explain xkcd - User contributions [en]

2414: Solar System Compression Artifacts

2021-01-21T11:05:37Z

162.158.159.142: /* Explanation */ Rewriting to better agree with my following paragraph.

{{comic
| number = 2414
| date = January 20, 2021
| title = Solar System Compression Artifacts
| image = solar_system_compression_artifacts.png
| titletext = Most of our universe consists of dark matter rendered completely undetectable by our spacetime codec's dynamic range issues.
}}

==Explanation==
{{incomplete|Created by a MISSING PHYSICAL PHENOMENON LOST DUE TO HIGH COMPRESSION. More on the title text - Dark matter and dynamic range issues need to be explained in more detail. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

{{w|Voyager 1}} is a [[:Category:Space probes|space probe]] launched by the United States in 1977. Originally designed to study the outer planets of the {{w|Solar System}}, it is now several decades into an extended mission beyond Neptune.

When images are compressed by a {{w|lossy compression}} format (e.g. {{w|JPEG}}), visual artifacts are created. The Voyager probe has made history for passing many milestones of our solar system. Randall here is suggesting that the probe has passed the artifacts. This cannot be true, as the solar system does not have compression artifacts{{Citation needed}}. However, the slightly discolored regions often created by compression may be a metaphor for the region of space that that solar radiation prevents from being a complete vacuum. Voyager 1 has passed through numerous such boundaries, as mentioned previously in [[1189: Voyager 1]].

Compression artifacts are often caused by large changes in coloration over a short distance, and Randall could feel that the drastic change in coloration from bright sun to dark vacuum could be creating a compression artifact around the Sun, somewhat like the Sun looking blurry due to low video quality. However, there is no definite region where solar radiation stops, only a boundary where it fades to a level lower than that of radiation from other sources. Some compression methods result in compression artifacts that behave in the same way, fading as the distance from the color boundary increases but never completely disappearing. (They may become literally unnoticeable because hexadecimal color values are discrete, but the compression artifacts will persist as slightly different RGB values before rounding to the nearest integer.)

The 'solar system' in the snapshot appears to be a 4-bit greyscale-plane at a more pixelated level than the image given. It can be picked out as being in 16 'banded' levels from the brightest (closest zones, within this image, to the Sun) to darkest (the furthest illustrated expanses, heading into interstellar space), with irregular or non-trivial transitional edges but no obvious or dominant dithering/speckling or 'noise'. The Voyager image (and track) is overlaid at finer resolution in the white 'line drawing' format.

The 'apparent pixels' seem to be at a resolution of close to the order of 1AU². A rough count of the pixelation boundaries from the craft to the leftmost edge, plus an additional allowance for the likely radius of the 'sun' (or, rather, its solar wind density, or similarly represented measure) still beyond the edge, is surprisingly close to to the 150 AU or so of distance that Voyager 1 is at, currently. (For perspective, the Earth is then ''by definition'' 30ish of the lower-resolution 'pixels' beyond the left of the image just (or within) one 'pixel' from the spot inhabited by the Sun itself. - The overlaid Voyager 'sketch' then stretches out over maybe a dozen such low-res pixels/AU, which is equivalent to slightly more than the radius of Saturn's orbit or the entire diameter of Jupiter's!

In the title text the mystery of the undetectable {{w|Dark Matter}}, which is makes up most of the mass in the universe, is explained since this dark matter is rendered completely undetectable by our spacetime codec's {{w|dynamic range}} issues.

==Transcript==
:[Irregular bands of gray are shown, shading from a white circular segment on the bottom left side of the panel to completely black on the right. The bands have pixelated edges. A small white space probe is shown just outside the last dark gray band, in the completely black are. A dotted line starting from inside the dark gray ending at the space probe indicated that it is moving to the right out of the gray area. Close to the white area there are many bands packed closely together and with hard to define edges. But there are five gray areas clearly separated from the white, with a tendency to be elongated towards the space probes direction.]

:[Caption below the panel:]
:Milestone: '''''Voyager''''' has passed through the streaming video compression artifacts that mark the edge of the solar system

{{comic discussion}}

[[Category:Space probes]]

Talk:2410: Apple Growers

2021-01-12T20:30:08Z

162.158.159.142: Intimidation isn't new to U.S. elections either.

