<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=141.101.104.221</id>
		<title>explain xkcd - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=141.101.104.221"/>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php/Special:Contributions/141.101.104.221"/>
		<updated>2026-04-14T22:06:37Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.30.0</generator>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2301:_Turtle_Sandwich_Standard_Model&amp;diff=191530</id>
		<title>Talk:2301: Turtle Sandwich Standard Model</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2301:_Turtle_Sandwich_Standard_Model&amp;diff=191530"/>
				<updated>2020-05-02T21:08:39Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
This is the first time I have had a chance to see the comic early enough to make a meaningful contribution to the explanation, but this time I have no idea whatsoever what the comic is about! [[User:Moosenonny10|Moosenonny10]] ([[User talk:Moosenonny10|talk]]) 20:32, 1 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Looks like it is referencing the standard model of elementary particles. The title text mentions four of the quarks(top,bottom,charm,strange) [[Special:Contributions/162.158.106.150|162.158.106.150]] 20:38, 1 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Disagree with DgbrtBOT that this is primarily to do with genetics. I agree that it's about the standard model. Up, down, charmed and strange. It may 'because I'm dumb', but even I'm not that dumb.&lt;br /&gt;
:I agree that this is not about genetics. The usual Mendelian diagram has the same traits in both dimensions. Maybe he didn't make the particle physics connection because that has more than 4 boxes. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 21:52, 1 May 2020 (UTC)&lt;br /&gt;
:Agree with Barmar: This is not at all about genetics, but only about the particles standard model. Hence the name given by Randal, hence the dimensions not fitting Mendel, hence the lab reference and hence the biological absurd combinations. It does not fit genetics at all, but it perfectly fits a basic assumption of the standard particle modell: That every combination does exist. Labs all over the world have spend decades trying find/prove the existance of a particle predicted by lining up the dimensions of the particles standard model just as shown here and most seeming just as absurd. [[Special:Contributions/172.68.51.52|172.68.51.52]] 00:06, 2 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
I added a bit about the physics part of it, but it can definitely use more information! [[User:ChunyangD|ChunyangD]] ([[User talk:ChunyangD|talk]]) 20:52, 1 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Randall missed an obvious physics/turtle joke &amp;quot;turtles all the way down&amp;quot; reference here  [[Glenn Strycker]] 4:56pm CDT 1 May 2020&lt;br /&gt;
: It was the first thing I thought, Randall can be sure his readers fill in such details... [[Special:Contributions/141.101.104.221|141.101.104.221]] 21:08, 2 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
If this really is about genetics, which I question, it seems likely that most people who haven't studied genetics would find the use of genetics jargon to be less than helpful in an explanation.[[User:Darthpoppins|Darthpoppins]] ([[User talk:Darthpoppins|talk]]) 22:46, 1 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
In my opinion, the ExplainXKCD community has been successfully trolled by the contributor of the explanation of this comic, and with humorous effect.  The troll consists of an explanation couched entirely in terms used primarily by biologists but generally difficult for others to understand, contrary to this community's practice of trying to simplify.  [[Wikipedia:genotype|Genotypes]], [[Wikipedia:phenotype|phenotypes]], [[Wikipedia:Punnett Square|Punnett Squares]], [[Wikipedia:heterozygous|heterozygous]], [[Wikipedia:homozygous|homozygous]], [[WIkipedia:ontogeny|ontogeny]].  That being said, the contributor is certainly correct that the comic is about [[Wikipedia:genetics|genetics]], in that the depicted two-by-two square is immediately suggestive of the visual tool used for predicting the results of cross-breeding experiments.  And the comic is certainly also about [[Wikipedia:particle physics|particle physics]], in that the comic title refers to a &amp;quot;Standard Model&amp;quot; and then the title text alludes to particle names used in the [[Wikipedia:standard model|standard model of particle physics]].  So the comic's joke is about the unexpected juxtaposition of genetics with particle physics, and also is about turtle sandwiches which, as drawn, are intrinsically funny anyway.  Yes, @Glen, all the way down.  JohnB [[Special:Contributions/162.158.75.116|162.158.75.116]] 00:25, 2 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
This looks less like a Punnet Square than it does like one of those political alignment chart memes. Punnet squares use symbols next to each other to designate genotypes, not diagrams of the results. Not to mention that the individual labels along the sides are supposed to be alleles, not separate effing traits! That whole paragraph is completely wrong and should be removed. [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 00:44, 2 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Isn't this about supersymmetry?  The missing pieces are the bosonic partners of the known fermions (matter particles), and the fermionic partners of the known bosons (force particles).... Joel K&lt;br /&gt;
&lt;br /&gt;
For a second, I thought it said &amp;quot;Turkey Sandwich Standard Model&amp;quot;[[User:AllTheWayDown|AllTheWayDown]] ([[User talk:AllTheWayDown|talk]]) 01:31, 2 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
This is clearly a use of the box method for factoring a trinomial in standard form (ax^2 + bx + c) which the coefficient of the first term (say ax^2) is not simply 1 (a&amp;lt;&amp;gt;1). Actually, the moment I saw it I knew exactly what it was, simply because I have been helping my high school son with his algebra the past few weeks. I laughed out loud! I never heard of this method as a math undergrad because it was brand new at the time, but now it's evidently fairly standard. &lt;br /&gt;
&lt;br /&gt;
You create a 2x2 box, and write the first term of the trinomial (ax^2) in the top right corner and the last term (c) in the lower left. Then you have to figure out what factoring of a x c gives you two middle terms that when added will yield the middle term, bx. Let's call those b1x and b2x (where b1 x b2 = a x c, and b1 + b2 = b). You put those terms, b1x and b2x in the two empty boxes (in either order). Then you pull out common factors along each row and column until they multiply correctly to get the table. The terms you have pulled out then are your two binomial factors of the trinomial. &lt;br /&gt;
&lt;br /&gt;
Randall has factored a turtle sandwich where the first term (ax^2) is a sandwich and the last term (c) is a turtle. These are the known terms (check marks). The unknown terms, through working the box method, turn out work if the bread is the common factor along the top row and the turtle shell on the bottom row. The sandwich filling is the common factor in the first column, and the shell-less turtle is the common factor on the second column.&lt;br /&gt;
&lt;br /&gt;
I believe the alt-text is a play on the fact that, if I'm not mistaken, there are more ways to factor a trinomial if you allow imaginary numbers, because that allows square roots of negative numbers. Analogously, dividing shells differently suggests subatomic particles—thus, various quark flavors like charm and strange.&lt;br /&gt;
[[User:EternalLearner|EternalLearner]] ([[User talk:EternalLearner|talk]]) 01:52, 2 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Apropos of nothing, and just for the comic relief of the commenters, I searched for 'turtle' 'sandwich' 'standard' 'model' and came across [https://www.globalxvehicles.com/turtle.html | this bad boy].  I couldn't resist sharing.  Thanks for the knowledge.  -- brad&lt;br /&gt;
