explain xkcd - User contributions [en]

2298: Coronavirus Genome

2020-04-25T15:25:02Z

162.158.78.136: /* Explanation */ spelling

{{comic
| number = 2298
| date = April 24, 2020
| title = Coronavirus Genome
| image = coronavirus_genome.png
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.
}}

==Explanation==
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abbreviated as G, A, C, T, and U).

The nucleotide sequence displayed is a 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from the East Coast of the United States. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. However, SARS-CoV-2 is an RNA-virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence has been altered to resemble the more familiar codes of DNA.

[[Cueball]] is surprised that Megan and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this "{{w|epigenetics}}". In the real world, epigenetics is the study of changes that are not caused by changes in nucleotides, but by other chemical modifications to DNA and chromosomes that cause changes in patterns of gene expression and activation, often many generations down. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or rendered in boldface or enlarged to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.

The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude, and may exceed the capabilities of any available spell-checking program.

The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences to see their differences and similarities, an activity which is the bread and butter of bioinformatics nowadays. Grammar checking would be analogous to being able to understand the chemical and biological function of a sequence straight from its nucleotides, something we are unable to do at the moment except in very limited ways and only in a few simple cases.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]
:Cueball (off-screen): So that's the coronavirus genome, huh?
:Megan: It is!
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA

:[Cueball walks up and stands behind Megan, still working on the laptop.]
:Cueball: It's weird that you can just look at it in a text editor.
:Megan: It's essential!
:Megan: We geneticists do most of our work in Notepad.

:[A frameless panel, Cueball still standing behind Megan.]
:Cueball: Notepad?
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.
:Cueball: Ah, okay.
:Megan: That extra formatting is called "epigenetics".

:[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.]
:Cueball: Hey, why does that one have a red underline?
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.
:Cueball: ''Clever!''

{{comic discussion}}
[[Category: Comics featuring Cueball]]
[[Category: Comics featuring Megan]]
[[Category: Biology]]
[[Category:COVID-19]]

2298: Coronavirus Genome

2020-04-25T15:22:47Z

162.158.78.136: /* Explanation */ spelling, grammar, wording

{{comic
| number = 2298
| date = April 24, 2020
| title = Coronavirus Genome
| image = coronavirus_genome.png
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.
}}

==Explanation==
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abreviated as G, A, C, T, and U).

The nucleotide sequence displayed is a 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from the East Coast of the United States. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. However, SARS-CoV-2 is an RNA-virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence has been altered to resemble the more familiar codes of DNA.

[[Cueball]] is surprised that Megan and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this "{{w|epigenetics}}". In the real world, epigenetics is the study of changes that are not caused by changes in nucleotides, but by other chemical modifications to DNA and chromosomes that cause changes in patterns of gene expression and activation, often many generations down. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or rendered in boldface or enlarged to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.

The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude, and may exceed the capabilities of any available spell-checking program.

The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences to see their differences and similarities, an activity which is the bread and butter of bioinformatics nowadays. Grammar checking would be analogous to being able to understand the chemical and biological function of a sequence straight from its nucleotides, something we are unable to do at the moment except in very limited ways and only in a few simple cases.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]
:Cueball (off-screen): So that's the coronavirus genome, huh?
:Megan: It is!
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA

:[Cueball walks up and stands behind Megan, still working on the laptop.]
:Cueball: It's weird that you can just look at it in a text editor.
:Megan: It's essential!
:Megan: We geneticists do most of our work in Notepad.

:[A frameless panel, Cueball still standing behind Megan.]
:Cueball: Notepad?
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.
:Cueball: Ah, okay.
:Megan: That extra formatting is called "epigenetics".

:[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.]
:Cueball: Hey, why does that one have a red underline?
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.
:Cueball: ''Clever!''

{{comic discussion}}
[[Category: Comics featuring Cueball]]
[[Category: Comics featuring Megan]]
[[Category: Biology]]
[[Category:COVID-19]]

2049: Unfulfilling Toys

2020-02-13T20:47:28Z

162.158.78.136: /* Title-text: Falling-Apart Rubik's cube */

{{comic
| number = 2049
| date = September 21, 2018
| title = Unfulfilling Toys
| image = unfulfilling_toys.png
| titletext = We were going to do a falling-apart Rubik's cube that was just 27 independent blocks stuck together with magnets, but then we realized it was actually really cool and even kind of worked, so we cut that one.
}}

==Explanation==
This comic lists and illustrates a number of classic toys that are missing a key piece or attribute that makes them work and/or that makes them unique.

====Rigid Slap Bracelet====
{{w|Slap bracelet}}s are flexible curved strips of spring steel that roll up and become a bracelet when you slap them against your wrist. This function operates on the same principle and basic design as the rolled band of metal inside a tape-measure. A rigid one would not twist and would be deeply frustrating and potentially painful.

====Sealed Stomp Rocket====
A {{w|stomp rocket}} has a rubber pouch full of air, connected via a hose to a vertical cylinder contained snugly within the base of an air propelled rocket. By stomping on the pouch, the air is forced out the top end of the cylinder, launching the rocket into the air. By sealing the air channel, the rocket would stay on the cylinder and the person would just be bounced into the air by the pouch – acting like the world's smallest bouncy house – or the pouch will burst rendering the toy even more useless.

====Pump-only Supersoaker====
A {{w|Super Soaker}}™ is a brand of water gun that works by first pumping air into the gun, thereby introducing pressurized air above the water, then releasing the water using the gun's trigger – the extra pressure from the pumped air makes the water go much further than a traditional water gun which relies upon the pressure generated from a single pump of the trigger itself. In [[Randall]]'s version, the water cannot be released, so the fun part of the water gun – getting to spray your friends – isn't available.

====Glass Glow Stick====

In a classic {{w|glow stick}}, made of flexible plastic, one must first bend it enough to break the glass cylinder inside. This allows the chemicals inside to mix and begin glowing within the plastic tube. If the entire tube were made of actual glass, however, it would not only shatter into many sharp glass pieces, but would also cover the hands of the unfortunate user with a mixture of mild but not harmless chemicals. Also, depending on this contraption's construction and/or luck, the chemicals either won't mix and do not glow at all defeating the purpose of the glow-stick or stain your hands, clothes and surroundings with a glowing liquid which would be rather unfortunate.

====Wingless Sky Dancer====

In the {{w|Sky Dancers|original toy}}, a doll or figure with folded-up wings sits on top of a hand-held device with a wrapped string or other mechanism that lets it spin the doll very fast. As the doll spins, [[123|centrifugal]] force causes the wings to unfold and provide lift, and the doll rises up in the air and flies, spinning, sometimes going quite high. Without the wings, the doll will spin but otherwise remain flightless.

====No-strings-attached Yo-yo====
In a traditional {{w|yo-yo}}, one attaches a string to their finger and the other end of the string is looped around the shaft of the yo-yo, in such a way that it will hold the yo-yo but the yo-yo can still spin. In this case, the string is presumably included but not attached to the yo-yo, so when the yo-yo reaches the end of its string it will fall off, instead of coming back to the person or spinning at the end of the string.

Nonetheless {{w|Yo-yo#Off-string|off-string}} yo-yoing technique exists that has been a division of the {{w|World Yo-Yo Contest}} since 2003. The division specifies that the string is tied to one finger but not the yo-yo. It was popularized by yo-yo player Jon Gates. It differs from the manipulation of a {{w|Diabolo}} because the string is tied to one finger instead of being tied to two sticks. The return is accomplished with a twist of the string called a bind. Diabolos don't return. A good example is here at this video: [https://youtube.com/watch?v=tVpuh5aMhTQ Youtube: Crazy Stringless Yoyo Tricks!].

Note that the phrase "no strings attached" is an {{w|idiom}} and usually refers to something being available without special conditions or restrictions, a favor being done with nothing expected in return, or a relationship intended to be very casual. In this case it is literal rather than an idiom, in that the string that is normally attached to the yo-yo is literally not attached.

====Title-text: Falling-Apart Rubik's cube====
In order to build the magnetic {{w|Rubik's Cube}}, you would need to embed magnets in the inward-facing sides of each cube. This actually can be achieved by using a checkered pattern for the polarity of each piece, a single piece uses the same polarity at all its connecting sides while the immediate neighbor is configured in the opposite. This [https://youtube.com/watch?v=Xb8ENlS-5Go video] shows the principle and even a working 5x5x5 magnetic cube.

Because such a cube doesn't fall apart Randall had to remove it from his "deeply unfulfilling versions of classic toys."

It might also refer to various square shaped neodymium magnet based toys, like [https://www.youtube.com/watch?v=_j0KRK2MZic this one] or [https://magneticcube.com/ this one], which although they can be taken easily apart, they are successful and very fulfilling products on their own.

==Transcript==
:[The comic presents toys in six different frames.]

:[Cueball slaps his wrist with a strap-like item in his hand.]
:''Smack''
:Rigid slap bracelet

:[Cueball jumps on top of a pouch full of air connected via a hose to an air propelled rocket. The pouch does not budge and the rocket remains connected to its base.]
:Sealed stomp rocket

:[Ponytail holds a water gun and makes use of its hand-operated pump system.]
:''Pump pump pump''
:''Pump''
:''Click''
:Pump-only SuperSoaker

:[Megan pulls an item apart between her hands. The middle section breaks into many pieces on the ground and liquid is falling from the end parts.]
:''Pop''
:Glass glow stick

:[Cueball holds a figurine sitting on top of a hand-held device and pulls a string connected to it.]
:''Spin''
:Wingless sky dancer

:[Megan holds a yo-yo until the yo-yo falls from the string and starts rolling on the ground.]
:''Roll''
:No-strings-attached yo-yo

:[Caption below the frames:]
:My least successful product line was probably "deeply unfulfilling versions of classic toys."

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]

373: The Data So Far

2019-09-23T20:58:41Z

162.158.78.136:

{{comic
| number = 373
| date = January 21, 2008
| title = The Data So Far
| image = the data so far.png
| titletext = But THIS guy, he might be for real!
}}

==Explanation==
There are often people who claim to have supernatural powers, but then when their powers are tested by some sort of experiment, the experiment refutes their claims. This comic summarizes all the data from such experiments, observing that given the data, it's very unlikely that supernatural powers actually exist.

The title text refers to a person who has claimed to have supernatural powers, and suggests that he might really have such powers. This invokes the fact that absence of evidence is not the same as evidence of absence, although there has never previously been a confirmed example of a person with superpowers this does not prove that this is certainly impossible. However the graph above suggests that, although not impossible, such an event would be highly unlikely. No matter how much evidence we collect there is always some positive (but vanishingly small) chance, that some person may hold supernatural powers.

Alternatively the title text explains that even though there is no reason to believe anyone has any super powers, some people are always ready to believe the next one to claim so - very naive - and the exact opposite meaning of the one described above. Knowing [[Randall]]'s comic, this seems more likely. In this case the two other comics mentioned has no relation to this comic.