I think this is the first strip to refer to Trump by name. Can anyone confirm that? [[User:Captain Video|Captain Video]] ([[User talk:Captain Video|talk]]) 05:32, 12 January 2021 (UTC)

: Negatory. [[2137: Text Entry]] is one I remember. [[Special:Contributions/172.69.63.173|172.69.63.173]] 06:00, 12 January 2021 (UTC)
::The earliest I'm aware of is [[980: Money]] from 2011 (so before he'd held elective office). It's almost unfindable in the giant image. Trump is mentioned in the lower right corner of the "Billionaires" box, inside the very large "Billions" section. [[Special:Contributions/108.162.237.64|108.162.237.64]] 06:12, 12 January 2021 (UTC)
::: And, of course, [[2383: Electoral Precedent 2020]].
:I was sufficiently interested in this question to actually look it up with the search function. Turns out the transcripts are actually useful for something!
:*[[980: Money]] is the only one from before Trump was elected President
:*[[1836: Okeanos]] (mentioned as "Trump" only) is the first after the election - May 12, 2017, nearly six months after it
:*[[1939: 2016 Election Map]] ("Trump" only)
:*[[2126: Google Trends Maps]]
:*[[2137: Text Entry]]
:*[[2220: Imagine Going Back in Time]] ("Trump" only)
:*[[2383: Electoral Precedent 2020]] ("Trump" only)
:*[[2399: 2020 Election Map]] ("Trump" only)
:As far as I can tell, these are the only nine comics (inclusive of this one) that use the name "Trump", and there are only four occurrences of "Donald Trump", including this. So it's not unknown, but Randall does seem to be avoiding it. [[Special:Contributions/108.162.237.238|108.162.237.238]] 06:56, 12 January 2021 (UTC)

Is it really a good idea to take the lack of masks on the spokesfolks as evidence of their mental state? It seems to me that Randall often draws characters without masks when they're not directly topical, even in these days of Covid precautions, and the reporters aren't wearing masks either. It's unlikely that either group is made up entirely of family members who share the same residence [citation needed], so I would count it more likely that they can all be assumed to be masked in the same way that they can be assumed to have eyes and mouths despite lack of any visual indicators of such. --[[Special:Contributions/108.162.245.216|108.162.245.216]] 07:48, 12 January 2021 (UTC)
:Do remember that they also has no close on, so unless the masks are important for the topic, then you can assume they have masks just as you can assume they have clothe on. (Or if you like, you can assume Megan and Ponytail doesn't, as I always do :-p ) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:04, 12 January 2021 (UTC)
::Specifically they don't have faces so... rja.carnegie@excite.com [[Special:Contributions/162.158.155.42|162.158.155.42]] 10:46, 12 January 2021 (UTC)

I'm pretty sure the state is Washington. Washington's pretty well known for apples, and the Cosmic Crisp variety mentioned in the title text was developed by researchers at Washington State University. [[Special:Contributions/108.162.245.40|108.162.245.40]] 08:00, 12 January 2021 (UTC)

According to a quick Wikipedia search, the title text's "we have SO MUCH to say" could be a reference to the fact that promotion for cosmic crisp was apparently the largest campaign in apple industry history. If anyone has the time to check and confirm that, we should add it to the explanation. [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 08:05, 12 January 2021 (UTC)
:Right now, "Pink Lady" is splurging an ad (basically a 'facetime filter'-type graphics enhanced thing) over here in the UK. Though the classic from my youth was the ¿Golden Delicious? brand doing a Bugsy Mallone-spoof ("le Crunch Bunch"). But I don't follow apple brands (there's a cooking-apple tree in a garden, that I pick from, been there 40-50 years - but now no idea what cultivar it is, etc) and I'm not particularly exposed to US news on apples, only its politics. Just so you know. [[Special:Contributions/162.158.155.138|162.158.155.138]] 08:36, 12 January 2021 (UTC)

Does anybody agree that "Uh, apples are great. Best fruit. Everyone should buy 1,000 of them" is a reference to Trump-style way of talking in speeches? [[User:Reisbein|Reisbein]] ([[User talk:Reisbein|talk]]) 08:31, 12 January 2021 (UTC)
:Yes already added this to the explanation. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:04, 12 January 2021 (UTC)