&lt;br /&gt;
Uhm,wut,mostly. Okay so the earth is on a turtle. What holds the turtle up? It's turtles, all the way down, I've heard but? &amp;quot;Turtle legs&amp;quot; is my answer.  Why I'm here: didn't xkcd.com used to say it was updated Monday, w, f, ? [[Special:Contributions/162.158.78.182|162.158.78.182]] 04:55, 2 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Please refer to http://recipes-plus.com/recipe/turtle-sandwiches-kids-30062 for the top left sighting. [[User:Steven Nijhuis|Steven Nijhuis]] ([[User talk:Steven Nijhuis|talk]]) 05:35, 2 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
LOL.  This is the most random comments I have seen on one of these.  This is 100% particle physics.  Standard model of particle physics, up quarks, charmed quarks..  this is a commentary on how we know there is gravity, and we know there are electrons and we have a standard model which is still being filled in, in order to unify the theories.&lt;br /&gt;
&lt;br /&gt;
--Adam Outler [[Special:Contributions/108.162.238.131|108.162.238.131]] 06:03, 2 May 2020 (UTC)&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
I'm a bit confused by these comments. It seems like people are getting thrown off by the 2x2 table thinking that the comic must be related to where they've seen tables before (genetics / factoring quadratics / ...). This is wrong though, this comic is 100% particle physics.&lt;br /&gt;
In particle theoretical (particle) physics, the way forward has often been unification (combining forces of nature mathematically). We know the Standard Model is wrong, so physicists have been searching for ways to theoretically extend the known theory for decades. One of the most popular ways of doing this is looking for a larger symmetry group that encompasses the known symmetry groups of the equations governing the Standard Model. And the first time that physicists got REALLY close to a working theory was extending to E(5). When doing this mathematical extension of the Standard Model, you automatically get new messenger particles that are predicted (leptoquarks) that would theoretically make a transition between leptons and quarks possible (much like the weak interaction allows for transitions between quarks). The whole thing tends to get represented as a matrix visually, much like the turtle sandwich joke.&lt;br /&gt;
tl;dr: The joke makes perfect sense in theoretical particle physics. This type of diagram is common in extending the Standard Model (which is definitely incomplete) to a larger symmetry group like E(5).&lt;br /&gt;
Tom B&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Outside of anything scientific, I think it's also referring to the memetic &amp;quot;Is a BLANK a sandwich?&amp;quot; debate (normally a hotdog or a calzone) [[Special:Contributions/141.101.107.84|141.101.107.84]] 18:12, 2 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Anyone else mistakenly see the tomato slice/cheese/lettuce as a [https://en.wikipedia.org/wiki/Turtles_(chocolate) Turtle Chocolate] and a slice of [https://en.wikipedia.org/wiki/Turtle_pie Turtle Pie]?&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2298:_Coronavirus_Genome&amp;diff=191220</id>
		<title>Talk:2298: Coronavirus Genome</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2298:_Coronavirus_Genome&amp;diff=191220"/>
				<updated>2020-04-25T12:00:08Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: Sequence unknown&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Epigenetics is a pun, right? I think it's a pun but I don't know what and it's maddening. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 23:03, 24 April 2020 (UTC)&lt;br /&gt;
:...{{w|Epigenetics}} is a real thing&amp;amp;mdash;the study of how changes in things other than the genome itself can be passed down between generations. An example is conditioning a mouse to be scared of the smell of oranges/cherries/almonds by having them associate the scent of acetophenone with an electric shock, then testing whether its pups also have the same fear of that smell: they do, but this obviously can't be by the genome itself changing (no component of this has a lot of ionizing radiation{{Citation needed}}). Whatever causes this is the topic of actual epigenetics. --[[User:Volleo6144|Volleo6144]] ([[User talk:Volleo6144|talk]]) 00:12, 25 April 2020 (UTC)&lt;br /&gt;
::I know that, I added the link to the article. But afaik that has nothing to do with how the genome is formatted in Word, and I think it's a pun. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 00:31, 25 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
since when does notepad have spellcheck? [[Special:Contributions/172.68.226.46|172.68.226.46]] 23:05, 24 April 2020 (UTC)&lt;br /&gt;
: Word does, so maybe she is using Word instead? Kind of contradictory. [[Special:Contributions/172.69.34.46|172.69.34.46]] 23:14, 24 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
True Story: In the 1980s, as part of the Work Experience initiative at my school, I was assigned to one of my local council's offices (I'd applied for their computer department, but someone else got that). I don't ''think'' the word-processor I used at home (Psion Exchange) had spellcheck, but the one the office used (Lotus? Can't actually recall, but it, like most things, was DOS-based) definitely had, and it was very easy to edit in new words. Inspired by the chemistry lessons I'd recently had, and some 'reports' I was asked to write (keeping the kid busy, more like!) that dealt with chemical degradation of concrete under the action of salt and suchlike, I of course added &amp;quot;NaCl&amp;quot; then absolutely any other chemical formulae I could think of. &amp;quot;H2SO4&amp;quot; was an early one (partial subscript formatting wasn't relevent to the spill-chucker) but I eventually got round to CH4, C2H6, C3H8, etc, and then as many of the derived alcohols, alkenes, alkynes, etc that I could be bothered to type in. Which were a lot. By the end I was 'confident' that nobody would ever type ''any'' correct chemical formula into that machine (no network-shared resources!) and have to worry about false-positive typo alerts. Yeah, well, I was still at school and thought I knew ''everything''. [[Special:Contributions/162.158.159.70|162.158.159.70]] 23:37, 24 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Can confirm: virus genomes are looked at in notepad. I worked at one of the national laboratories for a summer, experimenting with ways to check for the length of a gene and strength of genetic expression in various circumstances in E. coli. We used notepad because even old computers can open very large files without difficulty, and all our scripts were in Perl, which can easily output to .rtf or .txt file formats. These files are huge, by the way. If you hold down on the scroll bar so it's zooming to the bottom, you could be waiting 20 minutes to reach the end depending on the number of kilobase pairs in your microbe. And epigenetics is not a pun. It's a real word. [[Special:Contributions/172.68.143.192|172.68.143.192]] 00:15, 25 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Concurrent to the work in the medical community, work is underway in various open source software communities to fix bugs and other issues with software (eg genome analysis tools) that is useful to the scientists combatting COVID-19. These include the Debian &amp;quot;biohackathon&amp;quot; (https://lwn.net/Articles/816280/) as well as support from Mozilla (https://lwn.net/Articles/816386/). Parallel to these efforts, the FSF (Free Software Foundation) has focused on the shortage of medical equipment: https://lwn.net/Articles/816392/ [[Special:Contributions/108.162.242.5|108.162.242.5]] 00:34, 25 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
I’m suddenly inspired to write a DNA-edit-mode for Emacs (if it doesn’t have it already) which would allow for the virus spell check as described in this comic. [[Special:Contributions/172.69.63.153|172.69.63.153]] 04:16, 25 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Derek Lowe has some insights about actual coronavirus mutations [https://blogs.sciencemag.org/pipeline/archives/2020/04/21/watching-for-mutations-in-the-coronavirus here], if you are interested.&lt;br /&gt;