The title itself may be a reference to the TV show {{w|Supernatural (U.S. TV series)|Supernatural's}} recap segment, "The Road So Far."

==Transcript==
:[Bar graph titled "Claims of Supernatural Powers" and has two sets of data. The first data set is labeled "Confirmed By Experiment", and is empty. The second data set is "Refuted By Experiment" and goes to the top of the graph.]

{{comic discussion}}

[[Category:Bar chart]]
[[Category:Paranormal]]

718: The Flake Equation

2019-09-23T20:51:44Z

162.158.78.136: /* The article conflated the number of stories about aliens with the number of false stories about aliens. You can't assume that all stories about aliens are false if that's the point you're trying to prove. */

{{comic
| number = 718
| date = March 24, 2010
| title = The Flake Equation
| image = the flake equation.png
| titletext = Statistics suggest that there should be tons of alien encounter stories, and in practice there are tons of alien encounter stories. This is known as Fermi's Lack-of-a-Paradox.
}}

==Explanation==
The Flake equation is a parody of the {{w|Drake equation}} , which is an estimate the number of detectable extraterrestrial civilizations in our galaxy. The Flake equation, however, provides an estimate about how many false stories ''about'' aliens are likely to exist. It does so in similar manner: by multiplying number of stars by consecutive probabilities of the star having certain characteristics making detectable life possible. Just like the Drake equation, exact numbers are unknown, but can be estimated, and the equation shows the guesses about the values.

The word "Flake" is informally used to describe a crazy person, such as someone who would imagine an alien encounter.

===Explanations of values===
{| class="wikitable"
!Symbol
!Assumed value
!Explanation
|-

|WP
|7,000,000,000
|World population at the time of the creation of the comic, taken as a starting value.
|-
|(CR + Mi)
|1/10,000 + 1/10,000
|Fraction of people who would falsely believe they had been visited by aliens. This is assumed to be people who are crazy, want to feel special, or misinterpret physical phenomena as alien sightings. It is assumed that a total of one in 10,000 people to at least one of the first two of these groups and another one in 10,000 belong to the final group, for a total of one in 5000 belonging to one of these three groups. Multiplied by the world population we get the number of people who falsely believe to have been visited by aliens
|-
|TK
|1/10
|The fraction of people who believe to have experienced an alien sighting that tell others about their experience. Multiplying with the previous values we get the number of people who falsely believe to have experienced an alien sighting, and tell others about it.
|-
|F0
|10
|Average number of people they tell about their "sightings". Multiplying with the previous values we get the amount of people this is the amount of people who hear about a false alien sighting from the "primary source".
|-
|F1
|10
|Average number of people that they decide to tell about the "firsthand" account. Multiplying with the previous values we get the amount of people who hear a second-hand account of a false story.
|-
|DT
|9/10
|The probability that the details will be slightly adjusted during the retelling process, making the account believable. The total is now the amount of believable-yet-false alien sighting stories.
|-
|AU
|1/100
|The proportion of people who have the willingness and ability to share this story with the with a broad audience. The total is now the amount of believable-yet-false alien sightings that are published to a wider audience.
|}

The final results tells us that there should be about 100 000 stories about aliens that have reliable explanation. The data is obviously highly uncertain, and as with the Drake Equation, you can plug in your own numbers, but if you keep your guesses realistic, you will most likely get a very large number. This convinces the reader that the fact that there are many stories about aliens does not necessarily means that many people actually met aliens.

The title text refers to Fermi's Lack-of-a-Paradox as a parody of the {{w|Fermi paradox}}: The contradiction between the high estimated probable existence of extraterrestrial civilizations and the lack of establishing contact to such civilizations by humans.

Another comic parodying this equation is [[384: The Drake Equation]]. The credibility of paranormal reports in general is revisited in [[1235: Settled]], which posits that if such phenomena were real they should have been unambiguously captured on camera by now.

==Transcript==
:The Flake Equation:
:P = WP × (CR + MI) × TK × F0 × F1 × DT × AU ≈ 100,000
:Where:
::WP = World Population (7,000,000,000)
::CR = Fraction of people who imagine an alien encounter because they're crazy or want to feel special (1/10,000)
::MI = Fraction of people who misinterpret a physical or physiological experience as an alien sighting (1/10,000)
::TK = Probability that they'll tell someone (1/10)
::F0 = Average number of people they tell (10)
::F1 = Average number of people each friend tells this "firsthand" account (10)
::DT = Probability that any details not fitting the narrative will be revised or forgotten in retelling (9/10)
::AU = Fraction of people with the means and motivation to share the story with a wider audience (blogs, forums, reporters) (1/100)
:Even with conservative guesses for the values of the variables, this suggests there must be a ''huge'' number of credible-sounding alien sightings out there, available to anyone who wants to believe!

{{comic discussion}}
[[Category:Math]]
[[Category:Astronomy]]
[[Category:Science]]
[[Category:SETI]]
[[Category:Statistics]]
[[Category:Paranormal]]

Talk:2198: Throw

2019-09-03T13:51:34Z

162.158.78.136:

I created this page as it seem DgbrtBOT fails because it is interactive. So far it still won't shown on the front page or with a button to it from the previous comic or the "newest" comic button. Maybe it just takes some time? It is now in the [[List_of_all_comics]] but still no luck getting it to work... --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 07:58, 3 September 2019 (UTC)
:Maybe it is because it was published on a tuesday? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 08:16, 3 September 2019 (UTC)
::No it is not unusual that a comic does not come out on MWF. For instance the Sunday comic recently. Here is the list of Tuesday comics: [[:Category:Tuesday_comics]]--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 13:29, 3 September 2019 (UTC)
:Also it doesn't display my comment below the explanation. Something is very broken here...--[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 08:25, 3 September 2019 (UTC)
:It appears now. [[User:PkmnQ|PkmnQ]] ([[User talk:PkmnQ|talk]]) 08:53, 3 September 2019 (UTC)
How did he get an estimate for Carly Rae Jepson, anyway? [[Special:Contributions/162.158.255.34|162.158.255.34]] 09:52, 3 September 2019 (UTC)
:https://www.youtube.com/watch?v=AgwAywJlo1M [[Special:Contributions/172.68.142.221|172.68.142.221]] 09:55, 3 September 2019 (UTC)
::Alternatively he could have worked together with her, as with Serena Williams. I will look it up in the afternoon, when I have my preordered book :) --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 10:22, 3 September 2019 (UTC)
By the transitive property of Worthiness, if Capt America can throw Thor's Hammer, surely George Washington is Worthy!

I got this data from the code:
{| class="wikitable"
! id
! name
! canThrow
! canBeThrown
! length
! diameter
! mass
! dragC
! throwPower
|-
| microwave
| A microwave oven
| false
| true
| 0.406
| 0.406
| 10.591
| 0.8
|
|-
| basketball
| a basketball
| false
| true
| 0.243
| 0.243
| 0.624
| 0.3
|
|-
| blender
| a blender
| false
| true
| 0.203
| 0.203
| 5.216
| 0.8
|
|-
| gold_bar
| a gold bar
| false
| true
| 0.0535
| 0.0535
| 12.4
| 0.8
|
|-
| cake
| a wedding cake
| false
| true
| 0.51
| 0.51
| 13
| 0.8
|
|-
| pingpong
| a ping pong ball
| false
| true
| 0.04
| 0.04
| 0.003
| 0.5
|
|-
| quarterback
| an NFL quarterback
| true
| false
| 1.905
| 0.584
| 102.058
| 0.6
| 20
|-
| acorn
| an acorn
| false
| true
| 0.0191
| 0.0191
| 0.0045
| 0.3
|
|-
| hammer
| thor's hammer
| false
| true
| 0.5
| 0.15
| 2000
| 0.4
|
|-
| javelin
| a javelin
| false
| true
| 1.8
| 0.0254
| 0.8
| 0.1
|
|-
| george
| George Washington
| true
| true
| 1.829
| 0.562
| 90.718
| 0.6
| 15
|-
| pikachu
| Pikachu
| true
| true
| 0.4
| 0.3
| 5.9874
| 0.4
| 10
|-
| car
| A car
| false
| true
| 4.5
| 2.134
| 1179.34
| 0.25
|
|-
| silver_spin
| a silver dollar (spinning)
| false
| true
| 0.04
| 0.011
| 0.027
| 0.5
|
|-
| silver_tumble
| a silver dollar (tumbling)
| false
| true
| 0.04
| 0.04
| 0.027
| 0.66
|
|-
| carly
| Carly Rae Jepsen
| true
| false
| 1.575
| 0.46
| 49.895
| 0.6
| 10
|-
| thor
| thor, god of thunder
| true
| false
| 1.91
| 0.59
| 91
| 0.6
| 10000
|-
| chris hemsworth
| chris hemsworth
| true
| false
| 1.91
| 0.59
| 91
| 0.6
| 10
|-
| squirrel
| A squirrel
| true
| true
| 0.203
| 0.096
| 0.454
| 0.6
| 10
|}
(Sorry if this table messes the talk page.)[[Special:Contributions/162.158.78.136|162.158.78.136]] 13:51, 3 September 2019 (UTC)

Talk:2193: Well-Ordering Principle

2019-08-29T01:10:01Z

162.158.78.136:

Still a "trap": POOF, you're now the worst McFly cosplayer; here's a mirror.
:She asked about people who 'tried' to dress as Marty McFly. So unless Megan has ever tried to dress as him, I don't think she can be the answer.[[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 00:10, 24 August 2019 (UTC)
::_Technically_, Megan never used the formal "I wish" construction: she had "my wish is" and "just show me." Since the genie didn't immediately grant it in response to "my wish is," either (1) it's not possible (see other folks' comments below), (2) like Alex Trebec, he requires the proper format, or (3) we can assume that he'll respond to a direct order ... in which case, Megan will become a McFly cosplayer in a subsequent panel. :p
:Considering that wishing for any of the genie's suggestions would make her a wanted criminal that stole a billion dollars, a housefly in a room full of irritable people, or a genie trapped in a lamp for all eternity, this is hardly a terrible fate. [[Special:Contributions/172.68.65.66|172.68.65.66]] 14:04, 25 August 2019 (UTC)
:: Beware. The worst Marty McFly may be truly terrible. Or it could be a little kid in a costume they made out of craft paper and colored in crayon, terrible but adorable... but it could involve (1) real lightning, (2) real plutonium, (3) the band McFly, (4) actually a dog in costume, (5) actually a fly in costume, (6) Jeff Goldblum from "The Fly" i.e. fly head not Jeff Goldblum head - in costume, (7) Cthulhu - in costume. (The last and worst trick-or-treat you'll ever see; he would qualify.) rja.carnegie@gmail.com [[Special:Contributions/162.158.158.209|162.158.158.209]] 14:36, 26 August 2019 (UTC)
:She only wished to see "their costume". So the genie could trap her by only showing the costume, without letting her know how it looked on the wearer. In fact, the genie can also opt to ignore the "singular they" madness and bury her in a pile of costumes (of everyone who ever wore one for Halloween). [[Special:Contributions/198.41.231.135|198.41.231.135]] 16:50, 26 August 2019 (UTC)

