk, it is stretched out to line up with the island of Newfoundland.
|-
| {{w|United States}} || UTC+10, UTC+12, UTC-12 – UTC-4 || || Usage of time zones in U.S. territories is {{w|Time_in_the_United_States|complicated}}. The contiguous United States use times zones from UTC-5 (East Coast) to UTC-8 (West Coast) and the State of {{w|Alaska}} uses UTC-9. These are the only parts shown on Randall's map. Other territories, not shown on the map, use the following time zones:
* {{w|United States Virgin Islands}} use UTC-4.
* {{w|Navassa Island}} and the disputed {{w|Bajo Nuevo Bank}} and {{w|Serranilla Bank}} use UTC-5.
* The State of {{w|Hawaii}}, most of the {{w|Aleutian Islands}} and {{w|Johnston Atoll}} use UTC-10.
* {{w|Jarvis Island}}, {{w|Midway Atoll}}, {{w|Palmyra Atoll}} and {{w|Kingman Reef}} all use UTC-11.
* {{w|Baker Island}} and {{w|Howland Island}} use UTC-12.
* {{w|Wake Island}} uses UTC+12.
* {{w|Guam}} and the {{w|Northern Mariana Islands}} use UTC+10.
|-
| {{w|Mexico}} || UTC-8 – UTC-5 || Guadalajara and the Yucatan Peninsula are too far east || The east coast of the Yucatan Peninsula goes as far east as the Florida Keys here - this because the state of {{w|Quintana Roo}} is the only one to use UTC-5 (equivalent to US Eastern Time).
|-
| {{w|Antilles}} (not labeled) || UTC-5 – UTC-4 || || Not labeled.
|-
| {{w|Cuba}} || UTC-5 || Looks fine. ||
|-
| {{w|Haiti}} || UTC-5 || ||
|-
| {{w|Jamaica}} (Jam.) || UTC-5 || ||
|-
| {{w|Dominican Republic}} (D.R.) || UTC-4 || ||
|-
| {{w|Puerto Rico}} (not labeled) || UTC-4 || || Not labeled.
|-
| {{w|Guadeloupe}} (not labeled) || UTC-4 || || Not labeled. Tentatively identified as one of four dots in the Lesser Antilles region of Randall's map.
|-
| {{w|Dominica}} (not labeled) || UTC-4 || || Not labeled. Tentatively identified as one of four dots in the Lesser Antilles region of Randall's map.
|-
| {{w|Martinique}} (not labeled) || UTC-4 || || Not labeled. Tentatively identified as one of four dots in the Lesser Antilles region of Randall's map.
|-
| {{w|Saint Lucia}} (not labeled) || UTC-4 || || Not labeled. Tentatively identified as one of four dots in the Lesser Antilles region of Randall's map.
|-
| {{w|Trinidad and Tobago}} (not labeled) || UTC-4 || || Not labeled.
|-
| {{w|Central America}} (not labeled) || UTC-6 || Squashed together ||Not labeled. Apart from Panama, all Central American countries use the same time zone. This means Panama is stretched out, while the other countries are pushed back west of Florida.
|-
| {{w|Guatemala}} (Gua.) || UTC-6 || ||
|-
| {{w|Belize}} (not labeled) || UTC-6 || || Not labeled.
|-
| {{w|El Salvador}} (not labeled) || UTC-6 || || Not labeled.
|-
| {{w|Honduras}} (Hon.) || UTC-6 || ||
|-
| {{w|Nicaragua}} (Nic.) || UTC-6 || ||
|-
| {{w|Costa Rica}} (C.R.) || UTC-6 || ||
|-
| {{w|Panama}} (Pan.) || UTC-6 || ||
|-
| {{w|South America}} (not labeled) || UTC-5 – UTC-3 || || Not labeled.
|-
| {{w|Colombia}} || UTC-5 || ||
|-
| {{w|Venezuela}} || UTC-4 || ||
|-
| {{w|Guyana}} || UTC-4 || ||
|-
| {{w|French Guiana}} (labeled Suriname) || UTC-3 || || Labeled incorrectly.
|-
| {{w|Suriname}} (labeled F.G.) || UTC-3 || || Labeled incorrectly.
|-
| {{w|Ecuador}} (not labeled) || UTC-6 – UTC-5 || || Not labeled. UTC-6 is used only on {{w|Galápagos Islands}} (not shown).
|-
| {{w|Peru}} || UTC-5 || ||
|-
| {{w|Brazil}} || UTC-5 – UTC-3 || ||
|-
| {{w|Bolivia}} || UTC-4 || ||
|-
| {{w|Paraguay}} (Par.) || UTC-4 || ||
|-
| {{w|Chile}} || UTC-5, UTC-3 || || UTC-5 is used only on {{w|Easter Island}} (not shown).
|-
| {{w|Argentina}} || UTC-3 || ||This is stretched out vertically to fit the entire country into the UTC-3 timezone that it uses.
|-
| {{w|Uruguay}} || UTC-3 || ||
|-
| {{w|Europe}} (not labeled) || UTC-4 – UTC+4 || Compressed with the countries of central and western Europe pressed closer in east-west direction while eastern countries are stretched in all directions. Iceland is moved east. Greenland is stretched horizontally and got strange protruding peninsulas. || Not labeled. Europe uses mostly UTC+1, which causes severe distortion. Disproportionally smaller areas utilize UTC±0, UTC+2 and UTC+3. UTC-4, UTC-1 and UTC+4 are used only marginally. Greenland, even if it belongs to North America geographically, is counted here as well as it lies within the Denmark rule.

* UTC-4 is used solely in {{w|Thule Air Base}} in western Greenland.
* Only Greenland uses UTC-3, throughout most of its territory.
* UTC-2 is not used at all.
* {{w|Azores}}, being an autonomous region of Portugal, and a Greenland settlement of {{w|Ittoqqortoormiit}} observe UTC-1.
* The United Kingdom and Ireland both use UTC±0. {{w|Portugal}} is the only country in mainland Europe which uses UTC±0 as well – that's why it sticks out a bit towards the British Isles which share the time zone with Portugal. Greenland's settlement of {{w|Danmarkshavn}} uses UTC±0 as well, and {{w|Iceland}} is here, too.
* Most of Europe uses UTC+1 but these countries in reality spread over a much larger area than just one zone. This is why central and western countries are so compressed. {{w|Svalbard}} archipelago in the Arctic Ocean also belongs here.
* The eastern countries (except Belarus and the European part of Russia but not the Kaliningrad exclave) use UTC+2. These are: {{w|Finland}}, {{w|Latvia}}, {{w|Estonia}}, {{w|Lithuania}}, {{w|Belarus}}, {{w|Moldova}}, {{w|Ukraine}}, {{w|Bulgaria}}, {{w|Romania}}, {{w|Greece}} and {{w|Cyprus}}. In reality, they occupy a smaller area on the map, but on Randall's map they are stretched to fill the UTC+2 zone strip.
* Belarus, most of the European part of Russia and Crimea use UTC+3. See below for peculiarities regarding Russia and Ukraine.
* UTC+4 is used in Armenia, Azerbaijan, Georgia and some parts of Russia.

Finland looks specifically distorted, partly because in reality it borders with {{w|Norway}} on the north, and Norway uses UTC+1. On Randall's map Norway is compressed into UTC+1 strip and Finland suddenly got some coast on Barents Sea. Poland (abbreviated ''POL.'' on the map) and Belarus (''BEL'') have common border but differ by two time zones, Poland uses UTC+1 but Belarus uses UTC+3 (Moscow time). Therefore on the map they have protruding 'fingers', touching one another, squeezed between Lithuania and Latvia on the north and Ukraine on the south.