May I question that "Nothing in modern American history resembles this"? Possibly nothing in the national Capitol's modern history resembles this precisely, but the Capitol in Michigan was invaded last May, Tennessee had an incident of this kind in 2001 while trying to debate state income tax, and there was that thing at the Malheur National Wildlife Refuge, in Oregon. And there was Black rioting in Washington and in most other places and machine guns at the Capitol when Dr Martin Luther King was murdered, does that count as modern? And President Reagan was shot in Washington. Presidents and the White House are shot at all the time. The President's personal militia attacking other branches of the government is less usual, or is it? Robert Carnegie rja.carnegie@excite.com [[Special:Contributions/141.101.107.82|141.101.107.82]] 12:01, 12 January 2021 (UTC)
:In the sense of '' an attempt to overturn fair election results and prevent the orderly transition of power by attacking the Capitol,'' yes. It's not the "important buildings were attacked/threatened" part, it's the context and meaning behind the actions that's unprecedented. The incident was an unprecedented attack on democracy—it has been described by some as ''an attempted coup d'état in the United States'', and a lot of congressmen and House members, plus the Vice President were close to being seriously harmed/killed during the incident. [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 14:19, 12 January 2021 (UTC)
::: I take issue both with your description, Herobrine, and the fact that in some circles, this wasn't looked at as a coup attempt at all, but as an attempt to PROTECT democracy from treasonous congressmen and house members. But I do have a question for you. Exactly what words did the president use in his speech on January 6 to "incite a riot"? Please use direct quotes in your answer.[[User:Seebert|Seebert]] ([[User talk:Seebert|talk]]) 14:29, 12 January 2021 (UTC)
::::Went through the transcript of the speech and noted that I misunderstood one section that my statement was based on when I read it two days ago. Whether he was responsible for inciting the event is debatable, but since there is no definite statement in the transcript, I have removed the section from my comment and the explanation. As for the coup attempt part, give me a sec and I'll reply later. [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 14:41, 12 January 2021 (UTC)
::::Changed to "described by some as (lawmakers, media, etc.)" to avoid misunderstanding. But honestly, there is no way that this was an attempt to protect democracy—they were trying to overturn a fair election and prevent the orderly transition of power. [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 14:47, 12 January 2021 (UTC)
:::::The election results are disputed, and around 75% of Republicans and 20% of Democrats are willing to start a civil war over it. In what way can this be considered a fair election if all audits of the voter registration are blocked?[[User:Seebert|Seebert]] ([[User talk:Seebert|talk]]) 14:55, 12 January 2021 (UTC)
::::::Claims of election fraud have been rejected as totally meritless by numerous state and federal judges, state and local election officials, governors, the Justice and Homeland Security departments, and the Electoral College. I do not see how this the election was unfair. As for the "results are disputed" part, that is primarily the result of the president's efforts to overturn the results of the election and unwillingness to concede and admit his loss. Also, please reply with your quotes and sources, thanks. (Will reply again in a few hours, busy now) [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 15:10, 12 January 2021 (UTC)
:::::::People who do not trust the government to run a fair election- are not going to trust ''numerous state and federal judges, state and local election officials, governors, the Justice and Homeland Security departments and the Electoral College'', or for that matter ''the president'' to self-audit. These are all GOVERNMENT officials, and we're talking about people who have a profound distrust of the government. Why would you think ANY of those people can be trusted to tell the truth? All you've proven is that you are incapable of fairly looking at people who disagree with you. This isn't about evidence- because neither side has actually presented any believable evidence. The government has yet to produce an audit of voter registration changes, and the people disputing the voter registration only have graphs that indicate pay-for-vote scams. Without an audit by a third party- say some private accounting firm- there can be no faith in your "fair election".[[User:Seebert|Seebert]] ([[User talk:Seebert|talk]]) 15:21, 12 January 2021 (UTC)
::::::::Seebert, by that token, the people who dispute the fairness of the election claim that the fraud was SO widespread that ALL of these people—''numerous state and federal judges, state and local election officials, governors, the Justice and Homeland Security departments and the Electoral College''—have committed concerted fraud on an unprecedented scale in the United States. Correct me if I'm wrong, but aren't all these people from both parties? You're accusing Herobrine of being ''incapable of fairly looking at people who disagree with you'', but doesn't that claim seem far-fetched enough to you as to seem outlandish? When Clinton lost against Trump in what was also a hotly debated election, the electoral margins reported were far less important than in this election. Yet there was no fraud outcry. The big difference here is that Trump is crying fraud relentlessly. Now if a third party would intervene to audit the election, would that be proof enough for the people who back him? Would that settle it? Or wouldn't they claim that said third party was bought off, or was biased from the start anyway? Where does this end? In the meantime, we can see where it has led: to gallows being put up in front of the Capitol by a bunch of would-be executioners.[[User:A new user|A new user]] ([[User talk:A new user|talk]]) 17:00, 12 January 2021 (UTC)

::If the interpretation of January 6th is some armed citizens interfering with the franchise of other citizens... that isn't a new idea in America either, is it? It's just usually done at polling stations. Robert Carnegie rja.carnegie@excite.com [[Special:Contributions/162.158.159.142|162.158.159.142]] 20:30, 12 January 2021 (UTC)

Well this is certainly going to be a very controversial comic for a good while. I'm personally under the belief that the election was not rigged and Trump should resign, but I feel we should create a much more neutral explanation than it is currently.--[[Special:Contributions/172.69.33.119|172.69.33.119]] 16:52, 12 January 2021 (UTC)

:: Yeah, whoever wrote that explanation should resign. They're not even trying to be neutral, it is pure ideological soapboxing being shoveled down the throat of anyone reading. I vote that the first couple of paragraphs be deleted and reworked completely. Or else, this website can abandon any claim it might have had to objectivity and neutrality.[[Special:Contributions/172.68.37.44|172.68.37.44]] 17:02, 12 January 2021 (UTC)

::: I think the explanation is hilarious. To me, this strip is about everyone having abandoned doing what they are supposed to know how to do and instead wasting everyone's time sharing their opinion on the subject that is neither their expertise nor purview. The audience's clear disinterest in apple growers' opinion about Trump is conveyed by "Do you have any apple-related announcements at all?" remark. The current explanation just needs a similar remark along the lines of "Do you have anything xkcd-related at all?" to underscore the irony lest someone takes it seriously, and it will be perfect :) [[Special:Contributions/141.101.69.113|141.101.69.113]] 18:31, 12 January 2021 (UTC)
::::Well, I deleted a lot of the article that was filled with useless information irrelevant to the actual comic. Feel free to add more if you want.[[Special:Contributions/108.162.245.82|108.162.245.82]]