*Are* costumes well-ordered? Even leaving aside the subjectivity of any ranking, there are several different criteria which could be used, and many ways of combining them. (What if the costume which looked least like Marty wasn't the ugliest, nor the one showing least effort?) — Also, may be worth qualifying the explanation of Halloween by mentioning the USA; some other countries don't celebrate it, and of those that do, not all do trick-or-treating or dressing-up &c. [[User:Gidds|Gidds]] ([[User talk:Gidds|talk]]) 00:23, 24 August 2019 (UTC)

::Saying there are different criteria kind of overlaps with saying the ranking is subjective. But far worse, even individual preferences are preorders aka quasiorders, which absolutely does mean that there may not be a worst, or even a set of costumes tied for worst. However, the fact that you can always find someone (e.g. on Amazon Mechanical Turk, or off the street, or on a wiki somewhere) to give you another opinion means that well-foundedness can be rescued with their {{w|mean opinion score}}. I wonder if the genie is powerful enough to know the asymptotic MOS ranking right away, or if it will have to wait for enough Amazon Mechanical Turk HITs to be completed. Given that there must have been at least hundreds of thousands of consumes so far, that could take quite a long time to achieve p<0.05. [[Special:Contributions/172.69.22.248|172.69.22.248]] 04:00, 24 August 2019 (UTC)
::I've spent way too much time on this, but the more I do, the more I think Randall is trying to say something about the simulation hypothesis, related to the theme on [https://www.youtube.com/watch?v=th5uJNB7VU8 ''Watch Room''] (warning: somewhat creepy but otherwise ok sci-fi short.) [[Special:Contributions/172.69.22.134|172.69.22.134]] 12:32, 24 August 2019 (UTC)

I hope this Munroe lowkey challenging the internet, that we might actually celebrate our infamous king (or girl marty queen) of crappy costume. --[[Special:Contributions/162.158.58.219|162.158.58.219]] 00:37, 24 August 2019 (UTC)

The "worst McFly" and "even" sounds like there should be a math pun in there somewhere, but I don't see it. [[Special:Contributions/172.69.63.11|172.69.63.11]] 01:36, 24 August 2019 (UTC)

"It's been over 30 years since Back to the Future came out." That makes me feel old. Isn't that something that Munroe does regularly? Should that be mentioned in the explanation? [[Special:Contributions/162.158.214.88|162.158.214.88]] 10:42, 24 August 2019 (UTC)
:Yes, I am sure there have been at least two comics where the often surprising ages of things formed a central part of the theme, but I can't remember enough about them to find them. Anyone? [[Special:Contributions/162.158.255.82|162.158.255.82]] 11:55, 24 August 2019 (UTC)
::Just see [[:Category:Comics to make one feel old]] :-). --[[User:DaB.|DaB.]] ([[User talk:DaB.|talk]]) 12:29, 24 August 2019 (UTC)
:::Thanks {{done}} [[Special:Contributions/172.69.22.134|172.69.22.134]] 12:38, 24 August 2019 (UTC)

"The real Worst McFly is probably lost to time" is also a pun regarding the fact that ''Back to the Future'' is a time-travel story.--[[User:MCBastos|MCBastos]] ([[User talk:MCBastos|talk]]) 17:20, 24 August 2019 (UTC)

I wonder if this could be trap from Megan - even unintended one: in some stories, the Genie could get into problems if he CANT fulfill the wish ... -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 22:07, 24 August 2019 (UTC)

Even if "preference" is a total order (i.e. connex and anti-symmetric, I think both of these are debatable) it isn't necessarily a well order, however, since the set of costumes is finite, there would still be a "worst" one. [[User:Probably not Douglas Hofstadter|Probably not Douglas Hofstadter]] ([[User talk:Probably not Douglas Hofstadter|talk]]) 03:17, 25 August 2019 (UTC)

:It's not a total preorder unless you don't let people have "no opinion" about some pairs, which is an acceptable constraint for preferences based on established objective criteria, but not something so subjective like quality of fashion. In practice, a lot of people are going to have least favorites between which they don't care. Surveys of subjective preferences almost always allow people to say that they don't have opinions or are not sure. Even in technically objective measures, like short- versus long-term bond yield curves, you can sometimes prove that people objectively should have certain preferences upon which they are clearly not acting. [[Special:Contributions/172.68.189.19|172.68.189.19]] 07:40, 25 August 2019 (UTC)

Sounds like a trap -- for the genie. Keep it busy so that it can't inflict "wishes" on others. Much more subtle than "find the last digit of pi", but possibly still a "halting problem" that can never be fully solved.

Actually, this wish is simply if not easily fulfilled, and it may indeed be a trap for Megan. Simply show her every Marty McFly costume ever worn. At some point she would have to have seen the worst, no matter how worst was determined. Depending upon the method, this could take a very long time. [[Special:Contributions/108.162.246.239|108.162.246.239]] 00:48, 27 August 2019 (UTC)
:Good point; added. [[Special:Contributions/172.68.142.83|172.68.142.83]] 06:34, 27 August 2019 (UTC)

Knowing this community and knowing the wetriffs.com story, I'm already looking forward to this year's Halloween
[[User:Kventin|Kventin]] ([[User talk:Kventin|talk]]) 06:13, 28 August 2019 (UTC)

What if the genie sends Megan to the time and place when the worst McFly costume was put on... and it sends her there naked... and the genie disappears from the scene and never answers another with from Megan ever again? Trapped in another time, possibly another country with a different language, and then promptly sent to prison for years. [[Special:Contributions/162.158.78.136|162.158.78.136]] 01:10, 29 August 2019 (UTC)

1480: Super Bowl

2018-04-02T13:27:27Z

162.158.78.136: /* Explanation */

{{comic
| number = 1480
| date = January 30, 2015
| title = Super Bowl
| image = super_bowl.png
| titletext = My hobby: Pretending to miss the sarcasm when people show off their lack of interest in football by talking about 'sportsball' and acting excited to find someone else who's interested, then acting confused when they try to clarify.
}}

==Explanation==
In this comic, [[Cueball]], representing [[Randall]], explains that even though he does not care about sports and is tempted to be scornful about others' obsession with them, he understands that people feel vulnerable about stuff they care about. And he will for sure be fed up with all the talk about the {{w|Super Bowl}} discussions and arguments over the coming weeks. (The comic was released on a Friday two days before {{w|Super Bowl XLIX}}, the final of the 2014 {{w|NFL}} season held on 2015-02-01).

However, since other people tolerate his interest in odd things like {{w|meteorology}} and the {{w|Philae (spacecraft)|''Philae'' lander}} (see [[1324: Weather]] and [[1446: Landing]]), he recognizes that he should show the same consideration to them. This is an invocation of the {{w|Golden Rule}}, "Do unto others as you would have them do unto you".

In the last frame, he tells us that instead of celebrating the sports event on Sunday, he will be celebrating friendship (through listening to his friends) and, as a side note, snacking (as they are very frequently brought to Super Bowl-watching events). This suggests that the value of friendship trumps the discomfort of watching human activities that seem uninteresting to him – and of course, the free snacks also help ameliorate his discomfort.

The title text continues the "[[My Hobby]]" trope characteristic of some ''xkcd'' comics: here, Randall references people who scornfully refer to popular sports such as football, basketball, and/or baseball as "sportsball" and creates discomfort for them by pretending to be interested in this imaginary sport. This makes it appear as though they are in fact interested in sports when they are not, exposing their snobbishness. (It is worth noting that there is [https://www.nintendo.com/games/detail/aWTjaTaTib5jIi7ZoHC9yzrx8xk4RSIo a Wii U game by that name].)

In a distant past, Cueball spent his time differently during the Super Bowl - see [[60: Super Bowl]]. (This was the second time that two xkcd comics have shared the [[:Category:Comics sharing name|exact same name]]). The year after he continued the trend with a Super Bowl related comic to "celebrate" the event: [[1640: Super Bowl Context]]. Between the 2006 comic and this one there were no other Super Bowl related comics coming out in relation to the Super Bowl final.

See also [[1107: Sports Cheat Sheet]] and two other comics where he jokes with sport in general: [[904: Sports]] and [[1507: Metaball]]. He again directly mentions lack of knowledge in [[1859: Sports Knowledge]].

==Transcript==
:[Cueball standing.]
:Cueball: I don't know much about sports, which can be culturally isolating, so it's tempting to get vocal and defensive about not following them.
:Cueball: Caring about something makes people vulnerable, so ''not'' caring gives you power.

:[Pictures of a [http://en.wikipedia.org/wiki/Weather_map weather map] and [http://en.wikipedia.org/wiki/Philae_(spacecraft) ''Philae'' spacecraft] in the background.]
:But I know things I'm into don't always sound interesting to 100% of the people around me, and it means a lot when they sometimes try to listen anyway - and maybe even find themselves sharing some of my excitement!

:[Cueball pointing to self.]
:Cueball: So while everyone is going on about the Super Bowl on Sunday, let me tell you what ''I'll'' be doing:

:[Cueball standing again.]
:Cueball: Listening!
:Cueball: Hooray for friendship!
:Cueball: Also, eating snacks.
:Cueball: Hooray for snacks!

== Trivia ==
This comic shares title with [[60: Super Bowl]], published February 6, 2006. This appears to be [[:Category:Disambiguation pages|only the second time]] that two ''xkcd'' comics have borne the same name. The first was [[786: Exoplanets]], published August 30, 2010, and [[1071: Exoplanets]], published June 20, 2012.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:My Hobby]]
[[Category:American football]]
[[Category:Sport]]
[[Category:Science]]
[[Category:Space]]
[[Category:Comics sharing name|Super Bowl 2]]

1970: Name Dominoes

2018-03-23T20:34:54Z

162.158.78.136:

{{comic
| number = 1970
| date = March 21, 2018
| title = Name Dominoes
| image = name_dominoes.png
| titletext = In competition, you can only play a name if you know who the person is. No fair saying "Frank ... Johnson. That sounds like a real person! Let me just Google him real quick."
}}

*A large version of the comic picture can be found [https://xkcd.com/1970/large/ here].
*A numbered version can be found [http://www.explainxkcd.com/wiki/images/7/73/1970-_Name_Dominoes_-_The_large_image_with_numbers.jpg here].