&lt;br /&gt;
Given coronavirus has an RNA genome, shouldn't all the 'T's be replaced by 'U's?&lt;br /&gt;
&lt;br /&gt;
The sequence in the transcript does not actually appear on the [https://www.ebi.ac.uk/ena/data/view/MT344963&amp;amp;display=text site] mentioned in the explanation. In fact, when I google for 'TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA' I only get this particular site.&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2235:_Group_Chat_Rules&amp;diff=183944</id>
		<title>Talk:2235: Group Chat Rules</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2235:_Group_Chat_Rules&amp;diff=183944"/>
				<updated>2019-11-30T09:32:36Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: /* 5884 × 9286 pixel image?? */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== 5884 × 9286 pixel image?? ==&lt;br /&gt;
&lt;br /&gt;
When I open this page (https://xkcd.com/2235, in case there's any confusion), I get an enormous image that bleeds far past the right and bottom of the page. Turns out that the image is 5884 × 9286 pixels. Has this been seen before? -- [[User:Dtgriscom|Dtgriscom]] ([[User talk:Dtgriscom|talk]]) 19:05, 29 November 2019 (UTC)&lt;br /&gt;
: Looks like Randall must have uploaded the wrong image size. I assume he'll fix the comic shortly. [[Special:Contributions/172.68.211.52|172.68.211.52]] 19:32, 29 November 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
11) I don't care if any generalised 'group chat' software does newest-first or oldest-first as default (and if you can resort to the other order, most-upticked, or whatever) but if it allows inclusion of prior comments, please ''DO NOT ENCOURAGE TOP-POSTING'', particularly when reply-pyramids can carelessly form with recless abandon, and often beyond the &amp;quot;this post is too long, click here to expand&amp;quot; point you often get. - Honestly, I just think a dose of more widespread peer-directed Usenet Netiquette (pre-Eternal September, definitely pre-Outlook Express) could do a lot of people good as well. Randomly split people up into 1990-ish sized cohorts for a 'training period' of socialisation until they can safely 'graduate' to the globally undelineated cohort. [[Special:Contributions/162.158.155.110|162.158.155.110]] 20:12, 29 November 2019 (UTC)&lt;br /&gt;
:Ok boomer, I'll be off your lawn in a moment. In the mean time I think there's a cloud up there which can't hear you. [[Special:Contributions/172.69.22.122|172.69.22.122]] 20:25, 29 November 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Anyone got any ideas about (4)? The only group chat I know of which constantly changes their group names to different random nonsense is the Chapo Trap House Discord. [[Special:Contributions/172.69.22.122|172.69.22.122]] 20:32, 29 November 2019 (UTC)&lt;br /&gt;
: This might just be something that he has experienced personally. All of the large group chats of which I've been a member have exhibited this behavior. In fact, I thought it was pretty weird that no one on here had heard of this before. I related to it immediately. [[User:Moosenonny10|Moosenonny10]] ([[User talk:Moosenonny10|talk]]) 23:10, 29 November 2019 (UTC)&lt;br /&gt;
::If there is a public example please add it. [[Special:Contributions/172.68.132.155|172.68.132.155]] 23:13, 29 November 2019 (UTC)&lt;br /&gt;
In my experience, constantly changing irrelevant chat names is a behaviour of chats with large numbers of messages and nothing ever being important or relevant - the kind where noone needs a bot because the posters are already spamming enough irrelevant stuff. So for me, it fits well with the rest of the list.&lt;br /&gt;
&lt;br /&gt;
Does anyone think that (10) means that all of the rules were sent as separate messages and the last one's just an apology for doing that? [[Special:Contributions/172.69.63.83|172.69.63.83]] 22:17, 29 November 2019 (UTC)&lt;br /&gt;
:Good call. [[Special:Contributions/162.158.255.244|162.158.255.244]] 22:48, 29 November 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
The initial explanation for 8 doesn’t seem right - the given examples of email notifications and source code commits are by definition not “junk that nobody asked for” (since such integrations require intentional setup) and are “algorithmically generated” only in a strictly literal sense. To me this is clearly a reference to social media platforms. [[Special:Contributions/188.114.111.151|188.114.111.151]] 08:21, 30 November 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=657:_Movie_Narrative_Charts&amp;diff=181868</id>
		<title>657: Movie Narrative Charts</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=657:_Movie_Narrative_Charts&amp;diff=181868"/>
				<updated>2019-10-29T00:01:02Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: /* {{w|Star_Wars|Star Wars (original Trilogy)}} */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 657&lt;br /&gt;
| date      = November 2, 2009&lt;br /&gt;
| title     = Movie Narrative Charts&lt;br /&gt;
| image     = movie_narrative_charts.png&lt;br /&gt;
| titletext = In the LotR map, up and down correspond LOOSELY to northwest and southeast respectively.&lt;br /&gt;
}}&lt;br /&gt;
*A [http://xkcd.com/657/large/ larger version] of this image can be found by clicking the image at xkcd.com - the comic's page can also be accessed by clicking on the comic number above.&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
&lt;br /&gt;
These charts show movie character interactions. The horizontal axis is time. The vertical grouping of the lines indicates which characters are together at a given time.&lt;br /&gt;
&lt;br /&gt;
=== {{w|Lord_of_the_Rings_film_trilogy|''Lord of the Rings'' Trilogy}} ===&lt;br /&gt;
A mass of colored lines weaves back and forth across the chart, representing various characters. Sauron is represented by a red bar at the bottom contained within a huge black bar with branches, that in turn represents his army of nazgul, orcs, etc. Major locations (Moria) and plot points (the breaking of the fellowship) are marked. Gandalf, especially at the beginning, jumps all over the map in a short time. Eagles appear and then disappear a couple of times. Treebeard's line is flat except for the march to Isengard. At the end, the ship to the West drifts off into a corner. The hobbits start off in the top left with Frodo, Sam, Merry, and Pippin with Bilbo with them for a short time because of the party at the beginning.  They go off on their adventure and briefly encounter Gandalf.  They are then split up for a short time but meet back up at Weathertop when the Nazgul attack and they meet Aragorn (Strider at that point). They meet up with the rest of what becomes the fellowship of the ring at the council of Elrond at Rivendell. The newly formed fellowship must then venture into the mines of Moria which is referenced in comic [https://xkcd.com/760/ #760] and comic [https://xkcd.com/1218/ #1218]. After encountering the Balrog and the later death of Boromir the fellowship splits up. Frodo and Sam take the ring and go off on their own to destroy it and sneak into Mordor with the help of Gollum. Merry and Pippin are captured by the Uruk-hai but are rescued by Eomer and his army. Eomer and his army then briefly reunite with Legolas, Gimli, and Aragorn while Merry and Pippin find Treebeard and flood Isengard. While Merry, Pippin and Treebeard are flooding Isengard Aragorn, Gimli, and Legolas fight at Helm's Deep with Gandalf and Eomer and Theoden.  Aragorn, Gimli, and Legolas go to wake the army of the dead while Pippin goes with Gandalf and Merry goes with the Rohirrim.  All of these people rejoin for the battle of the Pelennor fields where Eowyn kills the witch king after Theoden dies along with Denethor.  The orcs, men and oliphants are all destroyed and Aragorn releases the army of the dead.  All the surviving members of that battle go to the Black Gate except Eowyn and Faramir.  Sam and Frodo destroy the Ring, Gollum dies and everyone who is still alive is there for Aragorn's coronation. Everyone goes back to their respective homes except for Frodo, Gandalf, Elrond, Galadriel, and Bilbo who get on a ship to the west.&lt;br /&gt;