== Removing bias ==

When you add or remove from this explanation, please keep your political biases out of this. This is a webcomic explanation page, not a political discussion forum. [[Special:Contributions/162.158.107.219|162.158.107.219]]

Talk:2305: Coronavirus Polling

2020-05-11T22:13:44Z

162.158.159.142:

Wow am I first? If you want to get the public disunited, wait till you start to try to lift lockdown. Everyone has a different opinion of what to do first and when to do it! From Wales (Dis-UK) [[User:RIIW - Ponder it|RIIW - Ponder it]] ([[User talk:RIIW - Ponder it|talk]]) 20:14, 11 May 2020 (UTC)

Worth mentioning is the the last COVID poll referenced [http://www.politico.com/news/2020/04/15/poll-dont-stop-social-distancing-coronavirus-spread-187290] is actually a month old as of the publication of this comic ("The poll was conducted April 10-12" - whereas the comic is dated May 11.) I suspect the 81% number has shifted in the time since that poll data was current.[[Special:Contributions/172.69.68.157|172.69.68.157]] 20:28, 11 May 2020 (UTC)MeZimm

Ummm... "...is remarkably unanimous...", etc, in the description. Isn't that like "very unique" when there it isn't the only example? ("A large proportion are unanimous, with very few others who demur" or something?) [[Special:Contributions/162.158.159.142|162.158.159.142]] 22:13, 11 May 2020 (UTC)

Talk:2304: Preprint

2020-05-10T11:35:09Z

162.158.159.142: Accidentally cut this out of the pre-edit of my ramble. Nobody cares, though, so maybe I shouldn't have bothered.

I was going to mention the TeX format(/family), but someone got in there before me. So how about if it's a .wp4 document? ;) [[Special:Contributions/141.101.107.84|141.101.107.84]] 01:40, 9 May 2020 (UTC)
:But now [https://www.explainxkcd.com/wiki/index.php?title=2304:_Preprint&diff=191780&oldid=191776 the LaTeX reference is removed], anyway. [[Special:Contributions/162.158.158.163|162.158.158.163]] 16:14, 9 May 2020 (UTC)

Why is this comic labeled as a Saturday comic? I don't know what timezone you use, but it was posted Friday, well before midnight UTC. [[Special:Contributions/172.69.69.204|172.69.69.204]] 02:15, 9 May 2020 (UTC)

: I'm pretty sure that's just an error. The date for the comic in the [https://xkcd.com/archive/ archive] is "2020-5-8", which is today (Friday). Comic #[[2303]] correctly has the "Wednesday comic" category, and the archive lists its date as 2020-5-6 (which is Wednesday). ...And I've fixed it now. The category is automatically generated based on the date listed in the [[Template:Comic]] infobox at the top of the article; someone incorrectly entered it as "May 9, 2020" instead of "May 8, 2020". --[[User:V2Blast|V2Blast]] ([[User talk:V2Blast|talk]]) 02:53, 9 May 2020 (UTC)
::'Someone' == DgbrtBOT; and thus probably based off the time() it thinks it is, upon autocreating the base article, rather than any human erring. Depending on the home system's timezone, it probably ''was'' Saturday for DB, if not for Randall. Maybe an offset/correction/relocali(s|z)ation should be put into the code, but it seems to normally work out Ok and this comic might have been ''just'' over a threshhold... ''(edit: Wiki time in history seems to be UTC, for me at least - I'm in UTC+1/BST but as an IP-editor I haven't made any setting changes to my personal login that I don't have. DgbrtBOT piped up at 22:48, which at UTC+2 or more (Central Europe Daylight Savings, which matches what I recall of knowing about that entity, or anywhere more Easterly) would have been 'tomorrow', and I didn't spot the new comic until at least those dozen minutes after that which occured before my own clocks ticked past midnight. Given that Randall is (usually?) In UTC-5, or UTC-4 when daylight savings is established, maybe Dgbrt needs a special offset of -6 hours (or go directly via localtime() with the best current known Munroevian locale specified) in calculating things. Or we can let the community smooth these things out like we just did when a possible late-evening update causes this to be an issue?)'' [[Special:Contributions/162.158.155.62|162.158.155.62]] 03:17, 9 May 2020 (UTC)

Is "sarcastically pronouncing the registered trademark symbol" meant as pronouncing it "arr" in the way pirates talk? [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 15:00, 9 May 2020 (UTC)
:I would expect professional news anchors can come with something even more sarcastic. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 01:08, 10 May 2020 (UTC)