==Explanation==
{{incomplete|Created by Fats Domino: Table links should be checked and explanation and connections added. (Add a full transcript... "Done!" And good luck with that! "Thanks".) Do NOT delete this tag too soon. }}

{{w|Dominoes}} is a family of boardgames played with rectangular "domino" tiles. A domino tile is divided into two squares, each displaying a number. Under most rules, a domino tile is placed on the table adjacent to another tile, and the adjacent ends must match in some way (usually by the number displayed on the touching ends). Randall's "name dominoes" shows a set of domino tiles with people's names instead of numbers, and adjacent tiles are matched by whether the closest name is the same (such as how Chris Evans' family name matches Evan Taylor Jones' given name).

The title text spells out a rule that a player may only place a tile if they know who that person is. This is a variation of a rule in {{w|Scrabble}}, where a player loses a turn if their chosen word don't survive a dictionary challenge over the validity of the word. This rule implies that players are allowed to create new name dominoes tiles and that it is not a fixed set. In this case the player that is challenged has used the name Frank Johnson of which there are {{w|Frank Johnson|12 exact matches}} on Wikipedia along with six with a middle name and more. In a google search as of the day the comic came out the first hit was {{w|Frank Johnson (basketball)|Frank Johnson}} who is a retired American professional basketball player and coach. Randall has made several [[:Category:Basketball|references to basketball]] in his comics.

A large board is covered in rectangular "dominoes" (271 pieces), with each domino bearing the name of a "well-known" person or character (fictional). The dominoes are arranged as if a game of dominoes were being played, but instead of the game requiring the number of spots of adjacent dominoes to match up, this game requires adjacent ''names'' to match up. Because most people have two or more names, different matches are made at each end of a domino. Fun fact is that two of the people are "named after" the game: {{w|Fats Domino}} and {{w|Domino Harvey}}.

The match can be exact (e.g., "Kevin" on one domino adjacent to "Kevin" on another), homonymic (e.g., "Klein" adjacent to "Kline"), or nickname-based (e.g., "James" adjacent to "Jimmy", which in turn is adjacent to "Jim"). Sometimes last names are matched up with first names (e.g., "{{w|Elizabeth Warren}}" adjacent to "{{w|Warren Beatty}}"), and in some cases only a single name is used (e.g., "{{w|Columbo}}", "{{w|Drake_(musician)|Drake}}", "{{w|Garfield_(character)|Garfield}}", "{{w|Prince_(musician)|Prince}}"). Singular names are represented by a half-size square "domino" (or "{{w|Polyomino|monomino}}"), with a few exceptions: "{{w|Garnet_(Steven_Universe)|Garnet}}" has a full-size tile (a complex reference explained below), and "{{w|Batman}}" and "{{w|Superman}}" have full-size tiles and are placed as though they were two-part names: the first square of "Superman" is matched with "Super", and the second square is matched with the second square of "Batman" (as though both characters had the last name "Man"). Some people have three or more names (e.g., "{{w|Frank Lloyd Wright}}") and have a 3-square domino tile (or "straight {{w|Tromino|tromino}}", 50% longer than normal) which permits matching to a middle name (e.g. "Frank Lloyd Wright" is matched to "{{w|Lloyd Alexander}}" and "{{w|Harold Lloyd}}").

The names come from a wide variety of fields: scientists (e.g., {{w|Isaac Newton}}), historical figures ({{w|George Washington}}), musicians ({{w|Drake (musician)|Drake}}), politicians ({{w|John Kerry}}), actors ({{w|Kevin Costner}}), writers ({{w|Washington Irving}}), fashion designers ({{w|Oscar de la Renta}}), and so on. Most of the names are real people but a few are fictional characters, including some non-human characters like {{w|Garfield_(character)|Garfield}} and {{w|Grover#Super_Grover|Super Grover}}. In one case the nick name for a company is used: {{w|Ma Bell}} aka Bell System.

One notable reference beyond just the use of a name is in the bottom left, there is the connection [ {{w|William Safire}} ][ Garnet ][ {{w|Jack Ruby|Ruby, Jack}} ]. The connection seems to be based on the fact that {{w|Sapphire}}, {{w|Garnet}} and {{w|Ruby}} are all {{w|gemstones}}, which does not match the implied rules of the game. This tile is a reference to the character {{w|Garnet_(Steven_Universe)|Garnet}} in the cartoon {{w|Steven Universe}}, who is a "fusion" formed by two Gems: Ruby and Sapphire. Thus, the name "Garnet" is treated as though it was two names "Ruby" and "Sapphire", requiring a two-square tile despite having a one-word name. Randall has previously made references to this universe in [[1608: Hoverboard]]. (See [http://www.explainxkcd.com/wiki/images/3/39/1608_1031x1095y_Steven_Universe_family_and_ice_cream_prediction.png this] and [http://www.explainxkcd.com/wiki/images/f/fa/1608_1077x1109y_Darth_Vaders_talks_about_Steven_Universe_on_the_bridge_Megan_adjust_antenna.png this] image from that comic).

Additionally, Ayn Rand, Paul Ryan and Rand Paul have been mentioned before, in the title text of [[1277: Ayn Random]]. That idea may have been the prototype for this.

In at least one case it is not entirely clear who is being referred to: "John Kelly" most likely refers to Gen. {{w|John F. Kelly}}, Donald Trump's chief of staff, but the name is extremely common and could equally refer to {{w|John Kelly|any number of people}}.

==Table of names==
*The number # refers to the numbers on this [http://www.explainxkcd.com/wiki/images/7/73/1970-_Name_Dominoes_-_The_large_image_with_numbers.jpg numbered picture].
**Read more on this page:
***[[1970: Name Dominoes/Numbered images]]
*Wiki links not tested as they were set in only from the name in the comic.
**Spell checking...

