<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=DMLL4305</id>
		<title>explain xkcd - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=DMLL4305"/>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php/Special:Contributions/DMLL4305"/>
		<updated>2026-04-17T21:12:59Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.30.0</generator>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2308:_Mount_St._Helens&amp;diff=192201</id>
		<title>2308: Mount St. Helens</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2308:_Mount_St._Helens&amp;diff=192201"/>
				<updated>2020-05-19T00:39:01Z</updated>
		
		<summary type="html">&lt;p&gt;DMLL4305: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2308&lt;br /&gt;
| date      = May 18, 2020&lt;br /&gt;
| title     = Mount St. Helens&lt;br /&gt;
| image     = mount_st_helens.png&lt;br /&gt;
| titletext = It's a good mountain but it really peaked in the 80s.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
Mount St. Helens is a volcano that famously and explosively erupted in the 1980's.  Thousands of tons of earth were thrown from one face of the mountain and slid into the surrounding countryside.  After it was over, the peak of Mount St. Helens was no longer the 5th highest in the state of Washington, having lost thousands of feet in height.  This comic marks the 40 year anniversary of the May 18, 1980 eruption that killed 57 people.&lt;br /&gt;
&lt;br /&gt;
{{incomplete|Created by AN OVERBLOWN MOUNTAIN. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
Technically, the other mountains may be fluctuating in height as well, due to erosion or the movement of Earth's tectonic plates, but this phenomenon is not visible on the time-scale that Randall has plotted. &amp;lt;!-- Or are they rising on average due to the Cascadia Subduction Zone?--&amp;gt; Precision GPS measurements of various peaks in Washington have only been available since 2010, and it's likely that the primarily volcanic mountain of Washington experience significant but slight variations throughout the year due to snowfall, melt, or the pressure of swelling magma inside volcanic cores.  These changes go largely unmeasured, while the mountains continue to appear equally physically unchanging and imposing both in person and from a distance.&lt;br /&gt;
Source: Seattle Times https://www.seattletimes.com/seattle-news/how-tall-is-rainier-really/&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
[Caption above graph]&lt;br /&gt;
Heights of mountains in Washington State&lt;br /&gt;
over time&lt;br /&gt;
&lt;br /&gt;
The Graph shows many horizontal lines which seem not to change, &lt;br /&gt;
&lt;br /&gt;
a bold line going horizontally then immediately drops at the 1980 mark and levels off, continuing on its horizontal path.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Timelines]]&lt;/div&gt;</summary>
		<author><name>DMLL4305</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=How_To&amp;diff=192019</id>
		<title>How To</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=How_To&amp;diff=192019"/>
				<updated>2020-05-14T15:21:29Z</updated>
		
		<summary type="html">&lt;p&gt;DMLL4305: /* Chapters */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;''How To: Absurd Scientific Advice for Common Real-World Problems'' is a book by [[Randall|Randall Munroe]]. &lt;br /&gt;
&lt;br /&gt;
Randall explains it this way: &amp;quot;For any task you might want to do, there's a right way, a wrong way, and a way so monumentally bad that no one would ever try it. This book is a guide to the third kind of approach. It's the world's least useful self-help book.&amp;quot;&lt;br /&gt;
&lt;br /&gt;
The book became available on September 3, 2019. However, he began promoting it in the [[xkcd Header text]] at the top of the comic on [[xkcd_Header_text#2019-02-06_-_How_to_book|February 2019]]. Since then, the header has most of the time been a promotion for the book.&lt;br /&gt;
&lt;br /&gt;
A month before the release, he made an entire comic about the book (not a real comic but a temporary one day comic): [[Disappearing Sunday Update]]&lt;br /&gt;
&lt;br /&gt;
Three weeks before the release, he made a permanent comic and [[blag]] entry about a chapter in the book with [[2190: Serena Versus the Drones]].&lt;br /&gt;
&lt;br /&gt;
One week before the release, he made another permanent comic and [[blag]] entry about a chapter in the book with [[2194: How to Send a File]].&lt;br /&gt;
&lt;br /&gt;
==Chapters==&lt;br /&gt;
* How to Jump Really High&lt;br /&gt;
* How to Throw a Pool Party&lt;br /&gt;
* How to Dig a Hole&lt;br /&gt;
* How to Play the Piano&lt;br /&gt;
* How to Make an Emergency Landing&lt;br /&gt;
* How to Cross a River&lt;br /&gt;
* How to Move&lt;br /&gt;
* How to Keep Your House from Moving&lt;br /&gt;
* How to Build a Lava Moat&lt;br /&gt;