In 2020 I use pdf to put documents with tables onto a website, because html exports from editors are voluminous and brittle. [[Special:Contributions/162.158.6.118|162.158.6.118]] 10:32, 10 May 2020 (UTC)
:As someone who regularly takes tables ''from'' PDF in order to put them into spreadsheets for further use, some people don't do me any favours by that method. Among the problems, if the table setter didn't pay attention to the column widths then the copied-out text of two adjacent cells that don't ''appear'' to overlap each other will interlace at a character level and need editing back to separate entites. And then there's the inconsistencies of Header rows atop the table and/or atop the next newpage the table splits over. I could run a quick script on (X)HTML tables, and get it perfectly for my needs. CSV, or even TabSV, would actually be my preferred transport format (i.e. ''no'' format, just pure layout without even spanned/merged cells, and I can redo what needs redoing on the final redo), but I can't ever seem to get them to do that for me despite having the data almost in that form prior to the PDFing... Grrrr. [[Special:Contributions/162.158.159.142|162.158.159.142]] 11:30, 10 May 2020 (UTC)

Talk:2304: Preprint

2020-05-10T11:30:22Z

162.158.159.142:

I was going to mention the TeX format(/family), but someone got in there before me. So how about if it's a .wp4 document? ;) [[Special:Contributions/141.101.107.84|141.101.107.84]] 01:40, 9 May 2020 (UTC)
:But now [https://www.explainxkcd.com/wiki/index.php?title=2304:_Preprint&diff=191780&oldid=191776 the LaTeX reference is removed], anyway. [[Special:Contributions/162.158.158.163|162.158.158.163]] 16:14, 9 May 2020 (UTC)

Why is this comic labeled as a Saturday comic? I don't know what timezone you use, but it was posted Friday, well before midnight UTC. [[Special:Contributions/172.69.69.204|172.69.69.204]] 02:15, 9 May 2020 (UTC)

: I'm pretty sure that's just an error. The date for the comic in the [https://xkcd.com/archive/ archive] is "2020-5-8", which is today (Friday). Comic #[[2303]] correctly has the "Wednesday comic" category, and the archive lists its date as 2020-5-6 (which is Wednesday). ...And I've fixed it now. The category is automatically generated based on the date listed in the [[Template:Comic]] infobox at the top of the article; someone incorrectly entered it as "May 9, 2020" instead of "May 8, 2020". --[[User:V2Blast|V2Blast]] ([[User talk:V2Blast|talk]]) 02:53, 9 May 2020 (UTC)
::'Someone' == DgbrtBOT; and thus probably based off the time() it thinks it is, upon autocreating the base article, rather than any human erring. Depending on the home system's timezone, it probably ''was'' Saturday for DB, if not for Randall. Maybe an offset/correction/relocali(s|z)ation should be put into the code, but it seems to normally work out Ok and this comic might have been ''just'' over a threshhold... ''(edit: Wiki time in history seems to be UTC, for me at least - I'm in UTC+1/BST but as an IP-editor I haven't made any setting changes to my personal login that I don't have. DgbrtBOT piped up at 22:48, which at UTC+2 or more (Central Europe Daylight Savings, which matches what I recall of knowing about that entity, or anywhere more Easterly) would have been 'tomorrow', and I didn't spot the new comic until at least those dozen minutes after that which occured before my own clocks ticked past midnight. Given that Randall is (usually?) In UTC-5, or UTC-4 when daylight savings is established, maybe Dgbrt needs a special offset of -6 hours (or go directly via localtime() with the best current known Munroevian locale specified) in calculating things. Or we can let the community smooth these things out like we just did when a possible late-evening update causes this to be an issue?)'' [[Special:Contributions/162.158.155.62|162.158.155.62]] 03:17, 9 May 2020 (UTC)

Is "sarcastically pronouncing the registered trademark symbol" meant as pronouncing it "arr" in the way pirates talk? [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 15:00, 9 May 2020 (UTC)
:I would expect professional news anchors can come with something even more sarcastic. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 01:08, 10 May 2020 (UTC)

In 2020 I use pdf to put documents with tables onto a website, because html exports from editors are voluminous and brittle. [[Special:Contributions/162.158.6.118|162.158.6.118]] 10:32, 10 May 2020 (UTC)
:As someone who regularly takes tables ''from'' PDF in order to put them into spreadsheets for further use, some people don't do me any favours by that method. Among the problems, if the table setter didn't pay attention to the column widths then the copied-out text of two adjacent cells that don't ''appear'' to overlap each other will interlace at a character level and need editing back to separate entites. And then there's the inconsistencies of Header rows atop the table and/or atop the next newpage the table splits over. CSV, or even TabSV, would be my preferred transport format (i.e. ''no'' format, just pure layout without even spanned/merged cells, and I can redo what needs redoing on the final redo), but I can't ever seem to get them to do that for me despite having the data almost in that form prior to the PDFing... Grrrr. [[Special:Contributions/162.158.159.142|162.158.159.142]] 11:30, 10 May 2020 (UTC)

Talk:2301: Turtle Sandwich Standard Model

2020-05-03T01:35:33Z

162.158.159.142:

This is the first time I have had a chance to see the comic early enough to make a meaningful contribution to the explanation, but this time I have no idea whatsoever what the comic is about! [[User:Moosenonny10|Moosenonny10]] ([[User talk:Moosenonny10|talk]]) 20:32, 1 May 2020 (UTC)

Looks like it is referencing the standard model of elementary particles. The title text mentions four of the quarks(top,bottom,charm,strange) [[Special:Contributions/162.158.106.150|162.158.106.150]] 20:38, 1 May 2020 (UTC)

Disagree with DgbrtBOT that this is primarily to do with genetics. I agree that it's about the standard model. Up, down, charmed and strange. It may 'because I'm dumb', but even I'm not that dumb.
:I agree that this is not about genetics. The usual Mendelian diagram has the same traits in both dimensions. Maybe he didn't make the particle physics connection because that has more than 4 boxes. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 21:52, 1 May 2020 (UTC)
:Agree with Barmar: This is not at all about genetics, but only about the particles standard model. Hence the name given by Randal, hence the dimensions not fitting Mendel, hence the lab reference and hence the biological absurd combinations. It does not fit genetics at all, but it perfectly fits a basic assumption of the standard particle modell: That every combination does exist. Labs all over the world have spend decades trying find/prove the existance of a particle predicted by lining up the dimensions of the particles standard model just as shown here and most seeming just as absurd. [[Special:Contributions/172.68.51.52|172.68.51.52]] 00:06, 2 May 2020 (UTC)

I added a bit about the physics part of it, but it can definitely use more information! [[User:ChunyangD|ChunyangD]] ([[User talk:ChunyangD|talk]]) 20:52, 1 May 2020 (UTC)

Randall missed an obvious physics/turtle joke "turtles all the way down" reference here [[Glenn Strycker]] 4:56pm CDT 1 May 2020
: It was the first thing I thought, Randall can be sure his readers fill in such details... [[Special:Contributions/141.101.104.221|141.101.104.221]] 21:08, 2 May 2020 (UTC)

If this really is about genetics, which I question, it seems likely that most people who haven't studied genetics would find the use of genetics jargon to be less than helpful in an explanation.[[User:Darthpoppins|Darthpoppins]] ([[User talk:Darthpoppins|talk]]) 22:46, 1 May 2020 (UTC)

In my opinion, the ExplainXKCD community has been successfully trolled by the contributor of the explanation of this comic, and with humorous effect. The troll consists of an explanation couched entirely in terms used primarily by biologists but generally difficult for others to understand, contrary to this community's practice of trying to simplify. [[Wikipedia:genotype|Genotypes]], [[Wikipedia:phenotype|phenotypes]], [[Wikipedia:Punnett Square|Punnett Squares]], [[Wikipedia:heterozygous|heterozygous]], [[Wikipedia:homozygous|homozygous]], [[WIkipedia:ontogeny|ontogeny]]. That being said, the contributor is certainly correct that the comic is about [[Wikipedia:genetics|genetics]], in that the depicted two-by-two square is immediately suggestive of the visual tool used for predicting the results of cross-breeding experiments. And the comic is certainly also about [[Wikipedia:particle physics|particle physics]], in that the comic title refers to a "Standard Model" and then the title text alludes to particle names used in the [[Wikipedia:standard model|standard model of particle physics]]. So the comic's joke is about the unexpected juxtaposition of genetics with particle physics, and also is about turtle sandwiches which, as drawn, are intrinsically funny anyway. Yes, @Glen, all the way down. JohnB [[Special:Contributions/162.158.75.116|162.158.75.116]] 00:25, 2 May 2020 (UTC)

This looks less like a Punnet Square than it does like one of those political alignment chart memes. Punnet squares use symbols next to each other to designate genotypes, not diagrams of the results. Not to mention that the individual labels along the sides are supposed to be alleles, not separate effing traits! That whole paragraph is completely wrong and should be removed. [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 00:44, 2 May 2020 (UTC)

Isn't this about supersymmetry? The missing pieces are the bosonic partners of the known fermions (matter particles), and the fermionic partners of the known bosons (force particles).... Joel K

For a second, I thought it said "Turkey Sandwich Standard Model"[[User:AllTheWayDown|AllTheWayDown]] ([[User talk:AllTheWayDown|talk]]) 01:31, 2 May 2020 (UTC)

This is clearly a use of the box method for factoring a trinomial in standard form (ax^2 + bx + c) which the coefficient of the first term (say ax^2) is not simply 1 (a<>1). Actually, the moment I saw it I knew exactly what it was, simply because I have been helping my high school son with his algebra the past few weeks. I laughed out loud! I never heard of this method as a math undergrad because it was brand new at the time, but now it's evidently fairly standard.

You create a 2x2 box, and write the first term of the trinomial (ax^2) in the top right corner and the last term (c) in the lower left. Then you have to figure out what factoring of a x c gives you two middle terms that when added will yield the middle term, bx. Let's call those b1x and b2x (where b1 x b2 = a x c, and b1 + b2 = b). You put those terms, b1x and b2x in the two empty boxes (in either order). Then you pull out common factors along each row and column until they multiply correctly to get the table. The terms you have pulled out then are your two binomial factors of the trinomial.