{| class="wikitable sortable"
!style="width:15%"|Domino
!style="width:45%"|Notability and notes
!style="width:15%"|Connections
!style="width:20%"|Mode
!style="width:5%"|#
|-
|{{w|Christian Campbell}}
|Canadian American stage and screen actor, writer, and photographer. Most likely refers to the actor, but there are also a Trinidadian-Bahamian poet called {{w|Christian Campbell (poet)|Christian Campbell}}.
|
|
|1
|-
|{{w|Neve Campbell}}
|Canadian actress, known for starring in the movie series {{w|Scream (1996 film)|Scream}}.
|
|
|2
|-
|{{w|Joe McCarthy}}
|Joseph McCarthy, (also called {{w|Joseph_McCarthy#Legacy|Joe McCarthy}}), served as U.S. Senator from the state of Wisconsin from 1947 until his death in 1957. {{w|McCarthyism}} is named after him. It was the practice of making accusations of subversion or treason without proper regard for evidence, especially caused by fear of Communist influence during the beginning of the cold war. McCarthyism has its origins in the period in the United States known as the Second Red Scare, lasting roughly from 1947 to 1956.
|
|
|3
|-
|{{w|Eugene McCarthy}}
|Eugene Joseph McCarthy was an American politician, poet, and a long-time Congressman from Minnesota. He served in the United States House of Representatives from 1949 to 1959 and the United States Senate from 1959 to 1971. (He is not to be confused with the other Senator McCarthy, Joseph McCarthy, see #3)
|
|
|4
|-
|{{w|Gene Vincent}}
|American musician who pioneered the styles of rock and roll and rockabilly. His 1956 top ten hit with his Blue Caps, "Be-Bop-A-Lula", is considered a significant early example of rockabilly.
|
|
|5
|-
|{{w|Gene Kelly}}
|American actor and dancer known primarily for musicals such as 'Singing in the rain'
|
|
|6
|-
|{{w|Kate Hudson}}
|Golden globe winning American actress. Won for playing Penny Lane in Cameron Crowe’s Almost Famous in 2000.
|
|
|7
|-
|{{w|Rock Hudson}}
|American actor who was viewed as a prominent 'heartthrob' of the Hollywood Golden Age, staring as the lead man in many movies during the 1950s and 60s, among other {{w|Giant (1956 film)|Giant}}, James Deans last film, for which both where nominated for an Oscar in the best actor category. He later became known for his secret homosexual life. Hudson died from AIDS-related complications in 1985, becoming the first major celebrity to die from an AIDS-related illness.
|
|
|8
|-
|{{w|Gordon Brown}}
|British Prime Minister from 2007-2010.
|
|
|9
|-
|{{w|James Brown}}
|American singer, known as the Godfather of Soul
|
|
|10
|-
|{{w|Jon Brown}}
|Former British long-distance runner who specialized in 10,000 meters, cross country running and the marathon. His real first name was Jonathan, but he is the only one on Wikipedia known as Jon Brown, among several other {{w|Jonathan Brown|Jonathan Browns}}.
|
|
|11
|-
|{{w|John Howard}}
|Australian politician. Served as 25th Prime Minister of Australia from 1996-2007. There are several other {{w|John Howard (disambiguation)|John Howards}} but this Prime Minister is by far the best known among them.
|
|
|12
|-
|{{w|Columbo}}
|Fictional character. Homicide detective from American TV show "Columbo"; portrayed by actor Peter Falk.
|
|
|13
|-
|{{w|Chris Columbus (filmmaker)|Chris Columbus}}
|Film director and screenwriter.
|Columbo Christopher Columbus Chris Hughes
|Last-Only (approximate) First-First (approximate) and Last-Last First-First
|14
|-
|{{w|Christopher Columbus}}
|Italian explorer. Credited with "discovering" the Americas in 1492 by leading voyages and establishing continued ties between Europe and the Americas.
|
|
|15
|-
|{{w|Naomi Campbell}}
|British model and actress.
|
|
|16
|-
|{{w|Joseph Campbell}}
|American author. Most known for his book The Hero with a Thousand Faces about the hero type found throughout world mythologies.
|
|
|17
|-
|{{w|Joseph Smith}}
|American religious leader; founder of Mormonism. Publisher of The Book of Mormon.
|
|
|18
|-
|{{w|Frank Vincent}}
|American actor.
|
|
|19
|-
|{{w|John Kelly}}
|White House Chief of Staff under President Donald Trump. Retired US Marine Corps general.
|
|
|20
|-
|{{w|Katherine Johnson}}
|African-American mathematician at NASA. Calculated trajectories, launch windows, and flight paths for NASA moon missions and the Space Shuttle.
|
|
|21
|-
|{{w|The Rock}}
|Nickname for Dwayne Johnson, a pro wrestler and actor.
|
|
|22
|-
|{{w|Chris Rock}}
|American comedian.
|
|
|23
|-
|{{w|Chris Isaac}}
|American musician.
|
|
|24
|-
|{{w|James Newton Howard}}
|
|
|
|25
|-
|{{w|John Wayne}}
|American actor, known primarily for roles in Westerns
|
|
|26
|-
|{{w|Howard Stern}}
|Radio talk show host. Known for {{w|The Howard Stern Show}}.
|
|
|27
|-
|{{w|Howard Hunt}}
|Former CIA operative, convicted for Watergate burglary.
|
|
|28
|-
|{{w|Chris Hughes}}
|
|
|
|29
|-
|{{w|Naomi Watts}}
| Australian actress, born in Britain
|
|
|30
|-
|{{w|Naomi Klein}}
|
|
|
|31
|-
|{{w|Kevin Kline}}
|American actor
|
|
|32
|-
|{{w|Francis Bacon}}
|16th century English philosopher. Commonly credited with the phrase "knowledge is power".
|
|
|33
|-
|{{w|Francis Drake}}
|English privateer
|
|
|34
|-
|{{w|Lyndon Johnson}}
|Former American president (1963-1969)
|
|
|35
|-
|{{w|Oscar the Grouch}}
|A muppet from the children's TV show {{w|Sesame Street}}.
|
|
|36
|-
|{{w|Oscar Isaac}}
|Actor.
|
|
|37
|-
|{{w|Isaac Hayes}}
|American singer-songwriter
|
|
|38
|-
|{{w|Isaac Newton}}
|Well-known 1600s physicist who created the three laws of motion.
|
|
|39
|-
|{{w|Wayne Newton}}
|Musician.
|
|
|40
|-
|{{w|Wayne Knight}}
|
|
|
|41
|-
|{{w|Helen Hunt}}
|American actress
|
|
|42
|-
|{{w|Helen Hughes}}
|
|
|
|43
|-
|{{w|James Watt|James Watt (Steam)}}
|Scottish inventor who perfected on the earlier Newcomen steam engine with a design that made it practical for widespread use and is credited with helping to usher in the Industrial Revolution in Great Britain. His name became the SI unit for power.
|
|
|44
|-
|{{w|James G. Watt|James Watt (Interior)}}
|
|
|
|45
|-
|{{w|Kevin Costner}}
|Academy award winning American actor.
|
|
|46
|-
|{{w|Kevin Bacon}}
|American actor. Known for {{w|Footloose (1984 film)|Footloose}}, and for {{w|Six Degrees of Kevin Bacon}}.
|
|
|47
|-
|{{w|Kevin Love}}
|
|
|
|48
|-
|{{w|Lisa Frank}}
|
|
|
|49
|-
|{{w|Frank Drake}}
|
|
|
|50
|-
|{{w|Drake}}
|Grammy award winning Canadian rapper.
|
|
|51
|-
|{{w|Oscar de la Renta}}
|Fashion designer.
|
|
|52
|-
|{{w|Oscar de la Hoya}}
|Professional boxer who won multiple titles in different weight classes as well as an Olympic gold medal before his retirement in 2009.
|
|
|53
|-
|{{w|Sean Hayes (actor)|Sean Hayes}}
|
|
|
|54
|-
|{{w|Wallace Shawn}}
|
|
|
|55
|-
|{{w|Wayne Howard}}
|
|
|
|56
|-
|{{w|Wayne Brady}}
|American comedian, known for {{w|Whose Line Is It Anyway? (U.S. TV series)|Whose Line Is It Anyway?}}
|
|
|57
|-
|{{w|James Brady}}
|White House Press Secretary for US President Ronald Reagan (1981-1989) who was shot during an assassination attempt against Reagan in 1981. Subsequent gun control legislation known as the "Brady Bill" was named for him.
|
|
|58
|-
|{{w|Tom Brady}}
|Quarterback for the {{w|New England Patriots}}. Notable for winning 5 Super Bowls.
|
|
|59
|-
|{{w|Helen Thomas}}
|
|
|
|60
|-
|{{w|Tom Hanks}}
|Academy award winning actor. Known for {{w|Forrest Gump}}, {{w|Saving Private Ryan}}, {{w|Cast Away}}, and several other famous films.
|
|
|61
|-
|{{w|Hank Aaron}}
|Former Major League Baseball player. Hit 755 career home runs, a record at the time.
|
|
|62
|-
|{{w|Aaron Carter}}
|American singer.
|
|
|63
|-
|{{w|Stephen James}}
|
|
|
|64
|-
|{{w|Will Smith}}
|American actor. Known for {{w|The Fresh Prince of Bel-Air}}
|
|
|65
|-
|{{w|Kevin Smith}}
|American movie director
|
|
|66
|-
|{{w|Kevin James}}
|American actor. Known for {{w|Paul Blart: Mall Cop}}
|
|
|67
|-
|{{w|Garfield (character)|Garfield}}
|A fictional cat and the star of the eponymous ''{{w|Garfield}}'' comic by {{w|Jim Davis (cartoonist)|Jim Davis}}. Previously appeared in [[78: Garfield]].
|
|
|68
|-
|{{w|James Garfield}}
|20th President of the United States. Notably, he was assassinated after only 6 months.
|
|
|69
|-
|{{w|Warren Buffett}}
|Billionaire and CEO of {{w|Berkshire Hathaway}}.
|
|
|70
|-
|{{w|Jimmy Buffett}}
|American country musician.
|
|
|71
|-
|{{w|Warren Beatty}}
|
|
|
|72
|-
|{{w|Elizabeth Warren}}
|Massachusetts state Senator since 2013. Known for her work as a consumer rights activist.
|
|
|73
|-
|{{w|Earl Warren}}
|Chief Justice of the United States Supreme Court from 1953 to 1969. Presided over several landmark cases including ''Brown v. Board of Education of Topeka'' (ruled segregation of public schools unconstitutional), ''Reynolds v. Sims'' (electoral districts for state legislature must be equal in population), and ''Miranda v. Arizona'' (suspects detained by police must be informed of their rights as an accused).
|
|
|74
|-
|{{w|Elizabeth Kolbert}}
|
|
|
|75
|-
|{{w|Stephen Colbert}}
|American talk show host. Known for {{w|The Colbert Report}} and {{w|The Late Show with Stephen Colbert}}
|
|
|76
|-
|{{w|George Wallace}}
|American politician, who initially supported, but later renounced racial segregation.
|
|
|77
|-
|{{w|Charles Wallace}}
|
|
|
|78
|-
|{{w|James Monroe}}
|Foundign father and Fifth president of the USA
|
|
|79
|-
|{{w|Marilyn Monroe}}
|American actress and pin up model from the 50s. She was immensely famous during her time, and unexpectedly committed suicide at age 36.
|
|
|80
|-
|{{w|Hank Williams}}
|Country singer
|
|
|81
|-
|{{w|William C. Williams}}
|
|
|
|82
|-
|{{w|Steve Harvey}}
|Host of {{w|Family Feud}}.
|
|
|83
|-
|{{w|Domino Harvey}}
|
|
|
|84
|-
|{{w|Harvey Milk}}
|American politician and gay rights activist.
|
|
|85
|-
|{{w|James Saint James}}
|
|
|
|86
|-
|{{w|Etta James|Etta James (1)}}
| Used again in 266
|
|
|87
|-
|{{w|Jim Jones}}
|Cult leader behind the 1978 {{w|Jonestown}} mass suicide in Guyana.
|
|
|88
|-
|{{w|James Earl Jones}}
|American actor. Voiced {{w|Darth Vader}} in the original Star Wars.
|
|
|89
|-
|{{w|Charlie Parker}}
|
|
|
|90
|-
|{{w|Ray Parker Jr.}}
|Singer and songwriter who wrote and performed the theme song to the 1984 film {{w|Ghostbusters}}.
|
|
|91
|-
|{{w|Ray Charles}}
|American blues musician. Blind from the age of 7.
|
|
|92
|-
|{{w|Charles Manson}}
|Cult leader of the {{w|Manson Family}}. Convicted of 7 murders.
|
|
|93
|-
|{{w|Marilyn Manson}}
|American musician. Known for esoteric performances.
|
|
|94
|-
|{{w|Robin Williams}}
|American stand up comedian. Voiced the Genie in {{w|Aladdin (1992 Disney film)|Aladdin}}.
|
|
|95
|-
|{{w|Billy D. Williams}}
|American actor best known for playing {{w|Lando Calrissian}} in ''{{w|The Empire Strikes Back}}'' and ''{{w|Return of the Jedi}}''.
|
|
|96
|-
|{{w|Will Wright}}
|
|
|
|97
|-
|{{w|Fats Domino}}
|
|
|
|98
|-
|{{w|Bill Clinton}}
|42nd president of the United States. Known for having an affair in office. His wife, {{w|Hillary Clinton}}, ran against {{w|Donald Trump}} in the 2016 presidential election.
|
|
|99
|-
|{{w|Jimmy John}}
|Founder of the sandwich shop chain Jimmy John's.
|
|
|100
|-
|{{w|Tom Jones}}
|Can refer to the Welsh Singer or to the fictional character from the book of the same name by Henry Fielding
|
|
|101
|-
|{{w|Tommy John}}
|Former baseball pitcher who had a surgical graft done to replace a blown ligament in his pitching elbow in 1974; the procedure is now called Tommy John surgery.
|
|
|102
|-
|{{w|Quincy Jones}}
|American Jazz musician
|
|
|103
|-
|{{w|James Earl Ray}}
|Killer of Martin Luther King Jr.
|
|
|104
|-
|{{w|Man Ray}}
|
|
|
|105
|-
|{{w|Rachel Ray}}
|Celebrity chef.
|
|
|106
|-
|{{w|Ray Allen}}
|Professional basketball player who retired in 2013. Won two NBA championships with the Boston Celtics.
|
|
|107
|-
|{{w|Tim Allen}}
|American actor. Voiced Buzz Lightyear in {{w|Toy Story}}.
|
|
|108
|-
|{{w|Tim Cook}}
|Current (as of the time of this comic) Chief Executive Officer of {{w|Apple, Inc.}}
|
|
|109
|-
|{{w|Tim Howard}}
|Former goalkeeper for the United States men's national soccer team. Holds the record for most saves made in a World Cup match (15 against Belgium in 2010).
|
|
|110
|-
|{{w|Robin Wright}}
|American actress, aka Robin Wright-Penn
|
|
|111
|-
|{{w|Wilbur Wright}}
|One of the two Wright Brothers (the other was Orville) who made the world's first powered flight at Kitty Hawk, North Carolina in 1903.
|
|
|112
|-
|{{w|Fatty Arbuckle}}
|
|
|
|113
|-
|{{w|Fat Joe}}
|Real name Joseph Antonio Cartagena, rapper.
|
|
|114
|-
|{{w|George Clinton}}
|Could be either the {{w|George Clinton (vice president)|19th Century politician}} who served as Governor of New York and later as Vice President under {{w|Thomas Jefferson}} and {{w|James Madison}}, or the {{w|George Clinton (musician)|musician}} who rose to fame in the 1970's as one of the biggest acts in funk music and entered the Rock and Roll Hall of Fame in 1997.
|
|
|115
|-
|{{w|John Kerry}}
|Secretary of State under {{w|Barrack Obama}}. Ran against {{w|George W. Bush}} in the 2004 presidential election.
|
|
|116
|-
|{{w|Kerry Washington}}
|
|
|
|117
|-
|{{w|John Irving}}
|
|
|
|118
|-
|{{w|John Quincy Adams}}
|Sixth president of the United States and son of John Adams.
|
|
|119
|-
|{{w|John Adams}}
|Second president of the United States and father of John Quincy Adams.
|
|
|120
|-