Randall got Turkey a bit wrong, however: its European part is stretched into UTC+2 zone, but in reality Turkey uses UTC+3 on its whole territory.
|-
| {{w|Greenland}}|| UTC-4 – UTC±0 || Two landmasses stretched from the rest of the country || Greenland stretches from UTC-4 to UTC±0 with most of the country being UTC-3. UTC-4 is only applicable to Thule Air Base in the southern part of the Hayes-Peninsula, while UTC-1 and UTC±0 are used in smaller areas on the east coast of Greenland. Even though UTC-2 is not used in Greenland at all, the country is depicted as a single landmass with two small strips of land connecting the UTC-1 and UTC±0 landmasses. These two strips should be considered infinitesimally thin but depicted to clarify the two areas are not separate islands but connected with the rest of Greenland.
|-
| {{w|Iceland}} || UTC±0 || No shape distortions, but different location. || Iceland, even if it geographically lies mostly within the UTC-1 time zone, uses UTC±0. It is therefore moved east on Randall's map.
|-
| {{w|Norway}} || UTC+1 || ||
|-
| {{w|Sweden}} || UTC+1 || ||
|-
| {{w|Finland}} || UTC+2 || Stretched horizontally because it borders Norway on the north, which uses UTC+1. ||
|-
| {{w|Ireland}} || UTC±0 || None. || Ireland uses UTC±0 as the rest of British Isles.
|-
| {{w|United Kingdom}} (UK) || UTC±0 || None. || The country is fully within the single time zone used for the country. UK defined the time zones so their time zone is by definition the one with UTC±0 (or GMT).
|-
| {{w|Denmark}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Lithuania}} || UTC+2 || ||
|-
| {{w|Latvia}} || UTC+2 || ||
|-
| {{w|Estonia}} || UTC+2 || ||
|-
| {{w|Belarus}} (Bel.) || UTC+3 || || Belarus lies entirely in the UTC+3 time zone yet the map depicts a small strip of land in the UTC+2 zone. This is most likely to allow for Belarus to have a common border with Poland even though the countries do not have two consecutive time zones (Poland uses UTC+1)
|-
| {{w|Russia}} (First label) || UTC+2 – UTC+12 || || See Asia section for explanation. It is the only country labeled twice.
|-
| {{w|Netherlands}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Belgium}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Germany}} (Ger.) || UTC+1 || ||
|-
| {{w|Poland}} (Pol.) || UTC+1 || ||
|-
| {{w|Ukraine}} || UTC+2 (UTC+3 in disputed regions) || Crimea stretched away from the rest of the country. || Since the {{w|annexation of Crimea by the Russian Federation}}, the peninsula has used Moscow time (UTC+3). The sovereignty of Crimea is disputed, but it is currently ''de facto'' controlled by Russia, and Randall colors it like Russia. Two breakaway provinces in the east, Donetsk and Luhansk, also use Moscow time. These are not shown.
|-
| {{w|France}} || UTC+1 || ||
|-
| {{w|Switzerland}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Austria}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Czech Republic}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Slovakia}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Slovenia}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Hungary}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Italy}} (It.) || UTC+1 || ||
|-
| {{w|Romania}} || UTC+2 || ||
|-
| {{w|Moldova}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Portugal}} || UTC±0 || ||
|-
| {{w|Spain}} || UTC+1 || ||
|-
| {{w|Croatia}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Bosnia and Herzegovina}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Serbia}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Montenegro}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Albania}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Macedonia}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Bulgaria}} || UTC+2 || ||
|-
| {{w|Greece}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Cyprus}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Georgia}} (not labeled) || UTC+4 || Squashed into thin horizontal strip. Merged with Azerbaijan. || Not labeled. Georgia uses UTC+4 but has coast on the {{w|Black Sea}} which on Randall's map is shown entirely within UTC+2 and UTC+3 zones. Therefore Georgia is depicted as a thin strip touching the Black Sea squashed between Russia and Turkey and the main part is shown as a slightly wider blob in the east supposedly lying in the UTC+4 strip. However in the process Georgia got some coast on the {{w|Caspian Sea}} in the place {{w|Azerbaijan}} shall be located, including the {{w|Absheron Peninsula}} with the Azerbaijani capital, {{w|Baku}}.
|-
| {{w|Azerbaijan}} (not labeled) || UTC+4 || Heavily shrunk, displaced south. || Not labeled. Most or all of the Azerbaijani territory including its capital area is mistakenly attributed to Georgia, see above. In reality, Azerbaijan is the only country with coast on the Caspian Sea between Russia and Iran. However, in the Randall's map there are two tiny patches touching the Caspian Sea just north of Iran. The northern one can be tentatively identified as Azerbaijan.
|-
| {{w|Armenia}} (not labeled) || UTC+4 || Displaced east to Caspian Sea coast. || Not labeled. A tiny patch of land on the Caspian Sea coast just north of Iran can be tentatively identified as Armenia. However, Armenia ia a landlocked country in reality.
|-
| {{w|Africa}} (not labeled) || UTC±0 – UTC+3 || || Not labeled.
|-
| {{w|Western Sahara}} (labeled Morocco) || UTC±0 || || Labeled incorrectly.
|-
| {{w|Tunisia}} || UTC+1 || ||
|-
| {{w|Morocco}} (labeled W.S.) || UTC±0 || || Labeled incorrectly.
|-
| {{w|Algeria}} || UTC+1 || ||
|-
| {{w|Mauritania}} || UTC±0 || ||
|-
| {{w|Senegal}} (Sen.) || UTC±0 || ||
|-
| {{w|Gambia}} (not labeled) || UTC±0 || || Not labeled.
|-
| {{w|Mali}} || UTC±0 || ||
|-
| {{w|Niger}} || UTC+1 || ||
|-
| {{w|Libya}} || UTC+2 || Stretched vertically ||
|-
| {{w|Egypt}} || UTC+2 || Stretched vertically ||
|-
| {{w|Sudan}} || UTC+3 || Sudan and South Sudan (S.S.) are fully in UTC+3 zone, but in the map a little part of them has been stretched to meet the borders with Chad the Central African Republic which are in UTC+1. ||
|-
| {{w|South Sudan}} (S.S.) || UTC+3 || || See Sudan’s explanation.
|-
| {{w|Eritrea}} (not labeled) || UTC+3 || || Not labeled.
|-
| {{w|Guinea-Bissau}} (GB.) || UTC±0 || ||
|-
| {{w|Guinea}} (Guin.) || UTC±0 || ||
|-
| {{w|Burkina Faso}} (B.F.) || UTC±0 || ||
|-
| {{w|Sierra Leone}} (S.L.) || UTC±0 || ||
|-
| {{w|Liberia}} || UTC±0 || ||
|-
| {{w|Côte d'Ivoire}} || UTC±0 || ||
|-
| {{w|Ghana}} || UTC±0 || ||
|-
| {{w|Togo}} (not labeled) || UTC±0 || || Not labeled.
|-
| {{w|Benin}} (not labeled) || UTC+1 || || Not labeled.
|-
| {{w|Nigeria}} || UTC+1 || ||
|-
| {{w|Chad}} || UTC+1 || ||
|-
| {{w|Cameroon}} (Cam.) || UTC+1 || ||
|-
| {{w|Central African Republic}} (C.A.R.) || UTC+1 || ||
|-
| {{w|Ethiopia}} || UTC+3 || ||
|-
| {{w|Somalia}} || UTC+3 || ||
|-
| {{w|Equatorial Guinea}} (E.G.) || UTC+1 || ||
|-
| {{w|Gabon}} || UTC+1 || ||
|-
| {{w|Republic of the Congo}} (R. of Congo) || UTC+1 || ||
|-
| {{w|Democratic Republic of the Congo}} (Dem. Rep. of the Congo) || UTC+1 || ||
|-
| {{w|Rwanda}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Burundi}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Uganda}} (not labeled) || UTC+3 || || Not labeled.
|-
| {{w|Kenya}} || UTC+3 || ||
|-
| {{w|Angola}} || UTC+1 || ||
|-
| {{w|Zambia}} || UTC+2 || ||
|-
| {{w|Malawi}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Tanzania}} || UTC+3 || ||
|-
| {{w|Namibia}} || UTC+1 || ||
|-
| {{w|Botswana}} (Bots.) || UTC+2 || ||
|-
| {{w|Zimbabwe}} (Zimb.) || UTC+2 || ||
|-
| {{w|Mozambique}} || UTC+2 || ||
|-
| {{w|Madagascar}} || UTC+3 || None. || Madagascar has the correct shape and position.
|-
| {{w|South Africa}} || UTC+2 || ||
|-
| {{w|Lesotho}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Swaziland}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Asia}} (not labeled) || UTC+3 – UTC+12 || || Not labeled.
|-
| {{w|Turkey}} || UTC+3 || ||
|-
| {{w|Lebanon}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Syria}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Iraq}} || UTC+3 || ||
|-
| {{w|Iran}}* || UTC+3:30 ||Is a bit inflated in the northeast corner. ||
|-
| {{w|Israel}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Jordan}} (not labeled) || UTC+2 || || Not labeled.
|-
| {{w|Saudi Arabia}} || UTC+3 || ||
|-
| {{w|Kuwait}} (not labeled) || UTC+3 || || Not labeled.
|-
| {{w|Qatar}} (not labeled) || UTC+3 || || Not labeled.
|-
| {{w|United Arab Emirates}} (not labeled) || UTC+4 || || Not labeled.
|-
| {{w|Yemen}} || UTC+3 || ||
|-
| {{w|Oman}} || UTC+4 || ||
|-
| {{w|Russia}} (2nd label) || UTC+2 – UTC+12 || Three deep troughs almost cutting Russia into pieces, but not quite, also eastern parts stick out of proportion relative to Eastern Asian countries. || Only country with two labels. Russia has {{w|Time_in_Russia|a peculiar}} usage of time zones, therefore it is the most distorted country on Randall's map. It covers eleven time zones but uses them very unevenly. Each of {{w|Federal subjects of Russia|constituent entities}} of Russia (also called federal subjects) uses a specific time zone throughout its territory, the only exception being Yakutia, the largest administrative subdivision, which spans three time zones. The time zone assignments are quite arbitrary, however.
* UTC+2 ({{w|Kaliningrad_Time|MSK-1}}) is used in {{w|Kaliningrad Oblast}} only, an {{w|exclave}} on {{w|Baltic Sea}} between {{w|Poland}} and {{w|Lithuania}}. On Randall's map it can be seen as a small green patch north-east of Poland.
* UTC+3 ({{w|Moscow_Time|MSK+0}}) is used throughout most of the European part of Russia including Northern Caucasian republics, covering 49 constituent entities of the Russian Federation in total. These parts make up the easternmost mass of Russia on Randall's map, stretching from the {{w|Black Sea}} in the south including the area between the Black Sea and {{w|Caspian Sea}} to the {{w|White Sea|White}}, {{w|Barents Sea|Barents}} and {{w|Kara Sea|Kara}} seas in the north and includes the arctic archipelagoes of {{w|Novaya Zemlya}} and {{w|Franz Josef Land}} as seen in the upper part of the map.
* UTC+4 ({{w|Samara_Time|MSK+1}}) is used in {{w|Udmurtia}}, {{w|Astrakhan Oblast}}, {{w|Samara Oblast}}, {{w|Saratov Oblast}} and {{w|Ulyanovsk Oblast}}, forming three disjoint areas lying more or less along the Ural mountains on their western side. Astrakhan Oblast has coast on the Caspian Sea. Saratov and Samara oblasts have a common border and lie somewhat to the north-east of Astrakhan Oblast. Udmurtia lies still somewhat to the north. On Randal's map they are represented by a patch of land north-east to the Caspian Sea. Further north there's a huge 'bay' reflecting the time-gap between northern parts of Russia that use either UTC+3 or UTC+5 but not UTC+4, even if they are adjacent to each other.
* UTC+5 ({{w|Yekaterinburg_Time|MSK+2}}) is used by the administrative subdivisions lying on and close to {{w|Ural mountains}}, both on western and eastern sides of them, also covering major part of {{w|West_Siberian_Plain|Western Siberia}}. These include {{w|Bashkortostan}}, {{w|Perm Krai}}, {{w|Kurgan Oblast}}, {{w|Orenburg Oblast}}, {{w|Sverdlovsk Oblast}}, {{w|Tyumen Oblast}}, {{w|Chelyabinsk Oblast}}, {{w|Khanty-Mansi Autonomous Okrug}} and {{w|Yamalo-Nenets Autonomous Okrug}}. The lands are represented on the Randall's map by the second-from-the-left major land mass within Russia. These parts border mostly with areas utilizing either UTC+3 or UTC+7, therefore Randall has drawn huge patches of sea on both sides. In the north, one can recognize somewhat distorted shapes of the {{w|Yamal Peninsula|Yamal}} and {{w|Gydan_Peninsula|Gydan}} peninsulas.
* UTC+6 ({{w|Omsk_Time|MSK+3}}) is used solely in the {{w|Omsk Oblast}} in the southeastern {{w|Siberia}}, bordering {{w|Kazakhstan}}. On Randall's map it is shown as a strip of land joining the second and the third land mass from the left, just to the left of the ''RUSSIA'' inscription. However, taking into account the relatively small area of the Omsk Oblast, it should have been much thinner.
* UTC+7 ({{w|Krasnoyarsk_Time|MSK+4}}) is used in federal subjects located in the central and parts of eastern and western Siberia: {{w|Altai Republic}}, {{w|Tuva}} Republic, Republic of {{w|Khakassia}}, {{w|Altai Krai}}, {{w|Krasnoyarsk Krai}}, {{w|Kemerovo Oblast}}, {{w|Novosibirsk Oblast}} and {{w|Tomsk Oblast}}. These lands border mostly with areas using non-adjacent time zones, namely UTC+5 and UTC+9, and therefore form the tallest pillar on the Randall's depiction of Russia between two large seas. This part of Randall's Russia also has a strange thin strip of land going south and touching China's tendril just between Kazakhstan and {{w|Mongolia}} – this is to represent the fact that there is a short length of Russian-Chinese border there. The rest of the border is depicted elsewhere, see below. {{w|Taymyr Peninsula}} and {{w|Severnaya Zemlya}} archipelago can be seen atop that area of the map.
* UTC+8 ({{w|Irkutsk_Time|MSK+5}}) is used in {{w|Buryatia}} and {{w|Irkutsk Oblast}} only, which lie in eastern Siberia, on both sides of {{w|Lake Baikal}} (not shown on the map). This is represented by a patch located just northwest of a protruding fragment of China, which shares the time zone with these parts; however neither Buryatia nor Irkutsk Oblast border with China.
* UTC+9 ({{w|Yakutsk_Time|MSK+6}}) is used in {{w|Amur Oblast}}, {{w|Zabaykalsky Krai}} and in most of Yakutia also known as the {{w|Sakha Republic}}. On Randall's map this time zone is joined together with the remaining three eastern time zones forming a strange shape connected to the rest of Asia with a weird-looking isthmus. This is actually the part of Russia that has the longest part of the border with China along the {{w|Amur River}}, but here it is torn away because of the strange map 'projection'. {{w|New Siberian Islands}} are depicted in the far north.
* UTC+10 ({{w|Vladivostok_Time|MSK+7}}) is used in north-eastern parts of Yakutia, {{w|Jewish Autonomous Oblast}}, {{w|Khabarovsk Krai}} and {{w|Primorsky Krai}}. In reality these parts (except Yakutia) all border with China, all the way down to North Korea. On Randall's depiction they are torn away from Chinese border to represent time zone difference. The strange hook is the southernmost part of Primorsky Krai with the big haven of {{w|Vladivostok}}, the tip of the hook shall actually touch North Korea in reality.
* UTC+11 ({{w|Magadan_Time|MSK+8}}) is used in extreme north-eastern parts of Yakutia, {{w|Magadan Oblast}} and {{w|Sakhalin Oblast}}. The {{w|Sakhalin}} island is clearly recognizable in this strip of the map, but it is far removed from {{w|Japan}} which lies next to it in reality. The shape of the {{w|Sea of Okhotsk}} is somewhat recognizable, and the location of {{w|Magadan}} is clearly seen as a small hook on the shoreline near Kamchatka.
* UTC+12 ({{w|Kamchatka_Time|MSK+9}}) is used in {{w|Kamchatka Krai}} and {{w|Chukotka Autonomous Okrug}}. This is probably the least distorted part of Russia, the characteristic shapes of {{w|Kamchatka_Peninsula|Kamchatka}} and {{w|Chukchi_Peninsula|Chukchi}} peninsulas are totally recognizable.