Randall has factored a turtle sandwich where the first term (ax^2) is a sandwich and the last term (c) is a turtle. These are the known terms (check marks). The unknown terms, through working the box method, turn out work if the bread is the common factor along the top row and the turtle shell on the bottom row. The sandwich filling is the common factor in the first column, and the shell-less turtle is the common factor on the second column.

I believe the alt-text is a play on the fact that, if I'm not mistaken, there are more ways to factor a trinomial if you allow imaginary numbers, because that allows square roots of negative numbers. Analogously, dividing shells differently suggests subatomic particles—thus, various quark flavors like charm and strange.
[[User:EternalLearner|EternalLearner]] ([[User talk:EternalLearner|talk]]) 01:52, 2 May 2020 (UTC)

Apropos of nothing, and just for the comic relief of the commenters, I searched for 'turtle' 'sandwich' 'standard' 'model' and came across [https://www.globalxvehicles.com/turtle.html | this bad boy]. I couldn't resist sharing. Thanks for the knowledge. -- brad

Uhm,wut,mostly. Okay so the earth is on a turtle. What holds the turtle up? It's turtles, all the way down, I've heard but? "Turtle legs" is my answer. Why I'm here: didn't xkcd.com used to say it was updated Monday, w, f, ? [[Special:Contributions/162.158.78.182|162.158.78.182]] 04:55, 2 May 2020 (UTC)
:Obviously, the turtle doesn't need to be held up. It's a sea turtle, it swims. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:13, 2 May 2020 (UTC)

Please refer to http://recipes-plus.com/recipe/turtle-sandwiches-kids-30062 for the top left sighting. [[User:Steven Nijhuis|Steven Nijhuis]] ([[User talk:Steven Nijhuis|talk]]) 05:35, 2 May 2020 (UTC)

LOL. This is the most random comments I have seen on one of these. This is 100% particle physics. Standard model of particle physics, up quarks, charmed quarks.. this is a commentary on how we know there is gravity, and we know there are electrons and we have a standard model which is still being filled in, in order to unify the theories.

--Adam Outler [[Special:Contributions/108.162.238.131|108.162.238.131]] 06:03, 2 May 2020 (UTC)
----

I'm a bit confused by these comments. It seems like people are getting thrown off by the 2x2 table thinking that the comic must be related to where they've seen tables before (genetics / factoring quadratics / ...). This is wrong though, this comic is 100% particle physics.
In particle theoretical (particle) physics, the way forward has often been unification (combining forces of nature mathematically). We know the Standard Model is wrong, so physicists have been searching for ways to theoretically extend the known theory for decades. One of the most popular ways of doing this is looking for a larger symmetry group that encompasses the known symmetry groups of the equations governing the Standard Model. And the first time that physicists got REALLY close to a working theory was extending to E(5). When doing this mathematical extension of the Standard Model, you automatically get new messenger particles that are predicted (leptoquarks) that would theoretically make a transition between leptons and quarks possible (much like the weak interaction allows for transitions between quarks). The whole thing tends to get represented as a matrix visually, much like the turtle sandwich joke.
tl;dr: The joke makes perfect sense in theoretical particle physics. This type of diagram is common in extending the Standard Model (which is definitely incomplete) to a larger symmetry group like E(5).
Tom B

Outside of anything scientific, I think it's also referring to the memetic "Is a BLANK a sandwich?" debate (normally a hotdog or a calzone) [[Special:Contributions/141.101.107.84|141.101.107.84]] 18:12, 2 May 2020 (UTC)
:The big debate, surely, is orientation. If I prepare (say) some chicken-breast in some sort of marinade, and then half-toast some bread (half-way ''towards'' toasting, not one-sidedly; I put the slices in the toaster but manually eject them when it makes a click which equates to roughly half way to the dialled-in toasting degree, at least on my old toaster) then lightly butter(/non-dairy spread) them and use them to sandwich the chicken, but with a slice of cheese atop the chicken, then it tastes nice. If, during consumption or just moving the construct to a plate, I end up inverting it so it's bread/chicken/cheese/bread from top to bottom (happens when passed from hand to hand, I think, between picking up and alighting anew) it tastes... still nice, but ''different''. Yes, the tongue is set only below the route the sandwich takes, but I'm not sure that accounts for it (experiments while inverting myself, with or without inverting the sandwich, are yet to be trialled without other factors going uncontrolled). However, it does mean that a sandwich cannot be assumed to have a reflective or rotational symmetry in the horizontal plane or any horizontal axis, which is the usual bar quoted against the smörgåsbord... [[Special:Contributions/162.158.159.142|162.158.159.142]] 01:35, 3 May 2020 (UTC)

Anyone else mistakenly see the tomato slice/cheese/lettuce as a [https://en.wikipedia.org/wiki/Turtles_(chocolate) Turtle Chocolate] and a slice of [https://en.wikipedia.org/wiki/Turtle_pie Turtle Pie]?