&lt;br /&gt;
As the title text points out, most of the plot of The Lord of The Rings occurs on a rough northwest to southeast axis, with the Fellowship of the Ring traveling from the Shire near the top of chart to Modor at the bottom of the chart (and back again.)  The most significant exception to the northwest-southeast axis is the area of the chart between &amp;quot;The Breaking of the Fellowship&amp;quot; and &amp;quot;Isengard Flooded.&amp;quot;  Helm's Deep and Isengard are southwest from the overall northwest-southeast axis of the movies.&lt;br /&gt;
&lt;br /&gt;
=== {{w|Star_Wars|''Star Wars'' (original Trilogy)}}  ===&lt;br /&gt;
Luke, mostly accompanied by R2-D2, joins and parts from other sets of characters. There's a dotted alternative path on Jabba's line for the special edition. A dark line representing Vader, travels through the duel where he kills Obi-Wan and proceeds to the Death Star to meet with the main charcters for the first time. Vader travels to Hoth where all the characters escape and goes to Cloud City where Han is frozen. He then duels Luke before going for a long time alone and confronts Luke for a short time before taking him to the Death Star II where the climatic duel happens and he is killed. Leia at first with C-3PO is captured and placed on the Death Star before being rescued and proceeds to Hoth, Cloud City, the Sail Barge and finally to the Battle of Endor before reuniting with all the survivors. R2D2 and C-3PO are mostly together save for when Luke is attacking the Death Star and Luke's Jedi training. Luke's line swerves through most of the scenes, breaking away from the other characters during the Jedi Training, the duel on Cloud City and the duel on the Death Star II. Han and Chewie are always together as they go through all the scenes. Greedo, Lando and Boba all appear in their respective scenes. Yoda appears about halfway through (where Luke's Jedi training is marked). All the surviving lines group up at Endor except for Vader, the Emperor, Luke, and Lando; after the climactic duel, the latter two join the rest.&lt;br /&gt;
&lt;br /&gt;
=== {{w|Jurassic_Park_(film)|''Jurassic Park''}} ===&lt;br /&gt;
The human characters are in black; dinosaurs are in red. Dilophosaurus appears briefly to eat Nedry and then fades out again. the T-Rex appears at the start and swoops down on the cars and eats Gennaro. It then weaves out until the end where it eats the raptors. The three raptors are together at the beginning, but split up about halfway through. One has a dotted portion of line between &amp;quot;locked up&amp;quot; and &amp;quot;escapes.&amp;quot; In the meantime, they cut off the lines of Arnold and Muldoon. Malcolm, Grant, Sattler, Hammond and the kids all weave in and out of their respective scenes. The raptor lines all end when t-rex's swoops down to meet them at the end, and all the surviving humans leave together.&lt;br /&gt;
&lt;br /&gt;
=== {{w|12 Angry Men (1957 film)|''12 Angry Men''}} === &lt;br /&gt;
This is a very famous trial film that tells the story of a jury made up of 12 men as they deliberate the guilt or acquittal of a defendant on the basis of reasonable doubt. Only one of these angry men believe the defendant may be innocent and he argues this against the other 11, eventually convincing them that there is reasonable doubt in the case.&lt;br /&gt;
&lt;br /&gt;
The lines are labeled Juror 1 through Juror 12. They are all perfectly horizontal and parallel.&lt;br /&gt;
&lt;br /&gt;
The joke in the 12 Angry Men graphic is that in the movie all 12 jurors (the angry men) are in the same room for the entire duration of the movie. They never move and they all always interact with each other, hence their lines stay straight and close to each other.&lt;br /&gt;
&lt;br /&gt;
This is actually not entirely true. The movie begins in the court room; a couple of times during the proceedings, a few jurors go into the washroom and have a brief discussion there; and finally, in the very last scene, two jurors have a brief exchange in front of the courthouse. In fact, this chart would actually become a useful reference to the film if each of the jury's votes sessions was shaded as battles/events, and each juror's vote shown on their line, tracking when each juror's vote switches from 'guilty' to 'not guilty'. But as far as the characters' locations, there is no need for such a narrative chart, and that is the joke.&lt;br /&gt;
&lt;br /&gt;
=== {{w|Primer_(film)|''Primer''}} ===&lt;br /&gt;
The last box is a movie called Primer from 2004, which became a cult classic.  It is about a group of engineers who discover a way to travel through time, but only in one direction (backwards) and only at the speed of regular time (i.e. you have to stay in the time machine for one hour to move an hour back in time). Because of this, the story ends up having multiple versions of the same person existing at the same time; the plot and time-travel mechanics are notoriously hard to follow, so that it is almost impossible to figure out where each character is at one time, as the comic illustrates.&lt;br /&gt;
Three lines start on the left labeled Abe, Aaron, and Granger. They enter a mass of scribbling. Somewhere vaguely towards the end, three lines emerge and fade out, all labeled with question marks.&lt;br /&gt;
The chart for ''Primer'' is referenced in the title text of the fourth image in the [[what if?]] ''{{what if|101|Plastic Dinosaurs}}''.&lt;br /&gt;
&lt;br /&gt;
=== Background ===&lt;br /&gt;
&lt;br /&gt;
These charts are a reference to &amp;quot;''[https://commons.wikimedia.org/wiki/File:Minard.png Napoleon's March]''&amp;quot; the map and statistical infographic by cartographic pioneer&lt;br /&gt;
{{w|Charles Joseph Minard}}; it details the movements and losses of Napoleon's troops on his failed conquest of Russia.  The size and location of Napoleon's army are represented by tapering streams similar to the design used for Sauron's and Saurman's troops in the LotR Chart. Minard's chart is extensively discussed by {{w|Edward Tufte}} in his book ''The Visual Display of Quantitative Information'', and he summarizes some of that [https://www.edwardtufte.com/tufte/minard on his website].&lt;br /&gt;
&lt;br /&gt;
[[File:Minard.png|Napoleon's March by Minard]]&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
[colors given approximately in HEX at first appearance]&lt;br /&gt;
&lt;br /&gt;
These charts show movie character interactions.&lt;br /&gt;
The horizontal axis is time. The vertical grouping of the&lt;br /&gt;
lines indicate which characters are together at a given time.&lt;br /&gt;
&lt;br /&gt;
=== Lord of the Rings ===&lt;br /&gt;
&lt;br /&gt;
Lord of the Rings&lt;br /&gt;
&lt;br /&gt;
====[Legend]====&lt;br /&gt;
[yellow line (fff500)] ring&lt;br /&gt;
&lt;br /&gt;
[thin line, here dark green (467120)] ringbearer&lt;br /&gt;
&lt;br /&gt;
[grey colored area (e9e9e9)] battle/event&lt;br /&gt;
&lt;br /&gt;
[line ending with a dot, here black] death&lt;br /&gt;
&lt;br /&gt;
[bar, here light brown (daccae)] army&lt;br /&gt;
&lt;br /&gt;
[line, here brown (9d7929), in a bar, here light brown] character leading army&lt;br /&gt;
&lt;br /&gt;
[grey line (b7bfb6)] wizards&lt;br /&gt;
&lt;br /&gt;
[brown line (9d7929)] men&lt;br /&gt;
&lt;br /&gt;
[blue line (4a89a8)] elves&lt;br /&gt;
&lt;br /&gt;
[dark brown line (6c411b)] dwarves &lt;br /&gt;
&lt;br /&gt;
[dark turquoise line, 143035] ents&lt;br /&gt;
&lt;br /&gt;
[green line (4e7629)] hobbits&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[signs and colors not explained by the legend]''' &lt;br /&gt;
*[line starting / ending with a little sun means appearance / disappearance]&lt;br /&gt;
*[dark grey line (Eagles)]&lt;br /&gt;
&lt;br /&gt;
====[Entering and leaving of characters] ====&lt;br /&gt;
&lt;br /&gt;