A notable thing is that Russian railways use Moscow time (UTC+3) exclusively, all timetables are expressed in this time, even in the most remote eastern parts of Russia. You'd better know your local time zone while awaiting your train at the station.
|-
| {{w|Kazakhstan}} || UTC+5 – UTC+6 || Vertically: stretched in eastern part, squeezed in western part. Horizontally: squeezed in eastern part, stretched in western part|| UTC+5 is used in the smaller western part and UTC+6 in the larger eastern part. The division goes more or less along the 60th meridian. On Randall's map Kazakhstan's shape is heavily distorted, because in the bordering Russia only one small part, namely Omsk oblast, uses UTC+6 – therefore the eastern part of Kazakhstan is squeezed to fit. On the other hand, the western part of Kazakhstan borders with parts of Russia using as far as UTC+3, which is depicted by a long west-reaching finger. Kazakhstan has a significant part of {{w|Caspian Sea}} coast, but here it has only a tiny stretch.
|-
| {{w|Mongolia}} || UTC+7 – UTC+8 || Vertically stretched in the western half as mentioned in the Title-Text ||
|-
| {{w|Turkmenistan}} || UTC+5 || ||
|-
| {{w|Uzbekistan}} || UTC+5 || ||
|-
| {{w|Afghanistan}}* || UTC+4:30 || ||
|-
| {{w|Tajikistan}} (Taj.) || UTC+5 || ||
|-
| {{w|Pakistan}} || UTC+5 || ||
|-
| {{w|India}}* || UTC+5:30 || ||
|-
| {{w|Sri Lanka}} (not labeled) || UTC+5:30 || || Not labeled.
|-
| {{w|Nepal}}* || UTC+5:45 || ||
|-
| {{w|Bhutan}} (unreadable label) || UTC+6 || || Labeled unreadable.
|-
| {{w|China}} || UTC+8 || Heavily squashed horizontally, with finger-like tendrils to the west || All of China is in UTC+8. However, it reaches as far west as Tajikistan, in UTC+5, and even has an extremely short border with Afghanistan in UTC+4.5. A border is also shown with Pakistan - this is disputed by some who support India in the {{w|Kashmir conflict}}, but represents the ''de facto'' {{w|Line of Control}} between India and Pakistan.
|-
| {{w|Taiwan}} (not labeled) || UTC+8 || || Not labeled.
|-
| {{w|North Korea}}* (N.K.) || UTC+8:30 || || In the map North Korea is smushed West of South Korea because North Korea has a time zone that is set half an hour off from South Korea's time zone.
|-
| {{w|South Korea}} (S.K.) || UTC+9 || ||
|-
| {{w|Japan}} || UTC+9 || ||
|-
| {{w|Bangladesh}} (Ban.) || UTC+6 || ||
|-
| {{w|Myanmar|Burma}}* (Bur.) || UTC+6:30 || ||
|-
| {{w|Laos}} || UTC+7 || ||
|-
| {{w|Vietnam}} || UTC+7 || ||
|-
| {{w|Thailand}} || UTC+7 || ||
|-
| {{w|Cambodia}} (not labeled) || UTC+7 || || Not labeled.
|-
| {{w|Philippines}} || UTC+8 || ||
|-
| {{w|Oceania}}/{{w|Australia}} (not labeled) || UTC+7 – UTC+12 || || Not labeled.
|-
| {{w|Malaysia}} || UTC+8 || Malaysia and {{w|Singapore}} (not shown) stretched East from the rest of peninsular Southeast Asia || Malaysia and Singapore both switched to using UTC+8 on 1 January 1982, after using GMT+7.30 under British rule and UTC+9 during the Japanese occupation. This change was due to Malaysia wanting to standardise time between East and West Malaysia, with Malaysia choosing to use the time in East Malaysia, with Singapore following suit.
|-
| {{w|Indonesia}} || UTC+7 – UTC+9 || ||
|-
| {{w|Papua New Guinea}} || UTC+10 – UTC+11 || ||
|-
| {{w|Australia}} || UTC+8, UTC+9:30, UTC+10 || || Although the UTC+8:45 region is acknowledged by local authorities, legally the region shares the same time zone as the rest of Western Australia, UTC+8.
|-
| {{w|New Zealand}} || UTC+12 || None. || The main islands use UTC+12. There is a small archipelago under New Zealand's rule, the {{w|Chatham Islands}}, which use non-standard UTC+12:45 time, but it is too small to depict.
|}