* How to Throw Things&lt;br /&gt;
* How to Play Football&lt;br /&gt;
* How to Predict the Weather&lt;br /&gt;
* How to Play Tag&lt;br /&gt;
* How to Ski&lt;br /&gt;
* How to Mail a Package&lt;br /&gt;
* How to Power Your House (on Earth)&lt;br /&gt;
* How to Power Your House (on Mars)&lt;br /&gt;
* How to Make Friends&lt;br /&gt;
* [https://blog.xkcd.com/2019/08/26/how-to-send-a-file/ How to Send a File]&lt;br /&gt;
* How to Charge Your Phone&lt;br /&gt;
* How to Take a Selfie&lt;br /&gt;
* [https://blog.xkcd.com/2019/08/16/serena-versus-the-drones/ How to Catch a Drone]&lt;br /&gt;
* How to Tell If You're a Nineties Kid&lt;br /&gt;
* How to Win an Election&lt;br /&gt;
* How to Decorate a Tree&lt;br /&gt;
* How to Get Somewhere Fast&lt;br /&gt;
* How to Be On Time&lt;br /&gt;
* How to Dispose of This Book&lt;br /&gt;
&lt;br /&gt;
===Mini-chapters===&lt;br /&gt;
These only have a short comic strip instead of a detailed explanation.&lt;br /&gt;
* How to Listen to Music&lt;br /&gt;
* How to Chase a Tornado&lt;br /&gt;
* How to Go Places&lt;br /&gt;
* How to Blow out Birthday Candles&lt;br /&gt;
* How to Walk a Dog&lt;br /&gt;
* How to Build a Highway&lt;br /&gt;
* How to Change a Light Bulb&lt;br /&gt;
&lt;br /&gt;
[[Category:Meta]]&lt;br /&gt;
[[Category:How To]]&lt;/div&gt;</summary>
		<author><name>DMLL4305</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=192016</id>
		<title>2299: Coronavirus Genome 2</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=192016"/>
				<updated>2020-05-14T14:36:23Z</updated>
		
		<summary type="html">&lt;p&gt;DMLL4305: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2299&lt;br /&gt;
| date      = April 27, 2020&lt;br /&gt;
| title     = Coronavirus Genome 2&lt;br /&gt;
| image     = coronavirus_genome_2.png&lt;br /&gt;
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].&lt;br /&gt;
&lt;br /&gt;
[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].)  If his post catches on and is widely shared, it might be described as &amp;quot;going viral&amp;quot;.(This &amp;quot;virtually&amp;quot; spreading the {{w|COVID-19|coronavirus}}, would be a prank).&lt;br /&gt;
Additionally while exchanging research data generally is as good an idea as using readymade tools for science publishing the genome of a dangerous virus actually might cause the virus to spread further: There are specialized manufacturers that can mail you arbitrary DNA snippets if you send them their sequence as an ASCII file. That actually can work in the other direction, too: Some of the machines used by such firms in order to save space stored a base pair in 4 bits of memory and could (using a buffer overrun) be convinced to actually try to execute instead of manufacturing the DNA code.&lt;br /&gt;
&lt;br /&gt;
In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but is able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).  It could also be [https://twitter.com/TruePrimal/status/1255258879623139328 tweeted as an image].&lt;br /&gt;
&lt;br /&gt;
This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically.  Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).  It could also be a reference to the ''{{w|The Hitchhiker's Guide to the Galaxy|Hitchhiker's Guide to the Galaxy}}'' series, in which humanity is revealed to possibly be the descendants of the &amp;quot;useless&amp;quot; occupants of the planet Golgafrincham, including telephone sanitizers; unfortunately, after sending their useless members to the planet later called Earth, the remaining Golgafrinchans were subsequently wiped out by a plague caught from an unsanitized telephone. This may also be a reference to the concept of digital data sanitization (the screening of user inputs to prevent exploitation of security flaws) as in [[327: Exploits of a Mom]].&lt;br /&gt;
&lt;br /&gt;
The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to &amp;quot;like&amp;quot; your friend's posts, even if you think they're strange. Alternately, the &amp;quot;like&amp;quot; button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting).  When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might &amp;quot;like&amp;quot; the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself.  (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger).  In this case, Megan &amp;quot;like&amp;quot;ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]&lt;br /&gt;
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?&lt;br /&gt;
:Megan: Sure.&lt;br /&gt;
:Megan: ...Why?&lt;br /&gt;
&lt;br /&gt;
:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]&lt;br /&gt;
:Cueball (off-panel): Nothing.&lt;br /&gt;
:Megan: I ... see.&lt;br /&gt;
:Megan: Well, here you go.&lt;br /&gt;
:Laptop: Click&lt;br /&gt;
&lt;br /&gt;