'''[Characters entering the chart on the left, from top to bottom]'''&lt;br /&gt;
*Merry [green line]&lt;br /&gt;
*Pippin [green line]&lt;br /&gt;
*Sam [green line]&lt;br /&gt;
*Frodo [green line]&lt;br /&gt;
*Bilbo [green line]&lt;br /&gt;
*Gandalf [grey line, disappearance and reappearance marked by the sun-symbol]&lt;br /&gt;
*Arwen [blue line]&lt;br /&gt;
*Elrond [blue line]&lt;br /&gt;
*Galadriel [blue line]&lt;br /&gt;
*Saruman [grey line]&lt;br /&gt;
*Wormtongue [brown line]&lt;br /&gt;
*Éomer [brown line]&lt;br /&gt;
*Théoden [brown on light brown bar]&lt;br /&gt;
*Éowyn [brown line]&lt;br /&gt;
*Boromir [brown line on light brown bar]&lt;br /&gt;
*Denethor [brown line on light brown bar]&lt;br /&gt;
*Faramir [brown line]&lt;br /&gt;
*Sauron [red line (a23939) on black bar]&lt;br /&gt;
&lt;br /&gt;
'''[Characters leaving the chart on the right side, from top to bottom]'''&lt;br /&gt;
&lt;br /&gt;
[The five characters leaving off the top border of the chart] &lt;br /&gt;
&lt;br /&gt;
*Frodo&lt;br /&gt;
*Gandalf&lt;br /&gt;
*Bilbo&lt;br /&gt;
*Elrond&lt;br /&gt;
*Galadriel&lt;br /&gt;
&lt;br /&gt;
[text next to the group of five] Ship to the West&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[other characters leaving on the right side]&lt;br /&gt;
&lt;br /&gt;
*Merry&lt;br /&gt;
*Pippin&lt;br /&gt;
*Sam&lt;br /&gt;
*Treebeard [dark turquoise line]&lt;br /&gt;
*Legolas [blue]&lt;br /&gt;
*Gimli [dark brown line]&lt;br /&gt;
*Éomer&lt;br /&gt;
*Arwen&lt;br /&gt;
*Aragorn [brown line]&lt;br /&gt;
*Éowyn &lt;br /&gt;
*Faramir &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
''' [characters starting or leaving in the middle the chart] '''&lt;br /&gt;
*Nazgûl [black line, emerging from the black bar of Sauron's army, disappearance and reappearance marked by the sun-symbol. Second appearance splits splitting in two branches. Both end with death.]&lt;br /&gt;
*Aragorn [brown line, emerging via a dotted line]&lt;br /&gt;
*Legolas [blue line, emerging via a dotted line]&lt;br /&gt;
*Gimli [dark brown line, emerging via a dotted line]&lt;br /&gt;
*Eagles [dark grey line (808080), emerging and vanishing twice via a dotted line (second time after splitting into two branches)]&lt;br /&gt;
*Uruk-Hai [black bar, two groups emerging out of Saruman's line]&lt;br /&gt;
*Gandalf [grey line, disappearance and reappearance marked by the sun-symbol]&lt;br /&gt;
*Dead [light green bar, emerging out of nothing, lead by Aragorn, disappearance marked by the sun-symbol]&lt;br /&gt;
*Ents [grey bar, emerging out of nothing, lead by Treebeard]&lt;br /&gt;
*Men&amp;amp;Oliphaunts [black bar, emerging out of nothing]&lt;br /&gt;
*Elves [light blue bar (b3cdda), emerging near the line of Galadriel]&lt;br /&gt;
*Gollum [dark green line, emerging via a dotted line]&lt;br /&gt;
*Treebeard [dark turquoise line, emerging via a dotted line]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==== [List of battles/events as displayed in the chart] ====&lt;br /&gt;
&lt;br /&gt;
*Bilbo’s party	    [joined by] Merry, Pippin, Sam, Frodo, Bilbo, Gandalf    [ring goes from Bilbo to Frodo]&lt;br /&gt;
&lt;br /&gt;
*Gandalf imprisioned              [joined by] Gandalf, Saruman, Eagles &lt;br /&gt;
&lt;br /&gt;
*Weathertop [joined by] Nazgûl, Merry, Pippin, Sam, Frodo with the ring, Aragorn |&lt;br /&gt;
&lt;br /&gt;
*Council of Elrond       [including] Merry, Pippin, Sam, Frodo with the ring, Aragorn, Bilbo, Elrond, Legolas, Gimli, Gandalf, Boromir  &lt;br /&gt;
&lt;br /&gt;
*Moria      [including] Merry, Pippin, Sam, Frodo with the ring, Aragorn, Legolas, Gimli, Gandalf [disappearance], Boromir &lt;br /&gt;
&lt;br /&gt;
*Breaking of the Fellowship      [including] Merry, Pippin, Sam, Frodo with the ring, Aragorn, Legolas, Gimli, Boromir [death], Uruk-Hai [black] &lt;br /&gt;
&lt;br /&gt;
*Hobbits escape      [including] Éomer, Merry, Pippin, Uruk-Hai [death]  &lt;br /&gt;
&lt;br /&gt;
*Helm’s Deep      [including] Éomer, Gandalf, Elves [death], Uruk-Hai [death], Aragorn, Legolas, Gimli, Théoden  &lt;br /&gt;
&lt;br /&gt;
*Isengard flooded       [including] Treebeard [with bar of ents-army in grey], Merry, Pippin, Saruman [death], Wormtongue [death]&lt;br /&gt;
&lt;br /&gt;
*Pelennor fields       [including] Aragon [with bar of Dead-army in light green (bbcbad)], Legolas, Gimli, Merry, Éomer, Éowyn, Pippin, Gandalf [with bar in light brown], Faramir, Men&amp;amp;Oliphaunts [death], Orcs [death], Nazgûl [death and disappearing], Théoden [death], Denethor [death] &lt;br /&gt;
&lt;br /&gt;
*Black gate       [including] Aragorn, Legolas, Gimli, Merry, Éomer, Pippin, Gandalf [with bar in light brown], Orcs [death], Eagles, Nazgûl [death] [this battle/event-area is joined with ring destroyed-area]&lt;br /&gt;
&lt;br /&gt;
*Ring destroyed       [including] Sam, Frodo, Gollum [death], Sauron [death], Nazgûl [death] [this battle/event-area is joined with Black Gate-area]&lt;br /&gt;
&lt;br /&gt;
*Aragorn crowned king       [including] Arwen, Elrond, Aragorn, Legolas, Gimli, Merry, Éomer [without army], Pippin, Gandalf [without army], Éomyn, Faramir, Sam, Frodo&lt;br /&gt;
&lt;br /&gt;
=== Star Wars (original triology) ===&lt;br /&gt;
&lt;br /&gt;
Star Wars (original triology)&lt;br /&gt;
&lt;br /&gt;
====[Entering and leaving of characters] ====&lt;br /&gt;
&lt;br /&gt;
'''[Characters entering the chart on the left, from top to bottom]'''&lt;br /&gt;
&lt;br /&gt;
*Vader [black line]&lt;br /&gt;
*Leia [grey line]&lt;br /&gt;
*R2-D2 [blue line]&lt;br /&gt;
*C-3P0 [yellow line]&lt;br /&gt;
*Obi-Wan [grey line]&lt;br /&gt;
*Luke [grey line]&lt;br /&gt;
*Han [grey line]&lt;br /&gt;
*Chewie [brown line]&lt;br /&gt;
*Jabba [green line]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[Characters leaving the chart on the right side, from top to bottom]'''&lt;br /&gt;
&lt;br /&gt;
*Luke&lt;br /&gt;
*Lando [grey line]&lt;br /&gt;
*Chewie&lt;br /&gt;
*Leia&lt;br /&gt;
*R2-D2&lt;br /&gt;
*C-3PO&lt;br /&gt;
*Han&lt;br /&gt;
&lt;br /&gt;
''' [Characters starting or leaving not in battle/event-areas and not on the left/right side of the chart] '''&lt;br /&gt;
&lt;br /&gt;
*Greedo [green line]&lt;br /&gt;
*Jabba Special edition [green dotted line, marking an alternative way for Jabba that unites after a little loop with Jabba main line].&lt;br /&gt;
*Yoda [green line, death also marked on the chart but not marked in an battle/event-area]&lt;br /&gt;
*Boa Fett [green line]&lt;br /&gt;
*Empperor [black]&lt;br /&gt;
&lt;br /&gt;
==== [List of battles/events as displayed in the chart] ====&lt;br /&gt;
&lt;br /&gt;
*Leia rescued       [including] Luke, Leia, Han, Chewie, Obi-Wan, R2-D2, C-3PO  &lt;br /&gt;
&lt;br /&gt;
*Duel [first]      [including] Vader, Obi-Wan [death]  &lt;br /&gt;
&lt;br /&gt;
*Death Star      [including] Vader, Luke, R2-D2, Han, Chewie  &lt;br /&gt;
&lt;br /&gt;
*Hoth      [including] Vader, Luke, Han, R2-D2, Chewie, Leia, C-3PO  &lt;br /&gt;
&lt;br /&gt;
*Luke's entire Jedi training      [including] Yoda, Luke, R2-D2  &lt;br /&gt;
&lt;br /&gt;
*Han frozen      [including] Boba Fett, Vader, Han, Chewie, Leia, C-3PO, Lando  &lt;br /&gt;
&lt;br /&gt;
*Duel [second]      [including] Luke, Vader  &lt;br /&gt;
&lt;br /&gt;
*Sail barge      [including] Luke, Chewie, Leia, R2-D2, C-3PO, Lando, Han, Boba Fett [death], Jabba [death] &lt;br /&gt;
&lt;br /&gt;
*Endor      [including] Chewie, Leia, R2-D2, C-3PO, Han  &lt;br /&gt;
&lt;br /&gt;
*Duel [third]    [including] Emperor [death], Vader [death], Luke, Lando&lt;br /&gt;
&lt;br /&gt;
=== Jurassic Park ===&lt;br /&gt;
&lt;br /&gt;
Jurassic Park&lt;br /&gt;
&lt;br /&gt;
==== [Entering and leaving of characters] ====&lt;br /&gt;
[all dinosaurs are represented by red, all men by black lines]&lt;br /&gt;
[for dinosaurs locked up, there is a donut-sign.]&lt;br /&gt;
&lt;br /&gt;
'''[Characters entering the chart on the left, from top to bottom]'''&lt;br /&gt;
&lt;br /&gt;
*T-Rex&lt;br /&gt;
*Raptors [splitting into Raptor 1, Raptor 2 and Raptor 3 later in the chart]&lt;br /&gt;
*Malcolm&lt;br /&gt;
*Grant&lt;br /&gt;
*Sattler&lt;br /&gt;
*Gennaro&lt;br /&gt;
*Hammond&lt;br /&gt;
*Muldoon&lt;br /&gt;
*Arnold&lt;br /&gt;