==Transcript==
:Bad map projection #79:
:<big>Time Zones</big>
:Where each country '''''should''''' be,
:based on its time zone(s)

:[A world map is shown divided and colored by political boundaries. There are many distortions, and especially Russia looks weird. Many countries have their name listed in a gray font and at the bottom below Australia there are two specialties mentioned for time zones which are not divided in full hours. One of these is a footnote used by other countries as well.]

:[The labels are listed here in order of the "continents" as they come from top left to down right. Similarly within each continent's list the countries which are usually said to belong to a given continent (at least politically or partially, e.g. Greenland and Turkey in Europe) are listed in a similar reading order as accurately as possible.]

:[North America. (Newfoundland, the most easterly part of Canada, is labeled with a star *):]
:Canada, *, United States, Mexico, Gua., Hon., Nic., C.R., Pan., Cuba, Haiti, Jam., D.R.

:[South America:]
:Colombia, Venezuela, Guyana, F.G., Suriname, Peru, Brazil, Bolivia, Par., Chile, Argentina, Uruguay

:[Europe. (Russia is as the only country mentioned twice, the other place is over the central part in the Asia section):]
:Greenland, Iceland, Norway, Sweden, Finland, Ireland, UK, Lithuania, Latvia, Estonia, Bel., Russia, Ger., Pol., Ukraine, France, It., Romania, Portugal, Spain, Bulgaria, Turkey

:[Africa:]
:W.S., Tunisia, Morocco, Algeria, Mauritania, Sen., Mali, Niger, Libya, Egypt, Sudan, Gb., Guin., B.F., S.L., Liberia, Côte d'Ivoire, Ghana, Nigeria, Chad, Cam., C.A.R., S.S., Ethiopia, Somalia, E.G., Gabon, R. of Congo, Dem. Rep. of the Congo, Kenya, Angola, Zambia, Tanzania, Namibia, Bots., Zimb., Mozambique, Madagascar, South Africa

:[Asia. (Russia is the only country mentioned twice, the other label is within the European border. The text written over Bhutan is unreadable in the image and marked with a question mark in this list):]
:Iraq, Saudi Arabia, Yemen, Iran*, Oman, Russia, Kazakhstan, Mongolia, Turkmenistan, Uzbekistan, Afghanistan*, Taj., Pakistan, India*, Nepal*, ?, China, N.K.*, S.K., Japan, Ban., Bur.*, Laos, Vietnam, Thailand, Philippines

:[Oceania/Australia. (In Australia there is a star * in the middle of it above the name):]
:Malaysia, Indonesia, Papua New Guinea, <nowiki>*</nowiki>, Australia, New Zealand

:[Below Australia there is an arrow pointing to the south coast and below that a footnote for the stars * used above:]
:UTC+8:45
:(One small area)

:<nowiki>*</nowiki>=Half-hour offset

*'''Click''' to expand for a more detailed description:
<div class="mw-collapsible mw-collapsed leftAlign" style="width:100%">
 
:[There are no more text from the comic here below:]

:[A world map is shown divided and colored by political boundaries. Antarctica is not included. Bodies of water are white. The map is clearly distorted, with Europe and Africa in the center, but not all continents or countries look wrong. Africa, Australia and North America seem least distorted. But the bottom part of of South America is very slim, Greenland has two chewing gum like blobs stretched away from it to the right, Iceland is over the UK, and most of Europe has been compressed. Finland is too large though. In Africa especially Dem. Rep. the Congo has been enlarged. The worst distortion is in Asia, where especially Russia looks weird with three deep troughs down the length of the country and the end to the right seems to be much longer than usually. But also China is completely wrong as it has been compressed, Mongolia taking up most of its usual position.]

:[Most countries over a certain size have their name listed in a gray font. Small countries like Ireland and Haiti has their name listed in the oceans around them. Most other countries have the name inside the country, but if there is not enough room abbreviations are used. There are also a few specialties mentioned when time zones are not divided in full hours, for instance a footnote regarding time zones with a half hour offset.]
</div>
 

==Trivia==
===Errors===
* Mixing labels:
** Randall mixes up Morocco and Western Sahara (a disputed territory)
** Suriname and French Guiana also have switched labels.
*Wrong time zones:
** {{w|East Thrace}}, the European portion of Turkey, is shown in Eastern European time (UTC+2). Actually, like the rest of Turkey, it uses UTC+3.
** Nepal's time zone is UTC+5:45
** {{w|Thule Air Base}} in northwestern Greenland follows UTC-4 rather than UTC-3, and should thus be shown on a tendril to the west, directly above Labrador and the rest of Atlantic Canada; instead, it is shown using UTC-3, like most of the rest of Greenland. This is especially strange considering that Randall has correctly drawn {{w|Danmarkshaven}} as using UTC and {{w|Ittoqqortoormiit}} as using UTC-1.
* Borders and adjacency are not always preserved although often attempted as mentioned in the section on [[#Map imperfections|map imperfections]]:
** Estonia is shown sharing a border with Finland - in fact, the two countries are separated by the {{w|Gulf of Finland}}. This sea should run to {{w|St Petersburg}} in Russia - instead, the city is shown as landlocked.
** Norway should border Russia. See {{w|Norway–Russia border}}.
** Azerbaijan territory is mistakenly attributed to Georgia – Georgia should not have coast on the Caspian Sea. Armenia should not have coast on the Caspian Sea as well.
** Tajikistan should not border Kazakhstan and follows UTC+5 rather than UTC+6. These would apply to Kyrgyzstan, which is not drawn in the map; Kyrgyzstan, however, does not border Afghanistan.
** Malawi has lost its border with Tanzania.