|{{w|Amy Adams}}
|
|
|
|121
|-
|{{w|Aimee Mann}}
|
|
|
|122
|-
|{{w|Superman}}
|Superhero owned by DC comics.
|
|
|123
|-
|{{w|Batman}}
|Superhero owned by DC comics.
|
|
|124
|-
|{{w|Ayn Rand}}
|Russian political author, known for {{w|Atlas Shrugged}}. XKCD frequently makes fun of Rand's philosophy.
|
|
|125
|-
|{{w|Lily Allen}}
|
|
|
|126
|-
|{{w|Paul Allen}}
|Co-founder of {{w|Microsoft}} along with Bill Gates and current owner of several professional sports teams in the Pacific Northwest (Seattle Seahawks, Portland Trail Blazers, part of Seattle Sounders FC).
|
|
|127
|-
|{{w|Ron Howard}}
|Actor and director. Most famously acted in ''{{w|Happy Days}}''; later directed ''{{w|Apollo 13 (film}|Apollo 13}}''.
|
|
|128
|-
|{{w|Howard Hughes}}
|American business tycoon
|
|
|129
|-
|{{w|Joe Kennedy}}
|US ambassador to the United Kingdom and father of {{w|John F. Kennedy}}.
|
|
|130
|-
|{{w|George Bush}}
|{{w|George H. W. Bush}} and {{w|George W. Bush}} (father and son, respectively), were both presidents of the United States.
|
|
|131
|-
|{{w|George Washington}}
|First president of the United States, and general during the Revolutionary War.
|
|
|132
|-
|{{w|Washington Irving}}
|Short story author who wrote "{{w|Rip Van Winkle}}" and "{{w|The Legend of Sleepy Hollow}}"
|
|
|133
|-
|{{w|Martha Wasington}}
|Wife of George Washington.
|
|
|134
|-
|{{w|Ma Rainey}}
|
|
|
|135
|-
|{{w|Jack Ma}}
|
|
|
|136
|-
|{{w|Super Grover}}
|
|
|
|137
|-
|{{w|Jack Black}}
|
|
|
|138
|-
|{{w|Rand Paul}}
|Republican senator from Kentucky; member of the {{w|Tea Party movement}}. Ran in the 2016 Republican presidential primary.
|
|
|139
|-
|{{w|Paul Ryan}}
|Republican representative from Wisconsin. Served as Speaker of the House at the time this comic was published.
|
|
|140
|-
|{{w|Paul Simon}}
|
|
|
|141
|-
|{{w|Ron Paul}}
|Libertarian politician. Known for running for president in many elections.
|
|
|142
|-
|{{w|John Hughes}}
|
|
|
|143
|-
|{{w|Langston Hughes}}
|
|
|
|144
|-
|{{w|John F. Kennedy}}
|35th president of the United States. Known for his public assassination during a parade; subject to many conspiracy theories.
|
|
|145
|-
|{{w|Little Richard}}
|Singer
|
|
|146
|-
|{{w|Rich Little}}
|
|
|
|147
|-
|{{w|Martha Stewart}}
|American TV personality. Convicted of insider trading in 2004.
|
|
|148
|-
|{{w|Yo Yo Ma}}
|Chinese cellist. Known for winning 18 Grammys; considered a child prodigy.
|
|
|149
|-
|{{w|Ma Bell}}
|Aka Bell System, the system of companies, led by the Bell Telephone Company and later by AT&T, which provided telephone services to much of the United States and Canada from 1877 to 1984.
|
|
|150
|-
|{{w|Grover Cleveland Alexander}}
|Pitcher named after the president; co-holds record for most wins by a pitcher in the National League (374).
|
|
|151
|-
|{{w|Grover Cleveland}}
|22nd and 24th president of the United States. Notably the only president to serve two non-consecutive terms.
|
|
|152
|-
|{{w|Jack White}}
|American musician. Part of {{w|The White Stripes}}.
|
|
|153
|-
|{{w|Jack Ryan}}
|Fictional character in the novels by Tom Clancy. Portrayed in Movies by Harrison Ford, Alec Baldwin, and Ben Affleck
|
|
|154
|-
|{{w|Debby Ryan}}
|
|
|
|155
|-
|{{w|Carly Simon}}
|
|
|
|156
|-
|{{w|Carly Hughes}}
|
|
|
|157
|-
|{{w|Charles Evans Hughes}}
|
|
|
|158
|-
|{{w|John Williams}}
|American composer. Known for many famous movie soundtracks, including Star Wars and Harry Potter.
|
|
|159
|-
|{{w|Little John}}
|Fictional character in the Robin Hood Legend. Known for great stature and strength.
|
|
|160
|-
|{{w|Stuart Little}}
|Fictional character.
|
|
|161
|-
|{{w|Potter Stewart}}
|
|
|
|162
|-
|{{w|Kristen Stewart}}
|American actress. Known for {{w|Twilight (2008 film)|Twilight}}.
|
|
|163
|-
|{{w|Kristen Bell}}
|American actress, known for various romantic comedies.
|
|
|164
|-
|{{w|Kristen Hooks}}
|
|
|
|165
|-
|{{w|Alexander Graham Bell}}
|Scottish inventor, credited with inventing the telephone.
|
|
|166
|-
|{{w|Franklin Graham}}
|
|
|
|167
|-
|{{w|Lloyd Alexander}}
|
|
|
|168
|-
|{{w|Meg White}}
|
|
|
|169
|-
|{{w|Meg Ryan}}
|American actress. Known for 'WHen Harry met Sally'
|
|
|170
|-
|{{w|Debbie Reynolds}}
|American singer and actress.
|
|
|171
|-
|{{w|John Reynolds}}
|
|
|
|172
|-
|{{w|Carly Fiorina}}
|Former CEO of {{w|Hewlett-Packard}}. Ran for president in the 2016 Republican primaries.
|
|
|173
|-
|{{w|Grace Lee Boggs}}
|
|
|
|174
|-
|{{w|Wade Boggs}}
|American baseball player. Played with the {{w|Boston Red Sox}}.
|
|
|175
|-
|{{w|William Safire}}
|
|
|
|176
|-
|{{w|Prince William}}
|Member of the British Royal Family. Second in line for succession to the throne.
|
|
|177
|-
|{{w|Little Prince}}
|One of the main characters of ''{{w|The Little Prince}}'', a novella by {{w|Antoine de Saint-Exupéry}}. The Little Prince has previously appeared in [[618: Asteroid]], as well as [http://what-if.xkcd.com/68 article 68] of ''[[what if?]]''.
|
|
|178
|-
|{{w|Harry Potter}}
|Fictional character in the books by J.K. Rowling
|
|
|179
|-
|{{w|James Potter}}
|Fictional character, father of harry Potter
|
|
|180
|-
|{{w|James Hook}}
|Fictional character from 'Peter Pan'
|
|
|181
|-
|{{w|James Dean}}
|American actor and teen icon.
|
|
|182
|-
|{{w|Aretha Franklin}}
|Soul singer.
|
|
|183
|-
|{{w|Frank Lloyd Wright}}
|American architect, known for his unconventional buildings.
|
|
|184
|-
|{{w|Barry White}}
|
|
|
|185
|-
|{{w|Walter White}}
|Main character from the TV show {{w|Breaking Bad}}.
|
|
|186
|-
|{{w|Walt Whitman}}
|American poet. {{w|Walt Whitman Bridge|A bridge in Philadelphia}} was named after him.
|
|
|187
|-
|{{w|John Kelly}}
|
|
|
|188
|-
|{{w|Grace Lee}}
|
|
|
|189
|-
|{{w|Nancy Grace}}
|
|
|
|190
|-
|{{w|Garnet_(Steven_Universe)|Garnet}}
|A {{w|garnet}} is a gem stone and the two names around here are {{w|William Safire}} (almost {{w|Sapphire}}) and {{w|Jack Ruby}} as in {{w|Ruby}}. But it is not just used because they are all {{w|gemstones}}. It is instead a reference to the character {{w|Garnet_(Steven_Universe)|Garnet}} in the cartoon {{w|Steven Universe}}. She is a "fusion" formed by two gems: Ruby and Sapphire, hence the legal connection in the Name Dominoes... Randall has previously made references to this universe in [[1608: Hoverboard]]. (See [http://www.explainxkcd.com/wiki/images/3/39/1608_1031x1095y_Steven_Universe_family_and_ice_cream_prediction.png this] and [http://www.explainxkcd.com/wiki/images/f/fa/1608_1077x1109y_Darth_Vaders_talks_about_Steven_Universe_on_the_bridge_Megan_adjust_antenna.png this] image from that comic).
|{{w|William Safire}} {{w|Jack Ruby}}
|Last-Only (as a Sapphire gem stone) Last-Only (as a Ruby gem stone) Both used to fuse together to Garnet.
|191
|-
|{{w|Prince (musician)|Prince}}
|American musician, part of the Rock and Roll hall of fame. He died two years prior to the release of this comic.
|
|
|192
|-
|{{w|Prince Fielder}}
|Professional baseball player who retired in 2016 after playing for the Milwaukee Brewers, Detroit Tigers, and Texas Rangers.
|
|
|193
|-
|{{w|Prince Harry}}
|Member of the British royal family. Fifth in line for succession to the throne.
|
|
|194
|-
|{{w|Harry Styles}}
|
|
|
|195
|-
|{{w|John Dean}}
|
|
|
|196
|-
|{{w|Benjamin Franklin}}
|One of the founding fathers of the United States. Credited with "discovering" electricity by flying a kite in a thunderstorm.
|
|
|197
|-
|{{w|Harrold Lloyd}}
|
|
|
|198
|-
|{{w|Harrold Ford}}
|
|
|
|199
|-
|{{w|Betty White}}
|American comedian. Known as the only surviving member of the {{w|The Golden Girls}}.
|
|
|200
|-
|{{w|Meg Whitman}}
|
|
|
|201
|-
|{{w|Christine Todd Whitman}}
|Governor of New Jersey from 1994 to 2001, then served as Director of the Environmental Protection Agency under {{w|George W. Bush}} from 2001 to 2003.
|
|
|202
|-
|{{w|Megyn Kelly}}
|American TV news anchor. Worked for Fox news until 2017, then switched to NBC.
|
|
|203
|-
|{{w|Grace Kelly}}
|American actress and Princess of Monaco
|
|
|204
|-
|{{w|Grace Jones}}
|
|
|
|205
|-
|{{w|Jack Nicholson}}
|Actor who has appeared in many films from ''{{w|The Shining (film)}}'' (as Jack Torrance) to ''{{w|Batman (1989 film)}}'' (as the Joker) to ''{{w|A Few Good Men}}'' (as Colonel Jessup).
|
|
|206
|-
|{{w|Jack Ruby}}
|Jack Ruby is known for shooting and killing {{w|Lee Harvey Oswald}} on national television. Oswald was the prime suspect in the {{w|assassination of John F. Kennedy}}. Ruby's involvement is the subject of many conspiracy theories.
|
|
|207
|-
|{{w|Jack Russel}}
|
|
|
|208
|-
|{{w|Harry Fielder}}
|
|
|
|209
|-
|{{w|Harry Truman}}
|33rd president of the United States. Known for authorizing the use of atomic weapons against Japan at the end of World War 2.
|
|
|210
|-
|{{w|Harry Jon Benjamin}}
|
|
|
|211
|-
|{{w|John Edward}}
|
|
|
|212
|-
|{{w|Benjamin Harrison}}
|23rd president of the United States
|
|
|213
|-
|{{w|Harrison Ford}}
|American actor. Known for playing Han Solo in the ''{{w|Star Wars}}'' films and the titular character in the ''{{w|Indiana Jones}}'' films.
|
|
|214
|-
|{{w|Henry Ford}}
|Founder of the {{w|Ford Motor Company}}. Credited with inventing the assembly line.
|
|
|215
|-
|{{w|Betty Ford}}
|Wife of Gerald Ford, 38th president of the United States.
|
|
|216
|-
|{{w|Betty Friedan}}
|
|
|
|217
|-
|{{w|Chris Christie}}
|Governor of New Jersey from 2010 to 2018. Ran for president in the Republican primaries in 2016.
|
|
|218
|-
|{{w|Chris Pratt}}
|American actor. Known for {{w|Parks and Recreation}}
|
|
|219
|-
|{{w|Maggie Grace}}
|
|
|
|220
|-
|{{w|Grace Hopper}}
|American computer scientist. Helped develop the {{w|COBOL}} programming language.
|
|
|221
|-
|{{w|Russel Crowe}}
|Australian actor
|
|
|222
|-
|{{w|Russ Smith}}
|
|
|
|223
|-
|{{w|John Smith}}
|John Smith is the most common name in the United States. {{w|John Smith|See Wikipedia}} for a list of people this may refer to.
|
|
|224
|-
|{{w|Justin Long}}
|
|
|
|225
|-
|{{w|John Bel Edwards}}
|
|
|
|226
|-
|{{w|John Candy}}
|Canadian comedian and actor. Known for {{w|Spaceballs}}.
|
|
|227
|-
|{{w|John Henry}}
|American folk hero
|
|
|228
|-
|{{w|Henry James}}
|
|
|
|229
|-
|{{w|Bill James}}
|
|
|
|230
|-
|{{w|Chris Cooper}}
|
|
|
|231
|-
|{{w|Chris Hemsworth}}
|
|
|
|232
|-
|{{w|Chris Evans}}
|
|
|
|233
|-
|{{w|Topher Grace}}
|
|
|
|234
|-
|{{w|Van Morrison}}
|
|
|
|235
|-
|{{w|Sheryl Crow}}
|
|
|
|236
|-
|{{w|Sheryl Sandberg}}
|
|
|
|237
|-
|{{w|Cameron Crow}}
|
|
|
|238
|-
|{{w|Long John Silver}}
|Fictional antagonist from {{w|Treasure Island}}.
|
|
|239
|-
|{{w|Olivia Newton John}}
|American actress. Known for ''Grease''
|
|
|240
|-
|{{w|Huey Long}}
|Governor of Louisiana from 1928 to 1932, and US Senator from 1932 until his assassination in 1935. Known for his "Share Our Wealth" proposal to address the hard economic conditions of the Great Depression.
|
|
|241
|-
|{{w|John Edwards}}
|American politician. Democratic candidate for presidential nomination in 2004 and 2008.
|
|
|242
|-
|{{w|Candy Crowley}}
|
|
|
|243
|-
|{{w|Alestier Crowley}}
|
|
|
|244
|-
|{{w|James Fenimore Cooper}}
|Author of ''{{w|The Last of the Mohicans}}''.
|
|
|245
|-
|{{w|James Cook}}
|18th century British explorer, navigator, cartographer, and captain in the Royal Navy.
|Alistair Cooke Cokie Roberts Alistair Cookie James Fenimore Cooper
|Last-Last (approximate) Last-First (approximate) Last-Last (approximate) First-First
|246
|-
|{{w|Robert Frost}}
|19th century American poet
|
|
|247
|-
|{{w|Bob Evans}}
|
|
|
|248
|-
|{{w|Evan Tayler Jones}}
|
|
|
|249
|-
|{{w|Van Jones}}
|
|
|
|250
|-
|{{w|James Cameron}}
|American director. Known for {{w|Terminator}} and {{w|Titanic (1997 film)|Titanic}}.
|
|
|251
|-
|{{w|Cam Newton}}
|Quarterback for the {{w|Carolina Panthers}}.
|
|
|252
|-
|{{w|Cameron Diaz}}
|American actress. Voiced Fiona in {{w|Shrek}}.
|
|
|253
|-
|{{w|Huey Newton}}
|
|
|
|254
|-
|{{w|Huey Lewis}}
|
|
|
|255
|-
|{{w|John Lewis}}
|
|
|
|256
|-
|{{w|Jenny Lewis}}
|
|
|
|257
|-
|{{w|Ryan Lewis}}
|
|
|
|258
|-
|{{w|Burt Reynolds}}
|American actor. Known for a wide variety of western and/or action films.
|
|
|259
|-
|{{w|Alistair Cooke}}
|Name misspelled Alistiar Cooke in the comic.
|
|
|260
|-
|{{w|Monsterpiece_Theater#Alistair_Cookie|Alistair Cookie}}
|A parody of Alistair Cooke "played" by Cookie Monster in the Sesame Street sketch "Monsterpiece Theatre" in the 1980s, a parody of the PBS series "Masterpiece Theatre".
|James Cook Alastair Reynolds
|Last-Last (approximate) First-First (approximate)
|261
|-
|{{w|Cokie Roberts}}
|National Public Radio (NPR) political correspondent known for her recurring segment "Ask Cokie" in which she answers listener submitted questions.
|
|
|262
|-
|{{w|John Roberts}}
|Current Chief Justice of the United States Supreme Court at the time of the comic's publication.
|
|
|263
|-
|{{w|Robert Johnson}}
|
|
|
|264
|-
|{{w|Robert E. Lee}}
|Confederate general during the {{w|American Civil War}}.
|
|
|265
|-
|{{w|Tommy Lee}}
|
|
|
|266
|-
|{{w|Tommy Lee Jones}}
|American actor known for 'The Fugitive'
|
|
|267
|-
|{{w|Etta James|Etta James (2)}}
|Used first time in 86
|
|
|268
|-
|{{w|John Oliver}}
|American talk show host. Known for {{w|Last Week Tonight}}.
|
|
|269
|-
|{{w|Ryan Reynolds}}
|Canadian actor. Known for several romantic comedies, and {{w|Deadpool (film)|Deadpool}}.
|
|
|270
|-
|{{w|Alastair Reynolds}}
|
|
|
|271
|}