Talk:2298: Coronavirus Genome

2020-04-25T12:05:12Z

162.158.159.142:

Epigenetics is a pun, right? I think it's a pun but I don't know what and it's maddening. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 23:03, 24 April 2020 (UTC)
:...{{w|Epigenetics}} is a real thing—the study of how changes in things other than the genome itself can be passed down between generations. An example is conditioning a mouse to be scared of the smell of oranges/cherries/almonds by having them associate the scent of acetophenone with an electric shock, then testing whether its pups also have the same fear of that smell: they do, but this obviously can't be by the genome itself changing (no component of this has a lot of ionizing radiation{{Citation needed}}). Whatever causes this is the topic of actual epigenetics. --[[User:Volleo6144|Volleo6144]] ([[User talk:Volleo6144|talk]]) 00:12, 25 April 2020 (UTC)
::I know that, I added the link to the article. But afaik that has nothing to do with how the genome is formatted in Word, and I think it's a pun. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 00:31, 25 April 2020 (UTC)

since when does notepad have spellcheck? [[Special:Contributions/172.68.226.46|172.68.226.46]] 23:05, 24 April 2020 (UTC)
: Word does, so maybe she is using Word instead? Kind of contradictory. [[Special:Contributions/172.69.34.46|172.69.34.46]] 23:14, 24 April 2020 (UTC)

True Story: In the 1980s, as part of the Work Experience initiative at my school, I was assigned to one of my local council's offices (I'd applied for their computer department, but someone else got that). I don't ''think'' the word-processor I used at home (Psion Exchange) had spellcheck, but the one the office used (Lotus? Can't actually recall, but it, like most things, was DOS-based) definitely had, and it was very easy to edit in new words. Inspired by the chemistry lessons I'd recently had, and some 'reports' I was asked to write (keeping the kid busy, more like!) that dealt with chemical degradation of concrete under the action of salt and suchlike, I of course added "NaCl" then absolutely any other chemical formulae I could think of. "H2SO4" was an early one (partial subscript formatting wasn't relevent to the spill-chucker) but I eventually got round to CH4, C2H6, C3H8, etc, and then as many of the derived alcohols, alkenes, alkynes, etc that I could be bothered to type in. Which were a lot. By the end I was 'confident' that nobody would ever type ''any'' correct chemical formula into that machine (no network-shared resources!) and have to worry about false-positive typo alerts. Yeah, well, I was still at school and thought I knew ''everything''. [[Special:Contributions/162.158.159.70|162.158.159.70]] 23:37, 24 April 2020 (UTC)

Can confirm: virus genomes are looked at in notepad. I worked at one of the national laboratories for a summer, experimenting with ways to check for the length of a gene and strength of genetic expression in various circumstances in E. coli. We used notepad because even old computers can open very large files without difficulty, and all our scripts were in Perl, which can easily output to .rtf or .txt file formats. These files are huge, by the way. If you hold down on the scroll bar so it's zooming to the bottom, you could be waiting 20 minutes to reach the end depending on the number of kilobase pairs in your microbe. And epigenetics is not a pun. It's a real word. [[Special:Contributions/172.68.143.192|172.68.143.192]] 00:15, 25 April 2020 (UTC)

Concurrent to the work in the medical community, work is underway in various open source software communities to fix bugs and other issues with software (eg genome analysis tools) that is useful to the scientists combatting COVID-19. These include the Debian "biohackathon" (https://lwn.net/Articles/816280/) as well as support from Mozilla (https://lwn.net/Articles/816386/). Parallel to these efforts, the FSF (Free Software Foundation) has focused on the shortage of medical equipment: https://lwn.net/Articles/816392/ [[Special:Contributions/108.162.242.5|108.162.242.5]] 00:34, 25 April 2020 (UTC)

I’m suddenly inspired to write a DNA-edit-mode for Emacs (if it doesn’t have it already) which would allow for the virus spell check as described in this comic. [[Special:Contributions/172.69.63.153|172.69.63.153]] 04:16, 25 April 2020 (UTC)

Derek Lowe has some insights about actual coronavirus mutations [https://blogs.sciencemag.org/pipeline/archives/2020/04/21/watching-for-mutations-in-the-coronavirus here], if you are interested.

Given coronavirus has an RNA genome, shouldn't all the 'T's be replaced by 'U's?

The sequence in the transcript does not actually appear on the [https://www.ebi.ac.uk/ena/data/view/MT344963&display=text site] mentioned in the explanation. In fact, when I google for 'TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA' I only get this particular site.
:Well, ''obviously'' it's a new variant, yet unknown to other clinical studies. Of RNA that has switched to looking like DNA, so this is a hot discovery! [[Special:Contributions/162.158.159.142|162.158.159.142]] 12:05, 25 April 2020 (UTC)