===Omissions===
Some countries and territories are missing from the map. Most of these omissions are undoubtedly deliberate, but some are likely mistakes.

* Countries supposedly too small to show on the map's scale are omitted. These include small European countries: {{w|Andorra}}, {{w|Kosovo}}, {{w|Liechtenstein}}, {{w|Luxembourg}}, {{w|Malta}}, {{w|Monaco}}, {{w|San Marino}} and the {{w|Vatican City}}, {{w|Djibouti}} in Africa, {{w|Singapore}} in Asia.
* All the Pacific Ocean isles, including {{w|Hawaii}}.
* All Atlantic and Indian Ocean isles excluding {{w|Sri Lanka}} and {{w|Madagascar}}.
* Most of the small Caribbean countries and territories; however four small dots in the {{w|Lesser Antilles}} are depicted, but are unlabelled and cannot be definitively identified.
* Kyrgyzstan is clearly omitted by mistake.

===Map with Labeled time zones===
*[[:File:1799 Map with Labeled time zones.PNG| Here]] is a map with labeled time zones, made by a user who posted the link in the [[#Discussion|discussion]]. 

===Time zone map overlayed the comic===
*And [[:File:1799_overlay.png| here]] is an attempt that shows a {{w|time zone}} map overlayed with the comic. 

{{comic discussion}}

[[Category:Large drawings]]
[[Category:Comics with color]]
[[Category:Maps]]
[[Category:Bad Map Projections]]

Talk:2110: Error Bars

2019-02-13T02:31:56Z

108.162.242.19: Added comment(s).

I put in a little thing about fractals and Cantor sets, seemed relevant. [[User:Netherin5|Netherin5]] ([[User talk:Netherin5|talk]]) 17:32, 11 February 2019 (UTC)
: Fractals seem more relevant than the Cantor set, since the Cantor set is the limit as you infinitely subtract stuff from a finite interval, whereas this is adding (more like a geometric series).[[Special:Contributions/172.68.174.64|172.68.174.64]] 23:25, 12 February 2019 (UTC)

Would the series have a limit or would it continue on until the error bars go from infinity to +infinity?
It will have limit. Becouse it will every time be 5% of prevous errors it will lower over time. --172.68.154.40
https://repl.it/repls/AppropriateMatureConferences for demonstration --172.68.154.40

Perhaps you should review [https://www.explainxkcd.com/wiki/index.php/1153:_Proof Zeno's paradoxes] [[User:PotatoGod|PotatoGod]] ([[User talk:PotatoGod|talk]]) 02:11, 12 February 2019 (UTC)

That's not my understanding of "propagating error". I understand that phrase to mean that you're taking a measured value (that has uncertainty) and plugging it into a formula / using it calculate another value. Because of the way this works, the (absolute & relative) error on the newly calculated value is likely to be larger or smaller than the error in the original value (the overall size of the error bars changes). Randall's joke is that, instead of calculating the new error bars, he calculates error bars on the ends of his existing bars. I also agree with Netherin5 that there's a clear fractal reference here.
[[Special:Contributions/162.158.79.113|162.158.79.113]] 17:45, 11 February 2019 (UTC) hagmanti
: I noticed this error too, and tried to correct it, but it sounds like you understand it better than I. Feel free to edit the article itself! [[Special:Contributions/162.158.78.178|162.158.78.178]] 23:38, 11 February 2019 (UTC)

A question too, does the CI tend towards negative infinity, zero, or one? Edit: Today I learned what CI means. [[User:Netherin5|Netherin5]] ([[User talk:Netherin5|talk]]) 18:01, 11 February 2019 (UTC)

He has confidence intervals in confidence intervals alone; despite this, you see, he lacks confidence in...he. [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 20:48, 11 February 2019 (UTC)

Just to pair with the alt-text: ...))))))))))). [[Special:Contributions/108.162.242.19|108.162.242.19]] 02:31, 13 February 2019 (UTC)

2108: Carbonated Beverage Language Map

2019-02-06T21:48:36Z

108.162.242.19: Undo revision 169230 by 162.158.106.240

{{comic
| number = 2108
| date = February 6, 2019
| title = Carbonated Beverage Language Map
| image = carbonated_beverage_language_map.png
| titletext = There's one person in Missouri who says "carbo bev" who the entire rest of the country HATES.
}}

==Explanation==
{{incomplete|Created by ONE GUY IN MISSOURI. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

In the US, people in various parts of the country refer to carbonated beverages by {{w|Names for soft drinks in the United States|different names}} such as Soda, Pop, Coke, etc. Generally, the West Coast and Northeast say "Soda", the South says "Coke" and the rest of the country says "Pop".

There are various maps of the name differences, including: [http://www.popvssoda.com/]

This map leverages xkcd's mockery-maps of regional and state-by-state differences or variations in the use of language and overlays the regional variances in the terms for soda pop (for example: https://laughingsquid.com/soda-pop-or-coke-maps-of-regional-dialect-variation-in-the-united-states/), as was made trending and popular in 2013. Not only are there far more terms than are actually used by Americans, many are terms for other drinks (mead), unrelated liquids (quicksilver), or copyrighted beverage names less popular than Coke/Coca Cola (Code Red) -- and in one case, something that's not even edible ({{w|cryptocurrency|"Crypto"}}).