==Transcript==
:[This comic a large grid with 271 black "domino" tiles. On each tile there is a name written with white text. The grid is arranged so that each touching side corresponds with the first or last name of another person (or at least there are some kind of relation between the names on the end of connecting tiles). Some of the domino tiles are rotated 90, 180 or 270 degrees so the text is either to be read down, up-side down or up. The names on the tiles are listed here below in approximate reading order, thus staring top left and moving over the grid from left to right and down. Each swipe left to right covers approximately tiles that are within a span of one standard tile in height. To be exact it lists the names in the order they were numbered in this [http://www.explainxkcd.com/wiki/images/7/73/1970-_Name_Dominoes_-_The_large_image_with_numbers.jpg image]. One name is used twice, Etta James.]
:Christian Campbell
:Neve Campbell
:Joe McCarthy
:Eugene McCarthy
:Gene Vincent
:Gene Kelly
:Kate Hudson
:Rock Hudson
:Gordon Brown
:James Brown
:Jon Brown
:John Howard
:Columbo
:Chris Columbus
:Christopher Columbus
:Naomi Campbell
:Joseph Campbell
:Joseph Smith
:Frank Vincent
:John Kelly
:Katherine Johnson
:The Rock
:Chris Rock
:Chris Isaac
:James Newton Howard
:John Wayne
:Howard Stern
:Howard Hunt
:Chris Hughes
:Naomi Watts
:Naomi Klein
:Kevin Kline
:Francis Bacon
:Francis Drake
:Lyndon Johnson
:Oscar the Grouch
:Oscar Isaac
:Isaac Hayes
:Isaac Newton
:Wayne Newton
:Wayne Knight
:Helen Hunt
:Helen Hughes
:James Watt (Steam)
:James Watt (Interior)
:Kevin Costner
:Kevin Bacon
:Kevin Love
:Lisa Frank
:Frank Drake
:Drake
:Oscar de la Renta
:Oscar de la Hoya
:Sean Hayes
:Wallace Shawn
:Wayne Howard
:Wayne Brady
:James Brady
:Tom Brady
:Helen Thomas
:Tom Hanks
:Hank Aaron
:Aaron Carter
:Stephen James
:Will Smith
:Kevin Smith
:Kein James
:Garfield
:James Garfield
:Warren Buffett
:Jimmy Buffett
:Warren Beatty
:Elizabeth Warren
:Earl Warren
:Eliabeth Kolbert
:Stephen Colbert
:George Wallace
:Charles Wallace
:James Monroe
:Marilyn Monroe
:Hank Williams
:William C. Williams
:Steve Harvey
:Domino Harvey
:Harvey Milk
:James Saint James
:Etta James
:Jim Jones
:James Earl Jones
:Charlie Parker
:Ray Parker Jr.
:Ray Charles
:Charles Manson
:Marilyn Manson
:Robin Williams
:Billy D. Williams
:Will Wright
:Fats Domino
:Bill Clinton
:Jimmy John
:Tom Jones
:Tommy John
:Quincy Jones
:James Earl Ray
:Man Ray
:Rachel Ray
:Ray Allen
:Tim Allen
:Tim Cook
:Tim Howard
:Robin Wright
:Wilbur Wright
:Fatty Arbuckle
:Fat Joe
:George Clinton
:John Kerry
:Kerry Washington
:John Irving
:John Quincy Adams
:John Adams
:Amy Adams
:Aimee Mann
:Superman
:Batman
:Ayn Rand
:Lily Allen
:Paul Allen
:Ron Howard
:Howard Hughes
:Joe Kennedy
:George Bush
:George Wasington
:Wasington Irving
:Martha Wasington
:Ma Rainey
:Jack Ma
:Super Grover
:Jack Black
:Rand Paul
:Paul Ryan
:Paul Simon
:Ron Paul
:John Hughes
:Langston Hughes
:John F. Kennedy
:Little Richard
:Rich Little
:Martha Stewart
:Yo Yo Ma
:Ma Bell
:Grover Cleveland Alexander
:Grover Cleveland
:Jack White
:Jack Ryan
:Debby Ryan
:Carly Simon
:Carly Hughes
:Charles Evans Hughes
:John Williams
:Little John
:Stuart Little
:Potter Stewart
:Kristen Stewart
:Kristen Bell
:Kristen Hooks
:Alexander Graham Bell
:Franklin Graham
:Lloyd Alexander
:Meg White
:Meg ryan
:Debbie Reynolds
:John Reynolds
:Carly Fiorina
:Grace Lee Boggs
:Wade Boggs
:William Safire
:Prince William
:Little Prince
:Harry Potter
:James Potter
:James Hook
:James Dean
:Aretha Franklin
:Frank Lloyd Wright
:Barry White
:Walter White
:Walt Whitman
:John Kelly
:Grace Lee
:Nancy Grace
:Garnet
:Prince
:Prince Fielder
:Prince Harry
:Harry Styles
:John Dean
:Benjamin Franklin
:Harrold Lloyd
:Harrold Ford
:Betty White
:Meg Whitman
:Christine Todd Whitman
:Megyn Kelly
:Grace Kelly
:Grace Jones
:Jack Nicholson
:Jack Ruby
:Jack Russel
:Harry Fielder
:Harry Trueman
:Harry Jon Benjamin
:John Edward
:Benjamin Harrison
:Harrison Ford
:Henry Ford
:Betty Ford
:Betty Friedan
:Chris Christie
:Chris Pratt
:Maggie Grace
:Grace Hopper
:Russel Crowe
:Russ Smith
:John Smith
:Justin Long
:John Bel Edwards
:John Candy
:John Henry
:Henry James
:Bill James
:Chirs Cooper
:Chirs Hemsworth
:Chirs Evans
:Topher Grace
:Van Morrison
:Sheryl Crow
:Sheryl Sandberg
:Cameron Crow
:Long John Silver
:Olivia Newton John
:Huey long
:John Edwards
:Candy Crowley
:Alestier Crowley
:James Fenimore Cooper
:James Cook
:Robert Frost
:Bob Evans
:Evan Tayler Jones
:Van Jones
:James Cameron
:Cam Newton
:Cameron Diaz
:Huey Newton
:Huey Lewis
:John Lewis
:Jenny Lewis
:Ryan Lewis
:Burt Reynolds
:Alistiar Cooke
:Alistair Cookie
:Cokie Roberts
:John Roberts
:Robert Johnson
:Robert E. Lee
:Tommy Lee
:Tommy Lee Jones
:Etta James
:John Oliver
:Ryan Reynolds
:Alastair Reynolds