*Nedry&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
'''[Characters leaving the chart on the right side]'''&lt;br /&gt;
&lt;br /&gt;
*T-Rex&lt;br /&gt;
*Kids [start short after the left border of the chart]&lt;br /&gt;
*Grant &lt;br /&gt;
*Sattler&lt;br /&gt;
*Malcolm&lt;br /&gt;
*Hammond&lt;br /&gt;
&lt;br /&gt;
===== [Characters starting or leaving not in events/battles and not on the left/right side of the chart] =====&lt;br /&gt;
&lt;br /&gt;
*Dilophosaurus [emerging by a dotted line, vanishing by a dotted line]&lt;br /&gt;
&lt;br /&gt;
==== [List of events as displayed in the chart] ====&lt;br /&gt;
&lt;br /&gt;
*Attack on cars     [including] T-Rex, Malcolm [serious injury marked by a sign looking like a hole], Gennaro [death], Grant, Kids &lt;br /&gt;
&lt;br /&gt;
*Must go faster       [including] T-Rex, Malcolm, Sattler, Muldoon  &lt;br /&gt;
&lt;br /&gt;
*Nedry eaten       [including] Dilophosaurus, Nedry [death]  &lt;br /&gt;
&lt;br /&gt;
*Gallimimus       [including] Grant, Kids, T-Rex&lt;br /&gt;
&lt;br /&gt;
*Shed       [including] Raptor 3, Arnold [death] &lt;br /&gt;
&lt;br /&gt;
*Clever girl       [including] Raptor 1, Muldoon [death], Raptor 2  &lt;br /&gt;
&lt;br /&gt;
*Locked up escapes       [including] Raptor 3, Sattler  [This area is only grey in the point of &amp;quot;locked up&amp;quot;, but a little further on the dotted line, the word &amp;quot;escapes&amp;quot; shows that the raptor 3 is free again. All over the entire comic, this is the only time that a description of &amp;quot;what happens&amp;quot; is given. All other labels are only titles, characters and locations and the note &amp;quot;Special edition&amp;quot; at Jabba / Star Wars, which is also a kind of meta-information.]&lt;br /&gt;
&lt;br /&gt;
*Kitchen locked up     [including] Raptor 1, Kids, Raptor 2 [marked as locked up with the donut-sign]  &lt;br /&gt;
&lt;br /&gt;
*Visitor Center      [including] T-Rex, Raptor 1 [death], Kids, Grant, Sattler, Raptor 3 [death]&lt;br /&gt;
&lt;br /&gt;
=== 12 angry men ===&lt;br /&gt;
&lt;br /&gt;
12 angry men&lt;br /&gt;
&lt;br /&gt;
==== [Entering and leaving of characters] ====&lt;br /&gt;
&lt;br /&gt;
[All lines go parallel, start and end at the borders of the chart. There are no areas of battle/event.]&lt;br /&gt;
&lt;br /&gt;
Juror 1 --------- Juror 1 ----------- Juror 1 ------------ Juror 1&lt;br /&gt;
&lt;br /&gt;
Juror 2 --------- Juror 2 ----------- Juror 2 ------------ Juror 2&lt;br /&gt;
&lt;br /&gt;
Juror 3 --------- Juror 3 ----------- Juror 3 ------------ Juror 3&lt;br /&gt;
&lt;br /&gt;
Juror 4 --------- Juror 4 ----------- Juror 4 ------------ Juror 4&lt;br /&gt;
&lt;br /&gt;
Juror 5 --------- Juror 5 ----------- Juror 5 ------------ Juror 5&lt;br /&gt;
&lt;br /&gt;
Juror 6 --------- Juror 6 ----------- Juror 6 ------------ Juror 6&lt;br /&gt;
&lt;br /&gt;
Juror 7 --------- Juror 7 ----------- Juror 7 ------------ Juror 7&lt;br /&gt;
&lt;br /&gt;
Juror 8 --------- Juror 8 ----------- Juror 8 ------------ Juror 8&lt;br /&gt;
&lt;br /&gt;
Juror 9 --------- Juror 9 ----------- Juror 9 ------------ Juror 9&lt;br /&gt;
&lt;br /&gt;
Juror 10 --------- Juror 10 ----------- Juror 10 ------------ Juror 10&lt;br /&gt;
&lt;br /&gt;
Juror 11 --------- Juror 11 ----------- Juror 11 ------------ Juror 11&lt;br /&gt;
&lt;br /&gt;
Juror 12 --------- Juror 12 ----------- Juror 12 ------------ Juror 12&lt;br /&gt;
&lt;br /&gt;
=== Primer ===&lt;br /&gt;
&lt;br /&gt;
[Three characters enter the chart on the left side, all represented by black lines]&lt;br /&gt;
*Abe&lt;br /&gt;
*Aaron&lt;br /&gt;
*Granger&lt;br /&gt;
[The lines come to a giant scribble and end up with dotted lines and question marks in the right area. One cannot see which line leads to which end.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Large drawings]]&lt;br /&gt;
[[Category:Timelines]]&lt;br /&gt;
[[Category:LOTR]]&lt;br /&gt;
[[Category:Star Wars]]&lt;br /&gt;
[[Category:Jurassic Park]]&lt;br /&gt;
[[Category:Velociraptors]]&lt;br /&gt;
[[Category:Time travel]]&lt;br /&gt;
[[Category:Fiction]]&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2036:_Edgelord&amp;diff=179843</id>
		<title>Talk:2036: Edgelord</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2036:_Edgelord&amp;diff=179843"/>
				<updated>2019-09-14T11:52:14Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Presumably has something to do with https://www.urbandictionary.com/define.php?term=edgelord&lt;br /&gt;
[[Special:Contributions/173.245.48.129|173.245.48.129]] 04:37, 22 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
What is up with the wolverine? Am I missing a joke here? Possibly a reference somewhere else? {{unsigned ip|172.68.34.106}}&lt;br /&gt;
: That is a reference to Wolverine, the Marvel Comics character, who has retractable &amp;quot;claws&amp;quot; stowed in his forearms and come out the back of his hands. The claws of an actual wolverine, like others in the family Mustelidae, are permanently extended.  [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 12:41, 22 August 2018 (UTC)&lt;br /&gt;
: It seems to me like the Wolverine thing is almost a non sequitur. I think a better comparison would be &amp;quot;like calling an engineering student a 'forcelord'&amp;quot; or &amp;quot;calling an astronomy PhD a 'Starlord'&amp;quot;, or a pharmacologist a 'Druglord'. -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 13:02, 22 August 2018 (UTC)&lt;br /&gt;
:: Agree. Update made.[[Special:Contributions/172.68.65.90|172.68.65.90]] 13:19, 22 August 2018 (UTC)&lt;br /&gt;
::: Aww... You guys made a better comparison than me. I put in the wolverine thing just to make a point that it was silly yet technically (by the loosest definition) accurate. I'm sorry it confused you. [[User:V|V]] ([[User talk:V|talk]]) 22:25, 23 August 2018 (UTC) ~&lt;br /&gt;
:: And someone studying military theory would be a Warlord? Or Lord of War? [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 06:53, 24 August 2018 (UTC)&lt;br /&gt;
::: There is an academic title called Master of War https://www.unsw.adfa.edu.au/master-war-studies-8571 {{unsigned ip|172.68.51.160}}&lt;br /&gt;
&lt;br /&gt;
If you are actually an &amp;quot;edgelord&amp;quot;, wouldn't you answer &amp;quot;no&amp;quot; anyway to provoke once again? [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 08:40, 22 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
I feel like there should be some discussion of what an edge (or hyper-edge) is in graph theory. [[Special:Contributions/162.158.165.22|162.158.165.22]] 10:20, 22 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
Good that he doesn't call his plumber a shitlord. Might need one again. [[Special:Contributions/172.69.54.75|172.69.54.75]] 11:54, 22 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
So... is the joke just a half-working pun on &amp;quot;edge&amp;quot;, or am I missing something? [[Special:Contributions/172.69.226.119|172.69.226.119]] 14:28, 22 August 2018 (UTC)&lt;br /&gt;
:Yes &amp;lt;[[Special:Contributions/162.158.167.120|162.158.167.120]] 15:29, 22 August 2018 (UTC)&amp;gt;&lt;br /&gt;
&lt;br /&gt;
So… Does this mean that white hat has a PhD in Graph Theory? {{unsigned ip|108.162.219.214}}&lt;br /&gt;
:It seems so. But please sign your comments. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 18:54, 22 August 2018 (UTC)&lt;br /&gt;
::Well, the White Hat in ''this'' comic has one. Doesn't necessarily imply the same thing about White Hats in any other comics. [[Special:Contributions/162.158.238.154|162.158.238.154]] 08:19, 23 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
Nothing to do with the Doctor who is a Time Lord? --[[Special:Contributions/172.68.34.94|172.68.34.94]] 20:16, 22 August 2018 (UTC)&lt;br /&gt;
:That's where my mind went as well, but I have no way to make that connection. (P.S. I love Alton Brown's description of himself on Twitter as a &amp;quot;Thyme Lord&amp;quot;. I almost wanted to add that as a &amp;quot;calling a chef&amp;quot; example above!) [[Special:Contributions/162.158.63.124|162.158.63.124]] 14:41, 23 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