:[In &amp;quot;two&amp;quot; frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square &amp;quot;speech bubble&amp;quot; with a &amp;quot;speech line&amp;quot; going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]&lt;br /&gt;
:Phone: &lt;br /&gt;
::GAAAGGTAAGATGGAGAGGCCTTGTC&amp;lt;span style=&amp;quot;background-color:pink&amp;quot;&amp;gt;CCTGGTTCAACGAGAA&amp;lt;/span&amp;gt;&lt;br /&gt;
::&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;-29,602&amp;lt;/font&amp;gt; &amp;lt;font color=&amp;quot;skyblue&amp;quot;&amp;gt;(+)&amp;lt;/font&amp;gt; &amp;lt;span style=&amp;quot;background-color:skyblue; color:white&amp;quot;&amp;gt;Tweet&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]&lt;br /&gt;
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.&lt;br /&gt;
:Megan:  Unsettling that your first instinct is &amp;quot;share it online.&amp;quot;&lt;br /&gt;
:Cueball: It's cool, I sanitized my phone before posting.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Coronavirus Genome]]&lt;br /&gt;
[[Category:Comics sharing name|Coronavirus Genome]]&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Biology]]&lt;br /&gt;
[[Category:Social networking]]&lt;/div&gt;</summary>
		<author><name>DMLL4305</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=192015</id>
		<title>2299: Coronavirus Genome 2</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=192015"/>
				<updated>2020-05-14T14:28:50Z</updated>
		
		<summary type="html">&lt;p&gt;DMLL4305: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2299&lt;br /&gt;
| date      = April 27, 2020&lt;br /&gt;
| title     = Coronavirus Genome 2&lt;br /&gt;
| image     = coronavirus_genome_2.png&lt;br /&gt;
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].&lt;br /&gt;
&lt;br /&gt;
[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].)  If his post catches on and is widely shared, it might be described as &amp;quot;going viral&amp;quot;.(This &amp;quot;virtually&amp;quot; spreading the coronavirus, would be a prank).&lt;br /&gt;
Additionally while exchanging research data generally is as good an idea as using readymade tools for science publishing the genome of a dangerous virus actually might cause the virus to spread further: There are specialized manufacturers that can mail you arbitrary DNA snippets if you send them their sequence as an ASCII file. That actually can work in the other direction, too: Some of the machines used by such firms in order to save space stored a base pair in 4 bits of memory and could (using a buffer overrun) be convinced to actually try to execute instead of manufacturing the DNA code.&lt;br /&gt;
&lt;br /&gt;
In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but is able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).  It could also be [https://twitter.com/TruePrimal/status/1255258879623139328 tweeted as an image].&lt;br /&gt;
&lt;br /&gt;
This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically.  Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).  It could also be a reference to the ''{{w|The Hitchhiker's Guide to the Galaxy|Hitchhiker's Guide to the Galaxy}}'' series, in which humanity is revealed to possibly be the descendants of the &amp;quot;useless&amp;quot; occupants of the planet Golgafrincham, including telephone sanitizers; unfortunately, after sending their useless members to the planet later called Earth, the remaining Golgafrinchans were subsequently wiped out by a plague caught from an unsanitized telephone. This may also be a reference to the concept of digital data sanitization (the screening of user inputs to prevent exploitation of security flaws) as in [[327: Exploits of a Mom]].&lt;br /&gt;
&lt;br /&gt;
The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to &amp;quot;like&amp;quot; your friend's posts, even if you think they're strange. Alternately, the &amp;quot;like&amp;quot; button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting).  When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might &amp;quot;like&amp;quot; the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself.  (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger).  In this case, Megan &amp;quot;like&amp;quot;ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]&lt;br /&gt;
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?&lt;br /&gt;
:Megan: Sure.&lt;br /&gt;
:Megan: ...Why?&lt;br /&gt;
&lt;br /&gt;
:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]&lt;br /&gt;
:Cueball (off-panel): Nothing.&lt;br /&gt;
:Megan: I ... see.&lt;br /&gt;
:Megan: Well, here you go.&lt;br /&gt;
:Laptop: Click&lt;br /&gt;
&lt;br /&gt;
:[In &amp;quot;two&amp;quot; frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square &amp;quot;speech bubble&amp;quot; with a &amp;quot;speech line&amp;quot; going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]&lt;br /&gt;
:Phone: &lt;br /&gt;