{{comic discussion}}

[[Category:Large drawings]]

1878: Earth Orbital Diagram

2017-08-18T22:38:35Z

162.158.78.136: /* Explanation */

{{comic
| number = 1878
| date = August 18, 2017
| title = Earth Orbital Diagram
| image = earth_orbital_diagram.png
| titletext = You shouldn't look directly at a partial eclipse because of the damage that can be caused by improperly aligning the solar-lunar orbital plane with the orbital bones around your eye.
}}

==Explanation==
{{incomplete|Created by a BOT - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
This comic is the third consecutive comic published in the week before the {{w|solar eclipse}} occurring on Monday, {{w|Solar eclipse of August 21, 2017|August 21, 2017}} which is a total solar eclipse and visible in totality within a band across the {{w|contiguous United States}} from west to east. The other comics are [[1876: Eclipse Searches]] and [[1877: Eclipse Science]].

The comic claims that the reason that eclipses don't happen every month is simple to understand by looking at an orbital diagram. Ironically, the cartoon has so many parts and labels that it is far more difficult to understand than is implied. While the graph itself is based on {{w|Orbital elements|astronomical definitions}} all the labels are nonsense in this context.

All these labels are complicated words, some are somewhat related to orbital mechanics ("equinox", "perihelion") while some are just Latin-sounding nouns. Moreover, many of the labels provided are kludged, obfuscated, or simply made up. Compare/contrast with the standard {{w|Kepler orbit|Kepler Orbit}} diagram. Most easily recognizable are the "Dimples of Venus," referring to axis-intersection points in the diagram on Earth.

The title text emphasize the warnings on not showing directly into the sun in a jokingly manner and refers to 'orbit' as the anatomical term for the eye socket.

All the labels and their astronomical meanings in detail:

;Arctangent
*{{w|Arctangent}} is the inverse function of the tangent function of trigonometry. You can determine a non-right angle of a right triangle by taking the arctangent of the length of the opposite side divided by the length of the adjacent side.
*The angle shown in the comic has no astronomical meaning.

;Astral plane
*The {{w|Astral plane}} is a plane of existence in various esoteric theories. Also used in fictional fantasy context.
*The picture shows the {{w|Orbit_of_the_Moon|lunar orbital plane}}, the plane in which the Moon orbits the Earth, tilted about 5.1 degrees from the ecliptic.

;Declension
*{{w|Declension}} is the inflection of nouns in a language.
*In astronomy the {{w|Declination|declination}} is one of the two angles that locate a point on the celestial sphere in the equatorial coordinate system. It is measured north or south of the celestial equator, like the geographical latitude on Earth. But in the picture the label is at the angle for the axial tilt of the Earth.

;Determinant of the date of Easter
*In Western Christianity {{w|Easter}} always falls on the first Sunday after the first astronomical full moon after the beginning of spring (equinox). Thus it is defined by a combination of a solar and a moon calendar. The position of that angle isn't that bad but it should be not more than 30 degrees (slightly more than one month.)

;Dimples of Venus
*The {{w|Dimples of Venus}} are indentations sometimes visible on the human lower back.
*In astronomy the {{w|Belt of Venus}} is a shadow cast by the Earth visible in its atmosphere.

;Enceliopsis
*{{w|Enceliopsis}} are small genus of flowering plants in the daisy family, appropriately known as "sunrays".
*In astronomy this point has also no specific meaning. But {{w|Enceladus}} is a moon around {{w|Saturn}}.

;Equinox / Solstice
{{w|Equinox}} and {{w|Solstice}} have a much different meaning:
*Equinoxes are the two instants in the year when the Sun is exactly over the equator; the length of day and night are very nearly equal that day, and it is the first day of spring or the first day of autumn.
*Solstices are the instants in the year when the sun's angle is maximally far from Earth's equator; when one occurs, the length of the day or night is shortest or longest (depending on whether one is in the northern or southern hemisphere), and it marks the first day of summer or winter.
Both types occur because the Earth's rotation axis is tilted (at 23.4 degrees) from its orbital plane (ecliptic) about the Sun.

;Hypothecate
*{{w|Hypothecate}} is a legal verb that means something similar to "make a mortgage".
*The depicted angle has no meanings but a {{w|Hypotenuse}} is the longest side of a right-angled triangle. Here it is the shortest side on a non right-angled triangle.

;Obsequity
*Obsequity means the state of being obsequious (showing a willingness to obey or serve).
*In astronomy the correct word is {{w|Obliquity}}, meaning an axial tilt.

;Perihelix
*This is a portmanteau of helix and perihelion.
*The {{w|perihelion}} is the point in a elliptical solar orbit that is closest to the Sun.

;Prolapse
*A {{w|Prolapse}} is a medical condition in which an internal organ is slipped forward or down.
*{{w|Retrograde and prograde motion}} are terms used to describe the apparent motion of celestial objects through the sky.

;Sagittal plane
*The {{w|Sagittal plane}} is an anatomical plane, dividing the body in left and right.
*The correct label in the picture would be the {{w|Ecliptic plane}}. The plane the Earth orbits the Sun.
*{{w|Sagittarius (constellation)|Sagittarius}} is one of the stellar constellations of the Zodiac. The center of the Milky Way lies in this constellation.

;Solar plexus
*The {{w|Solar plexus}} is a network of nerves located in the abdomen.
*{{w|Solar}} is an adjective referring to the Sun, the star in our solar system.

;Tropopause
*The {{w|Tropopause}} is the boundary in our atmosphere between the troposphere and stratosphere, defined as the boundary where air ceases to cool with increasing elevation. It is 9-17 km above sea level, not the thousands of kilometers as depicted here.

;Angle between the Astral and the Sagittal Planes

;Errata

==Explanation for "Why isn't there a (solar) eclipse every month?"==

If the plane of where the Earth orbits the Sun and where the Moon orbits the Earth were completely aligned, then there would be a solar eclipse at every new moon (once every {{w|Orbit_of_the_Moon#Lunar_periods| 29.5 days}}) and a lunar eclipse at every full moon (half a lunar period about 14.7 days after a New Moon). However, the plane in which the Moon orbits the Earth is tilted with an inclination of 5 degrees relative to that of the ecliptic plane (the plane defined by the Earth's orbit around the Sun). Eclipses are only possible during two eclipse seasons each year (half a year apart) where for a period of 31 to 37 days the Sun is nearly aligned with the two points in the tilted Earth-Moon plane where the Moon crosses the ecliptic plane. During an eclipse season at the time of a new moon there will be solar eclipses visible from certain locations and during full moons there will be lunar eclipses.

[[Image:Eclipse_Diagram.jpg]]

The real explanation of eclipses is evident from this xkcd comic, but is labeled with a fictional character similar to a Greek phi but with two vertical lines; the remaining labels also do not contribute to this explanation and exist only to distract or misinform the reader.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[An orbital map of the Earth is shown. The Sun is in the center, the Earth is at the right bottom, and the Moon is left below the Earth.]
:'''Why isn't there an eclipse every month?'''
:This is a common question! The answer is made clear by a quick look at the Earth's orbital diagram:

:[Label Sun:]
:Solar plexus

:[Label on the Earth's plane:]
:Sagittal plane

:[Labels on Earth's orbit (beginning at the Earth counterclockwise):]
:Perihelix, Declension, Obsequity, Hypothecate, Enceliopsis, Equinox (''Solstice'' in British English)

:[Two angles in the plane are labeled as:]
:Determinant of the date of Easter, Arctangent

:[The plane of the Moon is pictured in a small angle to the Earth's plane and named Astral Plane. The angle is presented between two lines (Greek Nu or Gamma and a double Greek Chi) and identified by a character that looks similar to a Greek Phi but with two vertical lines.]
:[The labels at the Moon's path are:]
:Tropopause, Prolapse, Errata.

:[An arrow points to the Earth at the zero meridian on the equator. The label reads:]
:Dimples of Venus

{{comic discussion}}

[[Category:Astronomy]]