Hehe &amp;quot;Starlord&amp;quot;--[[Special:Contributions/173.245.48.123|173.245.48.123]] 03:52, 24 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
About a week before this comic, SlackWyrm posted this one:  http://www.joshuawright.net/slack-wyrm-329.html Does that help? {{unsigned ip|108.162.249.244}}&lt;br /&gt;
:Nice comics and the edgelord theme runs until #335. Not sure if Randall knows this because he mentions many others at xkcd but not Joshua Wright. Nevertheless it's funny and maybe worth for a trivia section. Opinions? --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 15:18, 25 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
I trolled my friends with this comic, saying that they are a hyper-edgelord. I had a lot of giggles from that.Boeing-787lover 07:28, 6 October 2018 (UTC) {{unsigned|Xkcdreader52}}&lt;br /&gt;
&lt;br /&gt;
In Russian, word &amp;quot;graph&amp;quot; is also used to mean count's title.&lt;br /&gt;
[[Special:Contributions/141.101.104.221|141.101.104.221]] 11:52, 14 September 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2036:_Edgelord&amp;diff=179842</id>
		<title>Talk:2036: Edgelord</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2036:_Edgelord&amp;diff=179842"/>
				<updated>2019-09-14T11:50:59Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Presumably has something to do with https://www.urbandictionary.com/define.php?term=edgelord&lt;br /&gt;
[[Special:Contributions/173.245.48.129|173.245.48.129]] 04:37, 22 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
What is up with the wolverine? Am I missing a joke here? Possibly a reference somewhere else? {{unsigned ip|172.68.34.106}}&lt;br /&gt;
: That is a reference to Wolverine, the Marvel Comics character, who has retractable &amp;quot;claws&amp;quot; stowed in his forearms and come out the back of his hands. The claws of an actual wolverine, like others in the family Mustelidae, are permanently extended.  [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 12:41, 22 August 2018 (UTC)&lt;br /&gt;
: It seems to me like the Wolverine thing is almost a non sequitur. I think a better comparison would be &amp;quot;like calling an engineering student a 'forcelord'&amp;quot; or &amp;quot;calling an astronomy PhD a 'Starlord'&amp;quot;, or a pharmacologist a 'Druglord'. -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 13:02, 22 August 2018 (UTC)&lt;br /&gt;
:: Agree. Update made.[[Special:Contributions/172.68.65.90|172.68.65.90]] 13:19, 22 August 2018 (UTC)&lt;br /&gt;
::: Aww... You guys made a better comparison than me. I put in the wolverine thing just to make a point that it was silly yet technically (by the loosest definition) accurate. I'm sorry it confused you. [[User:V|V]] ([[User talk:V|talk]]) 22:25, 23 August 2018 (UTC) ~&lt;br /&gt;
:: And someone studying military theory would be a Warlord? Or Lord of War? [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 06:53, 24 August 2018 (UTC)&lt;br /&gt;
::: There is an academic title called Master of War https://www.unsw.adfa.edu.au/master-war-studies-8571 {{unsigned ip|172.68.51.160}}&lt;br /&gt;
&lt;br /&gt;
If you are actually an &amp;quot;edgelord&amp;quot;, wouldn't you answer &amp;quot;no&amp;quot; anyway to provoke once again? [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 08:40, 22 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
I feel like there should be some discussion of what an edge (or hyper-edge) is in graph theory. [[Special:Contributions/162.158.165.22|162.158.165.22]] 10:20, 22 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
Good that he doesn't call his plumber a shitlord. Might need one again. [[Special:Contributions/172.69.54.75|172.69.54.75]] 11:54, 22 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
So... is the joke just a half-working pun on &amp;quot;edge&amp;quot;, or am I missing something? [[Special:Contributions/172.69.226.119|172.69.226.119]] 14:28, 22 August 2018 (UTC)&lt;br /&gt;
:Yes &amp;lt;[[Special:Contributions/162.158.167.120|162.158.167.120]] 15:29, 22 August 2018 (UTC)&amp;gt;&lt;br /&gt;
&lt;br /&gt;
So… Does this mean that white hat has a PhD in Graph Theory? {{unsigned ip|108.162.219.214}}&lt;br /&gt;
:It seems so. But please sign your comments. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 18:54, 22 August 2018 (UTC)&lt;br /&gt;
::Well, the White Hat in ''this'' comic has one. Doesn't necessarily imply the same thing about White Hats in any other comics. [[Special:Contributions/162.158.238.154|162.158.238.154]] 08:19, 23 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
Nothing to do with the Doctor who is a Time Lord? --[[Special:Contributions/172.68.34.94|172.68.34.94]] 20:16, 22 August 2018 (UTC)&lt;br /&gt;
:That's where my mind went as well, but I have no way to make that connection. (P.S. I love Alton Brown's description of himself on Twitter as a &amp;quot;Thyme Lord&amp;quot;. I almost wanted to add that as a &amp;quot;calling a chef&amp;quot; example above!) [[Special:Contributions/162.158.63.124|162.158.63.124]] 14:41, 23 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
Hehe &amp;quot;Starlord&amp;quot;--[[Special:Contributions/173.245.48.123|173.245.48.123]] 03:52, 24 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
About a week before this comic, SlackWyrm posted this one:  http://www.joshuawright.net/slack-wyrm-329.html Does that help? {{unsigned ip|108.162.249.244}}&lt;br /&gt;
:Nice comics and the edgelord theme runs until #335. Not sure if Randall knows this because he mentions many others at xkcd but not Joshua Wright. Nevertheless it's funny and maybe worth for a trivia section. Opinions? --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 15:18, 25 August 2018 (UTC)&lt;br /&gt;
&lt;br /&gt;
I trolled my friends with this comic, saying that they are a hyper-edgelord. I had a lot of giggles from that.Boeing-787lover 07:28, 6 October 2018 (UTC) {{unsigned|Xkcdreader52}}&lt;br /&gt;
&lt;br /&gt;
In Russian, word &amp;quot;graph&amp;quot; is also used to mean count's title.&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2095:_Marsiforming&amp;diff=167804</id>
		<title>2095: Marsiforming</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2095:_Marsiforming&amp;diff=167804"/>
				<updated>2019-01-07T14:35:22Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: Wikified initial explanation&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2095&lt;br /&gt;
| date      = January 7, 2019&lt;br /&gt;
| title     = Marsiforming&lt;br /&gt;
| image     = marsiforming.png&lt;br /&gt;
| titletext = It has so many advantages--it preserves Martian life, requires fewer interplanetary launches, and makes it much easier to field-test Mars rovers.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a MARS ROVER. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
{{w|Terraforming}} is the (so far only suggested) process of changing a planet, usually to make it more habitable (for humans). A very common example is {{w|Mars}}, which is known to harbour water ice and believed to have previously been warm enough to have liquid water. Normally, plans for terraforming try to adjust temperatures to be compatible with liquid water, and an atmosphere containing significant amounts of oxygen but little carbon dioxide. In this comic [[Cueball]] is suggesting doing the opposite, and terraform {{w|Earth}} to be more like Mars, i.e. extremely dry, cold and with a very thin atmosphere. &lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2095:_Marsiforming&amp;diff=167803</id>
		<title>2095: Marsiforming</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2095:_Marsiforming&amp;diff=167803"/>
				<updated>2019-01-07T14:33:12Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2095&lt;br /&gt;
| date      = January 7, 2019&lt;br /&gt;
| title     = Marsiforming&lt;br /&gt;
| image     = marsiforming.png&lt;br /&gt;
| titletext = It has so many advantages--it preserves Martian life, requires fewer interplanetary launches, and makes it much easier to field-test Mars rovers.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a MARS ROVER. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