{| class="wikitable"
|+Map terms (from left to right, approximately)
|-
|Fanta
|Name of a carbonated beverage line
|-
|Söde
|Presumably pronounced "soda" but spelled oddly
|-
|True Water
|Possibly a reference to True Blood, a fictional artificial blood substitute for vampires in The Southern Vampire Mysteries book series by Charlaine Harris, and the television series True Blood.
|-
|Crypto
|A term for encryption, popularized by the rise of blockchain-based currencies. Not drinkable. Possibly a joke that the residents of Silicon Valley are actually computers who "drink" crypto (i.e. data).
|-
|Yum
|Refers to {{w|Yum! Brands}}, parent company of several fast food restaurants, which was spun off from PepsiCo, maker of a carbonated beverage, in 1997, and has a lifetime contract to serve their beverages.
|-
|Sparkle Fluid
|Roughly analogously to how "sparkling wine" and "sparkling cider" are carbonated varieties of wine and cider, "sparkling fluid" or "sparkle fluid" would presumably be any carbonated fluid
|-
|King Cola
|Name of a carbonated beverage
|-
|Pepsi
|Name of a carbonated beverage
|-
|{{w|Crystal Pepsi}}
|Name of a carbonated beverage
|-
|Ichor
|several definitions (blood of a god (or demon, or, in some dialects, any insect) or watery discharge from a wound). None of them carbonated. None of them recommended as a drinkable liquid. (Well, not by someone with your best interests at heart.)
|-
|You-Know-What
|A phrase typically employed when a more specific term is considered unspeakable.
|-
|Tab
|Name of a carbonated beverage
|-
|Spicewater
|Potentially a reference to the spice from ''Dune''.
|-
|Softie
|
|-
|Ohio Tea
|
|-
|Boat Drink
|
|-
|Melt
|Usually used to describe a kind of sandwich where cheese is melted in the center, usually on a griddle. Or maybe just a way to say "no, the *melted* ice"
|-
|Fizz Ooze
|
|-
|Punch
|A drink typically found in the juice aisle. Only sometimes carbonated.
|-
|Fun Wine
|Implies that normal wine is not "fun".
|-
|Diet
|Sometimes refers to a carbonated beverage. A common request in restaurants, as they often only have a single "diet soda" option for customers to pick. Ironically, "diet" sodas have been causally linked to metabolism related weight gain.
|-
|Refill
|The second glass of whatever you drank previously. Works for any drinkable liquid.
|-
|Tickle Juice
|Name of a Boston-based jazz band.
|-
|Bubble Honey
|
|-
|Sugar Oil
|The areas of Oklahoma and north Texas that are shaded produce a significant amount of {{w|petroleum|crude oil}}.
|-
|The Wet Drink
|Technically true of all drinks, unless one is attempting to drink sand. It may also refer to the fact that many advertisements for carbonated beverages attempt to make the product look more appetizing by photographing or filming a beverage container covered with water droplets.
|-
|Code Red
|Name of a carbonated beverage
|-
|Mead
|An alcoholic drink. Traditionally not carbonated. Often associated with Vikings, and these areas did have many Scandinavian immigrants.
|-
|Canadian Ale
|Probably a reference to the Canada Dry brand of Ginger Ale, a non-alcoholic carbonated beverage.
|-
|Aether
|Could refer to a highly flammable industrial solvent, also used as an anesthetic. Do not drink. Also, not carbonated. Alternately, could refer to the nonexistent fluid that was believed to carry light waves before electromagnetism was fully understood, or poetically to the sky; in either case it is not a drinkable liquid (or carbonated).
|-
|Carbonated Beverage
|Technically correct, but a bit of an awkward term due to its unnecessary length.
|-
|Mouthwater
|A play on the term "mouth watering" to describe delicious foods and drinks.
|-
|Capri
|Capri Sun is a brand of juice drinks, typically sold in uncarbonated pouches.
|-
|Skim Shake
|
|-
|Kid's Coffee
|Somewhat accurate. Coffee is typically drunk by adults for its caffeine. Carbonated beverages often have caffeine also, and are often consumed by children.
|-
|Regular
|In the past, referred to gasoline with lead, as opposed to "Unleaded". Not a drinkable liquid, and also outlawed.
|-
|Tang
|An orange flavored beverage containing less than 2% juice extract, not carbonated.
|-
|Formula
|Typically refers to an artificial replacement for mother's milk. Not carbonated.
|-
|Medicine
|Only sometimes a drinkable liquid. Never or perhaps almost never carbonated. Alternatively, a common euphemism for alcohol, or some other drink that the person doesn't want to admit to drinking -- or at least doesn't want to share.
|-
|Broth
|Liquid in which bones, meat, fish, or vegetables have simmered. Often used as a soup base. Not carbonated.
|-
|Fool's Champagne
|Carbonated beverage is to champagne what fool's gold is to gold.
|-
|Sugar Milk
|
|-
|No word for them
|This region of the US does not have a word for carbonated beverages (according to Randall). Apparently they do not drink them at all.
|-
|Hydro
|A word for water. Carbonated water does exist, but this word means all forms of water.
|-
|Harvard Tea
|The region shades this way includes {{w|Cambridge, Massachusetts}}, which is home to {{w|Harvard University}}.
|-
|Bubbler
|A nod to another popular map of the same type, exploring the regional dialects used to describe drinking fountains. Rhode Island and the eastern portion of Wisconsin are the only two locations where 'Bubbler' is commonly used to refer to drinking fountains.
|-
|Mouthbuzz
|Perhaps referring to the feeling of drinking a carbonated drink, where the releasing carbonation almost 'buzzes' in the mouth.
|-
|Brad's Elixer
|
|-
|Hot Water
|Not carbonated. Not even in Jacuzzi and hot tubs.
|-
|Fluid
|A word that means nearly any liquid in existence. Not specific to carbonated beverages.
|-
|Coke Zero
|Name of a carbonated beverage.
|-
|Carbo
|Sodas sweetened with corn syrup or cane sugar are high in carbohydrates. Could also refer to carbonation.
|-
|Quicksilver
|An old term for the element mercury, a metallic liquid in its pure form at room temperature. Extremely harmful if swallowed.
|-
|Glug
|Onomatopoeia, referring to the sound of swallowing a large amount of liquid.
|-
|Water Plus
|Technically the name of {{w|Water Plus|a British water retail services provider}}, this likely refers to the prevalence of "plus" as a preposition in branding nomenclature (e.g.: {{w|Google+}}, {{w|iPhone 8 Plus}}, {{w|7 Up Plus}}, etc.).
|}

The title text may be a wry comment in light of the pocket of "soda" in the St. Louis, MO area.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[A map of the United States divided into purple, red, green, blue, and yellow colored regions.]

:[A purple area in North West Washington:]
:Fanta

:[A blue area spanning the Western border of Washington and Oregon:]
:Sode

:[A yellow area spanning the remainder of Washington, North Western Oregon, Northern Idaho and the North Western corner of Montana:]
:Ichor

:[A green area spanning the North Eastern corner of Oregon, central Idaho and the majority of Montana:]
:Spicewater

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Maps]]

2107: Launch Risk

2019-02-05T16:36:59Z

108.162.242.19: /* Explanation */

{{comic
| number = 2107
| date = February 4, 2019
| title = Launch Risk
| image = launch_risk.png
| titletext = Don't worry--you're less likely to die from a space launch than from a shark attack. The survival rate is pretty high for both!
}}

==Explanation==
This comic deals with statistics based on a large population, such as all Americans, when the people in question are in a smaller group with vastly different statistics, such as astronauts.

A capsule is about to be launched into space. On the left side, there is an announcement: "T-MINUS 20...19..." The "T" stands for the time at which the rocket is scheduled to be launched. T minus 20 indicate 20 seconds before the launch, so it's basically a countdown for 20 seconds before the rocket is launched. In the capsule, one astronaut asks another how they are feeling. The second one pretends to feel nervous. The first one offers the supposedly reassuring observation that they are more likely to be struck by lightning than to be selected as an astronaut. Such "more likely to be struck by lightning" comparisons are commonly used to illustrate that a particular risk is very remote, and thus should not be considered particularly frightening.

The second one agrees with the first one for a moment, but then realizes that something is wrong with the argument. He says "Oh, that's a good-" which is likely "Oh, that's a good comforting comparison". Presumably, they realize that the likelihood of being ''selected as an astronaut'' is a moot point -- they are there because they ''already have'' been selected as an astronaut. That's why the first one's intention is more likely trolling than being really caring about the second one's nervousness. His words are only causing more confusion for the second one, that highlights the humorousness of the comic. The relevant concern is the risk level faced by an astronaut, given that they already hold that position. Unfortunately, the historical record shows that this risk is somewhat high, certainly far above the minuscule risk of being struck by lightning.

The lifetime odds of being struck by lightning are approximately 1 in 14,600 (approximately 10% of those struck by lightning are killed) [https://www.weather.gov/safety/lightning-odds How Dangerous is Lightning?].

The title text refers to another common comparison, the risk of a shark attack. In addition to shark attacks being rather rare, they are also not as likely to kill the victim as is commonly assumed. Most people attacked by sharks, and most people launched into space, live through the experience. However, it remains true that both are considerably riskier than most common activities like car accident (1 in 583 deaths) or unintentional poisoning (1 in 70 deaths).
([https://www.iii.org/fact-statistic/facts-statistics-mortality-risk])
Of the 557 people who who have been in Earth orbit, 18 (3%) have died in related accidents, not specifically at launch([https://en.wikipedia.org/wiki/List_of_spaceflight-related_accidents_and_incidents List of spaceflight-related accidents and incidents], [https://www.worldspaceflight.com/bios/stats.php Astronaut/Cosmonaut Statistics]). Of the 93 incidents logged for 2018 in the [http://www.sharkattackfile.net/index.htm Global Shark Attack File], 4 (4.3%) were fatal, but the statistic has been higher in the past when there has likely been less education against provoking sharks.

A tall rocket, such as depicted would be more likely to be struck by lightning than nearby structures. However launch controllers monitor weather carefully to reduce the chances of attempting to launch when lightning is likely.

A spacecraft launch can trigger lightning, by creating a conductive path through charge bearing clouds. Apollo 12 was struck by triggered lightning twice during launch phase. Thankfully backup systems allowed the flight to proceed. For more information, see [https://www.nasa.gov/audience/foreducators/9-12/features/F_Lightning_and_Launches_9_12.html NASA: Lightning and Launches]

The perceived value of risk is a recurring topic and is also featured in [[795: Conditional Risk]] and [[1252: Increased Risk]].

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[A rocket is about to launch.]
:Astronaut 1: How you feeling?
:Astronaut 2: Honestly, pretty nervous.
:Astronaut 1: I know it seems dangerous, but just remember: you're more likely to be struck by ''lightning'' than to be selected to become an astronaut.
:Astronaut 2: Oh that's a good-
:Astronaut 2: ...Wait.
:Countdown: T-Minus 20...19...

{{comic discussion}}
[[Category:Statistics]]
[[Category:Space]]

2107: Launch Risk

2019-02-05T16:34:26Z

108.162.242.19: /* Explanation */

{{comic
| number = 2107
| date = February 4, 2019
| title = Launch Risk
| image = launch_risk.png
| titletext = Don't worry--you're less likely to die from a space launch than from a shark attack. The survival rate is pretty high for both!
}}

==Explanation==
This comic deals with statistics based on a large population, such as all Americans, when the people in question are in a smaller group with vastly different statistics, such as astronauts.

A capsule is about to be launched into space. On the left side, there is an announcement: "T-MINUS 20...19..." The "T" stands for the time at which the rocket is scheduled to be launched. T minus 20 indicate 20 seconds before the launch, so it's basically a countdown for 20 seconds before the rocket is launched. In the capsule, one astronaut asks another how they are feeling. The second one pretends to feel nervous. The first one offers the supposedly reassuring observation that they are more likely to be struck by lightning than to be selected as an astronaut. Such "more likely to be struck by lightning" comparisons are commonly used to illustrate that a particular risk is very remote, and thus should not be considered particularly frightening.

The second one agrees with the first one for a moment, but then realizes that something is wrong with the argument. He says "Oh, that's a good-" which is likely "Oh, that's a good comforting comparison". Presumably, they realize that the likelihood of being ''selected as an astronaut'' is a moot point -- they are there because they ''already have'' been selected as an astronaut. That's why the first one's intention is more likely trolling than being really caring about the second one's nervousness. His words are only causing more confusion for the second one, that highlights the humorousness of the comic. The relevant concern is the risk level faced by an astronaut, given that they already hold that position. Unfortunately, the historical record shows that this risk is somewhat high, certainly far above the minuscule risk of being struck by lightning.

The lifetime odds of being struck by lightning are approximately 1 in 14,600 (approximately 10% of those struck by lightning are killed) [https://www.weather.gov/safety/lightning-odds How Dangerous is Lightning?].

The title text refers to another common comparison, the risk of a shark attack. In addition to shark attacks being rather rare, they are also not as likely to kill the victim as is commonly assumed. Most people attacked by sharks, and most people launched into space, live through the experience. However, it remains true that both are considerably riskier than most common activities like car accident (1 in 583 deaths) or unintentional poisoning (1 in 70 deaths).
([https://www.iii.org/fact-statistic/facts-statistics-mortality-risk])
Of the 557 people who who have been in Earth orbit, 18 (3%) have died in related accidents, not specifically at launch([https://en.wikipedia.org/wiki/List_of_spaceflight-related_accidents_and_incidents List of spaceflight-related accidents and incidents], [https://www.worldspaceflight.com/bios/stats.php Astronaut/Cosmonaut Statistics]). Of the 93 incidents logged for 2018 in the [http://www.sharkattackfile.net/index.htm Global Shark Attack File], 4 (4.3%) were fatal, but the statistic has been higher in the past when there has likely been less education against provoking sharks.

A tall rocket, such as depicted would be more likely to be struck by lightning than nearby structures. However launch controllers monitor weather carefully to reduce the chances of attempting to launch when lightning is likely.

A spacecraft launch can trigger lightning, by creating a conductive path through charge bearing clouds. Apollo 12 was struck by triggered lightning twice during launch phase. The flight continued using backup systems once this had been accomplished.

The perceived value of risk is a recurring topic and is also featured in [[795: Conditional Risk]] and [[1252: Increased Risk]].

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[A rocket is about to launch.]
:Astronaut 1: How you feeling?
:Astronaut 2: Honestly, pretty nervous.
:Astronaut 1: I know it seems dangerous, but just remember: you're more likely to be struck by ''lightning'' than to be selected to become an astronaut.
:Astronaut 2: Oh that's a good-
:Astronaut 2: ...Wait.
:Countdown: T-Minus 20...19...

{{comic discussion}}
[[Category:Statistics]]
[[Category:Space]]

2106: Sharing Options

2019-02-04T15:03:55Z

108.162.242.19: /* Transcript */

{{comic
| number = 2106
| date = February 1, 2019
| title = Sharing Options
| image = sharing_options.png
| titletext = How about posts that are public, but every time a company accesses a bunch of them, the API makes their CEO’s account click 'like’ on one of them at random so you get a notification.
}}

==Explanation==
This comic is a satire of social media’s presence in our lives and its vulnerabilities. [[Cueball]] is flying in an atmosphere that represents a Virtual Reality cyberspace, and he is talking to a screen that may be a smartphone with an advanced virtual assistant installed. This suggests that the comic is set in the distant future, where VR will have become commonplace and be embraced by [[Cueball]] and his friends. [[Ponytail]] and other characters also fly in the background, so this cyberspace may be the social network’s cyberspace where everyone interacts. The clouds represent the cloud server where the data of the social network is stored. The advanced virtual assistant seems to have a virtual face and have very advanced AI, which can even be arrogant by assuming that it already knew the information about the “option in between”.

Many social media sites allow users to control who is able to see data (posts, pictures etc.) that they share online, ranging from immediate friends to all other users (public). The settings for controlling the sharing of data are not always obvious to the user and several high profile social media sites have sparked controversy by having default settings that allow user data to be widely shared.

As most social media sites are free to use, the business model for these companies involves a mixture of selling advertising space on their website and selling data on its users to other companies, who may be interested in using it for marketing purposes. Targeted advertising takes data on users’ past behavior and things that they have liked, and uses this to predict what adverts they may be interested in or be most vulnerable to. Targeted adverts are more valuable to advertisers as they avoid paying to show adverts to individuals who are unlikely to be interested in their products; but can lead to users feeling that they are being spied on. Whilst the terms and conditions for social media websites will include details of how data will be used, the length of these documents and legal terminology may deter some users from reading them, meaning that they may be unaware that their data is being exploited in this way. Government legislation has so far been slow to catch up with changing online trends; however, the European Union have recently introduced {{w|General Data Protection Regulation|General Data Protection Regulations (GDPR)}} which aims to regulate how user data can be shared. GDPR was featured in comic [[1998: GDPR]].
Internet scammers refer to the scammers who acquire user data from using web crawlers to automatically scan social networks for personal information (particularly emails) to scam their owners. Those bots called web crawlers can get the information without scammers' manual browsing of the victims' profile. Those people who set their social network account as public (the 2nd option in the comic) are more likely victims of scammers since they can access their profiles without being the victim's friend or follower.

Randall, who might have never heard of the Facebook option to share with “friends of friends” as well, is making a point that there ought to be some option between sharing posts only with your friends and making them completely public. The title text shows that he would specifically like to know when corporations read his posts.

Randall might be interested in [https://www.scuttlebutt.nz/ scuttlebutt] or [https://secushare.org/ secushare]. The comic is set in the future of VR, yet the fact that Internet companies like Facebook, Tencent and Twitter try hard to collect and sell user data won't change. This may suggests that Randall believe those companies will never reconsider their approach regarding user privacy.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[Cueball floating in midair is communicating with a small floating screen that resembles a smartphone. Other people and clouds visible floating by in background.]
:Screen: Welcome to social media! When you put stuff here, you have two options: (1) You can make it available to a small set of 300 or so approved friends.
:Screen: Or (2) you can share permanent copies of it all with billions of people, including internet scammers, random predatory companies, and hostile governments.

:Cueball: Why would anyone pick option two?
:Screen: Two is the default.
:Cueball: Yikes.

:Cueball: So those are the only two options? There’s nothing in in between?
:Screen: I don’t understand. Like what?

:Cueball: I mean…there are numbers between 300 and a billion.
:Screen: Huh? Name one.
:Screen: ''Pretty'' sure I would have heard of those.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Social networking]]

Talk:1590: The Source

2015-10-15T19:09:37Z

108.162.242.19:

As soon as I finished this comic, I started to hear it. Please, make it stop. It's not on the basement, nor the attic. It's getting louder. Driving me crazy. Please. Maybe this gun would help me to shut the noise down. Now, where should I aim it? {{unsigned ip|108.162.212.38}}
:Very dark humour there from anonymous... I guess it will be to late to help him now. But if he misses he will have even more ringing noises in his ears than after reading this comic. ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 12:13, 14 October 2015 (UTC)
:Just shoot wherever. If you're lucky, you'll be partly deaf and not hear the hum anymore. --[[Special:Contributions/141.101.104.146|141.101.104.146]] 13:49, 14 October 2015 (UTC)
::No, hearing damage (for instance as a result of loud noise) is what very often ''causes'' tinnitus. [[User:Jkrstrt|Jkrstrt]] ([[User talk:Jkrstrt|talk]]) 14:44, 14 October 2015 (UTC)
::Thus, it would most likely be a fairly reliabel way to ensure that hear ONLY a high-pitched hum, and nothing else... -- [[User:Brettpeirce|Brettpeirce]] ([[User talk:Brettpeirce|talk]]) 14:04, 15 October 2015 (UTC)
The background noise created by appliances like refrigerators and washing machines is typically generated by their electric motors/pumps which operate at 60 Hz; a frequency I would not consider "high pitched". The only devices I can think of off the top of my head that generate what I would consider high-pitched noise are TVs (both CRT and flat-screen). [[User:Smperron|Smperron]] ([[User talk:Smperron|talk]]) 13:13, 14 October 2015 (UTC)
:: It's 50Hz over here in Germany {{unsigned ip|162.158.92.48}}
:: most new transformers are of the [https://en.wikipedia.org/wiki/Switched-mode_power_supply switching] variety and can be as high as 1MHz. [[Special:Contributions/108.162.242.19|108.162.242.19]] 19:09, 15 October 2015 (UTC)