{{w|Terraforming}} is the (so far only suggested) process of changing a planet, usually to make it more habitable (for humans). A very common example is Mars, which is known to harbour water ice and believed to have previously been warm enough to have liquid water. Normally, plans for terraforming try to adjust temperatures to be compatible with liquid water, and an atmosphere containing significant amounts of oxygen but little carbon dioxide. In this comic Cueball is suggesting doing the opposite, and terraform Earth to be more like Mars, i.e. extremely dry, cold and with a very thin atmosphere. &lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2095:_Marsiforming&amp;diff=167802</id>
		<title>2095: Marsiforming</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2095:_Marsiforming&amp;diff=167802"/>
				<updated>2019-01-07T14:32:29Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: A short starter explanation&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2095&lt;br /&gt;
| date      = January 7, 2019&lt;br /&gt;
| title     = Marsiforming&lt;br /&gt;
| image     = marsiforming.png&lt;br /&gt;
| titletext = It has so many advantages--it preserves Martian life, requires fewer interplanetary launches, and makes it much easier to field-test Mars rovers.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a MARS ROVER. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
{{w:Terraforming}} is the (so far only suggested) process of changing a planet, usually to make it more habitable (for humans). A very common example is Mars, which is known to harbour water ice and believed to have previously been warm enough to have liquid water. Normally, plans for terraforming try to adjust temperatures to be compatible with liquid water, and an atmosphere containing significant amounts of oxygen but little carbon dioxide. In this comic Cueball is suggesting doing the opposite, and terraform Earth to be more like Mars, i.e. extremely dry, cold and with a very thin atmosphere. &lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:1834:_Lunch_Order&amp;diff=140178</id>
		<title>Talk:1834: Lunch Order</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:1834:_Lunch_Order&amp;diff=140178"/>
				<updated>2017-05-23T21:22:38Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;First! Hee Hee... Anyways... I've been waiting for the site to come back up to find out about &amp;quot;the time autocorrect stopped a nuclear war&amp;quot;... I was sure any such potential war would have been years ago (which this description confirmed), so any such saving would technically be a typo or a mere misspelling and not autocorrect, but I figured that's what this meant. Seeing the explanation now, is this söituation just a hypothetical from Randall? The comic is just portraying that? (I didn't make the launch/lunch connection until now, I can only see the title text on this site, which was down) :) - NiceGuy1 [[Special:Contributions/108.162.219.16|108.162.219.16]] 21:31, 12 May 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
It might be a long shot, according to wikipedia WarGames the movie released on May 7th 1983. 34 years and  a day before this comic was posted (IMDB state May 19th 1983 as the release date). [[Special:Contributions/141.101.105.72|141.101.105.72]]&lt;br /&gt;
&lt;br /&gt;
The premise could have originated with this short-lived Saturday-morning TV program: https://en.wikipedia.org/wiki/Far_Out_Space_Nuts [[User:Elsbree|Elsbree]] ([[User talk:Elsbree|talk]]) 16:10, 16 May 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
A chem professor I know once gave a presentation on &amp;quot;Monomers, ''dinners'' and polymers&amp;quot;. [[User:Nialpxe|Nialpxe]] ([[User talk:Nialpxe|talk]]) 14:23, 19 May 2017 (UTC)&lt;br /&gt;
&lt;br /&gt;
This is obviously referring to a russian submarine in the cold war. America had litarally blocked cuba off using boats and russia was coming to help cuba. Russian submarines were allowed to launch torpedos when hit. One submarine was reported to have heard a loud noise but did decide not to shoot. In the end russia couldnt take the pressure anymore and had to admit america had more balls. The fact the submarine didnt shoot prevented a WWIII&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:917:_Hofstadter&amp;diff=133731</id>
		<title>Talk:917: Hofstadter</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:917:_Hofstadter&amp;diff=133731"/>
				<updated>2017-01-15T20:25:28Z</updated>
		
		<summary type="html">&lt;p&gt;141.101.104.221: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;I bet Randall felt so clever when he came up with that acronym. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|#707|David}}&amp;lt;font color=#070 size=3&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=#508 size=4&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 01:24, 17 April 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
IMO he had every right to. {{unsigned ip|‎79.114.62.187}}&lt;br /&gt;
&lt;br /&gt;
Is it worth mentioning that Is Meta is an acronym for &amp;quot;I'm,&amp;quot; the first word of the acronym? That seems like it would be in the spirit of Hofstadter and &amp;quot;meta,&amp;quot; especially since Hofstadter talks a lot about the meaning of &amp;quot;I&amp;quot; in his books. --[[Special:Contributions/108.162.237.117|108.162.237.117]] 04:28, 4 November 2013 (UTC)&lt;br /&gt;
&lt;br /&gt;
Would &amp;quot;this acronym&amp;quot; imply that the sentence itself is an acronym for something much larger?  A biography, perhaps?  [[Special:Contributions/108.162.237.218|108.162.237.218]] 14:48, 28 May 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
The acronym of the title text is &amp;quot;tit riots (r)j&amp;quot;. I'm fairly sure this doesn't really mean anything, but &amp;quot;tit riots&amp;quot; just made me giggle. [[Special:Contributions/141.101.70.21|141.101.70.21]] 11:41, 18 June 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Should it read “I'm so meta, even this acrostic”? Or did Randall eschew correctness in favor of more readers knowing what the comic's words meant? [[User:YatharthROCK|YatharthROCK]] ([[User talk:YatharthROCK|talk]]) 22:25, 27 November 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
The explanation is factually incorrect... the prefix &amp;quot;meta&amp;quot; comes from the (ancient) Greek preposition &amp;quot;meta&amp;quot; which doesn't mean &amp;quot;beyond&amp;quot; or &amp;quot;out of&amp;quot; but merely &amp;quot;after&amp;quot;. It came to mean, as a prefix, &amp;quot;beyond&amp;quot; or &amp;quot;reflexive&amp;quot;, in modern european languages, via the latin neologism &amp;quot;metaphysica&amp;quot;, supposed to be a translitteration of the title of Aristotle's collection of essays. This mysterious title was given by their first editor, living centuries after Aristotle, and was &amp;quot;ta meta ta physica&amp;quot;, that is to say something like : &amp;quot;those [the books] after those regarding nature&amp;quot;. As those mysteriously titled books concerned the general principles of reality, (including famously the &amp;quot;god&amp;quot;, the divine principle of nature&amp;quot;), the title came wrongly to be understood as meaning &amp;quot;beyond nature&amp;quot;. Eventually, the &amp;quot;metaphysics&amp;quot; of something came to be understood as dealing with the principles &amp;quot;beyond&amp;quot; a given domain, hence &amp;quot;meta-studies&amp;quot; or &amp;quot;meta-psychology&amp;quot;, etc. It is, however, a mistake made since centuries... --[[User:Antinomiste|Antinomiste]] ([[User talk:Antinomiste|talk]]) 19:31, 3 March 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
The last panel's boustrophedon acronym. &amp;quot;Woah I Think He / Nailed It&amp;quot; is an acronym for &amp;quot;Within&amp;quot;, if you read in boustrophedon. [[Special:Contributions/141.101.104.221|141.101.104.221]]&lt;/div&gt;</summary>
		<author><name>141.101.104.221</name></author>	</entry>

	</feed>