I can think of only one potentially high pitched hum generator that would look something like that, and I didn't know Cueball lived with a lesbian who uses a symbian. Let alone such a person leaving their rather high wattage sex toy plugged in. [[User:Seebert|Seebert]] ([[User talk:Seebert|talk]]) 13:55, 14 October 2015 (UTC)

I suspect the title text may be a reference to “why do we even ‘'have’’ that lever?” from The Emperor’s New Groove: https://www.youtube.com/watch?v=sw2B9knw58U [[User:ZevEisenberg|ZevEisenberg]] ([[User talk:ZevEisenberg|talk]]) 14:00, 14 October 2015 (UTC)

I agree, and made my account to make that observation. (Panther) {{unsigned|Panther}}

:I suspect the title text to be the most common wording for this kind of question, so it could not be a reference to whatever in any way. [[Special:Contributions/141.101.66.23|141.101.66.23]] 14:33, 14 October 2015 (UTC)

Here is a hum generator for you, from a noise generator website:
http://mynoise.net/NoiseMachines/60HzHumNoiseGenerator.php
[[Special:Contributions/108.162.216.115|108.162.216.115]] 15:15, 14 October 2015 (UTC)

: That was my first thought too. My second was "I guess they're going to find out." See [https://www.chesterton.org/taking-a-fence-down/ Chesterton's fence]. [[User:Wwoods|Wwoods]] ([[User talk:Wwoods|talk]]) 14:58, 14 October 2015 (UTC)

"There do, however, exist devices that are meant to create a high pitched hum, that people might wish to install in their house. These will be humming in the ultrasonic regions, although cheap versions can often be heard by young people. They are typically used for electronic pest control. Maybe someone tried to get rid of Cueball." - while I don't think the comic is intended to reference this, the above selection somehow almost entirely surrounds the concept of an {{w|The_Mosquito|ultrasonic youth-control device}} without actually involving it. (Probably because the editor(s) involved don't actually know about it. Maybe now they do.) [[Special:Contributions/141.101.75.185|141.101.75.185]] 15:11, 14 October 2015 (UTC)

I thought there might be more to it than just referencing high pitched noises inside a household (yes, I can hear it now as well, thanks a lot), so when I read the title of the comic, I thought it might have something to do with a source code of a program... Sometimes the program does something irritating that it should not - so in the first two frames Cueball is trying to locate the problem and then he walks throught the program to finally locate a piece of code that should not be there. And in the image title he says "Why did we even have that thing?" - as in you sometimes come across a piece of code that is useless and you don't even know what it is doing there. But who the hell knows.[[Special:Contributions/141.101.96.219|141.101.96.219]] 15:13, 14 October 2015 (UTC) 9of8

:As a programmer, you have a tendency to see all problem solving tasks in analogy with either programming or debugging. So do I, and so does Randall. But that doesn't mean that analogy is the point of anything Randall writes about solving any problem; it's just always there in the background, slightly influencing the way he describes things, in ways that people with similar backgrounds will pick up whether it's intended or not. In this case, I don't think it was intended, or adds anything to the joke. A doctor writing the same comic might have the main character act slightly differently in diagnosing the problem, and use slightly different words, but the point would be the same as it is here. --[[Special:Contributions/162.158.255.52|162.158.255.52]] 17:53, 14 October 2015 (UTC)

I had once thought about why do I sometimes hear high pitched noise. We have all kinds of tiny random noises all around us. Hums, pulses, bugs, elecs,etc. Human ear canal is a few centimeters long. And it has resonant frequency around 2000~3000Hz and its odd multiples. So, my conclusion was, of all the tiny noises the 2000(or 3000)Hz and its third(6000 or 9000Hz) and fifth harmonic(10000 or 15000Hz) frequencies,or even higher harmonics would get amplified by resonance. Pls correct me if I'm wrong. Thanks. [[User:Parsec|Parsec]] ([[User talk:Parsec|talk]]) 15:30, 14 October 2015 (UTC)
:That's all true, but your cochlea, auditory processing brain modules, etc. are all trained from birth to respond to the input they get from that resonant canal, so that amplification is already taken into account (i.e., those frequencies have higher activation thresholds and more opponent dampening, which counters the physical resonance). If your ear were radically reshaped in adulthood to have different resonant frequencies, it would take time for your brain to adjust, and it would do so imperfectly, but since this normally doesn't happen for most people, we don't notice any such effects.

:This does raise the question of whether one cause for tinnitus might be your brain overcompensating for loss of high-frequency inputs due to aging and/or damage. As far as I know, that hypothesis has been raised multiple times, but not yet conclusively tested, but you may want to search for yourself. ---[[Special:Contributions/162.158.255.52|162.158.255.52]] 17:53, 14 October 2015 (UTC)

Phillip Glass: Changing Opinions
"Gradually....we became aware...of a hum in the room....
an electrically hum....in the room.It went mmmmmmm mmmmmm mmmmm mmmmm mmmmm.
https://www.youtube.com/watch?v=UC01ZVEXCBY

Gradually
We became aware
Of a hum in the room
An electrical hum in the room
It went mmmmmm

We followed it from
Corner to corner
We pressed out ears
Against the walls
We crossed diagonals
And put our hands on the floor
It went mmmmmm

Sometimes it was
A murmur
Sometimes it was
A pulse
Sometimes it seemed
To disappear
But then with a quarter-turn
Of the head
It would roll around the sofa
A nimbus humming cloud
Mmmmmm

Maybe it's the hum
Of a calm refrigerator
Cooling on the big night
Mmmmmm
Cooling on the big night
Maybe it's the hum
Of our parents' voices
Long ago in a soft light
Mmmmmm
Long ago in a dimmed light
Mmmmmm

Maybe it's the hum
Of changing opinion
Or a foreign language
In prayer
Mmmmmm
Or a foreign language
In prayer
Maybe it's the mantra
Of the walls and wiring
Deep breathing
In soft air
Mmmmmm
Deep breathing
In soft air
Mmmmmm {{unsigned|Singmaster}}

For what it's worth, my first interpretation of the comic was that he was in some kind of ultra-quiet room (thus the bare walls and multiple doors) and Cueball was just hearing the inherent high-pitched buzz, created by your own body somehow (I've heard different explanations from different sound teachers), that one still hears in those rooms. But that was just my take. It made me chuckle. [[User:Xopherok|Xopherok]] ([[User talk:Xopherok|talk]]) 22:51, 14 October 2015 (UTC) [[User:xopherok|xopherok]]

Many types of power supplies for powering DC devices (like laptops, TVs etc.) from mains power generate high pitched hums. These hums are supposed to have a frequency above the audible range (making them inaudible to humans), but it's very common for a slightly faulty unit to actually create a constant audible very high pitched hum.
[[Special:Contributions/162.158.93.92|162.158.93.92]] 00:36, 15 October 2015 (UTC)

Hmm.. I feel like we still have not found the deeper layers of that comic. IMO it is not about trying to figure out what room or device the comic has similar effects in real life, but rather see them as imaginary. I personnally thought of a short story by Kafka, The Burrow, which features a self-aware animal which has build the perfect holt, but starts to hear a high-pitched hum. It is driven insane by it since it appears to be in permanent danger, but it is unable to locate the source. (Not saying Randall thought of that story.)

Maybe the comic ironically portrays the thoughts of person looking through their house for a undetectable hum which may even be imaginable. That person wishes for the sound coming from such a noise generator which can be easily switched off. Afterwards, the person would wonder why they even have such a generator. Obviously, this remains a wish (which is ridiculous if we see it depicted that clearly) of a increasingly insane person. --[[Special:Contributions/141.101.75.191|141.101.75.191]]

That is a nuclear device that keeps all the ghosts trapped. Don't disconnect it!![[Special:Contributions/162.158.115.22|162.158.115.22]] 10:02, 15 October 2015 (UTC)