::GAAAGGTAAGATGGAGAGGCCTTGTC&amp;lt;span style=&amp;quot;background-color:pink&amp;quot;&amp;gt;CCTGGTTCAACGAGAA&amp;lt;/span&amp;gt;&lt;br /&gt;
::&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;-29,602&amp;lt;/font&amp;gt; &amp;lt;font color=&amp;quot;skyblue&amp;quot;&amp;gt;(+)&amp;lt;/font&amp;gt; &amp;lt;span style=&amp;quot;background-color:skyblue; color:white&amp;quot;&amp;gt;Tweet&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]&lt;br /&gt;
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.&lt;br /&gt;
:Megan:  Unsettling that your first instinct is &amp;quot;share it online.&amp;quot;&lt;br /&gt;
:Cueball: It's cool, I sanitized my phone before posting.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Coronavirus Genome]]&lt;br /&gt;
[[Category:Comics sharing name|Coronavirus Genome]]&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Biology]]&lt;br /&gt;
[[Category:Social networking]]&lt;/div&gt;</summary>
		<author><name>DMLL4305</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=192014</id>
		<title>2299: Coronavirus Genome 2</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=192014"/>
				<updated>2020-05-14T14:26:56Z</updated>
		
		<summary type="html">&lt;p&gt;DMLL4305: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2299&lt;br /&gt;
| date      = April 27, 2020&lt;br /&gt;
| title     = Coronavirus Genome 2&lt;br /&gt;
| image     = coronavirus_genome_2.png&lt;br /&gt;
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].&lt;br /&gt;
&lt;br /&gt;
[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].)  If his post catches on and is widely shared, it might be described as &amp;quot;going viral&amp;quot;.(He is basically making a prank on &amp;quot;virtually&amp;quot; spreading the coronavirus via internet).&lt;br /&gt;
Additionally while exchanging research data generally is as good an idea as using readymade tools for science publishing the genome of a dangerous virus actually might cause the virus to spread further: There are specialized manufacturers that can mail you arbitrary DNA snippets if you send them their sequence as an ASCII file. That actually can work in the other direction, too: Some of the machines used by such firms in order to save space stored a base pair in 4 bits of memory and could (using a buffer overrun) be convinced to actually try to execute instead of manufacturing the DNA code.&lt;br /&gt;
&lt;br /&gt;
In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but is able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).  It could also be [https://twitter.com/TruePrimal/status/1255258879623139328 tweeted as an image].&lt;br /&gt;
&lt;br /&gt;
This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically.  Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).  It could also be a reference to the ''{{w|The Hitchhiker's Guide to the Galaxy|Hitchhiker's Guide to the Galaxy}}'' series, in which humanity is revealed to possibly be the descendants of the &amp;quot;useless&amp;quot; occupants of the planet Golgafrincham, including telephone sanitizers; unfortunately, after sending their useless members to the planet later called Earth, the remaining Golgafrinchans were subsequently wiped out by a plague caught from an unsanitized telephone. This may also be a reference to the concept of digital data sanitization (the screening of user inputs to prevent exploitation of security flaws) as in [[327: Exploits of a Mom]].&lt;br /&gt;
&lt;br /&gt;
The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to &amp;quot;like&amp;quot; your friend's posts, even if you think they're strange. Alternately, the &amp;quot;like&amp;quot; button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting).  When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might &amp;quot;like&amp;quot; the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself.  (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger).  In this case, Megan &amp;quot;like&amp;quot;ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]&lt;br /&gt;
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?&lt;br /&gt;
:Megan: Sure.&lt;br /&gt;
:Megan: ...Why?&lt;br /&gt;
&lt;br /&gt;
:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]&lt;br /&gt;
:Cueball (off-panel): Nothing.&lt;br /&gt;
:Megan: I ... see.&lt;br /&gt;
:Megan: Well, here you go.&lt;br /&gt;
:Laptop: Click&lt;br /&gt;
&lt;br /&gt;
:[In &amp;quot;two&amp;quot; frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square &amp;quot;speech bubble&amp;quot; with a &amp;quot;speech line&amp;quot; going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]&lt;br /&gt;
:Phone: &lt;br /&gt;
::GAAAGGTAAGATGGAGAGGCCTTGTC&amp;lt;span style=&amp;quot;background-color:pink&amp;quot;&amp;gt;CCTGGTTCAACGAGAA&amp;lt;/span&amp;gt;&lt;br /&gt;
::&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;-29,602&amp;lt;/font&amp;gt; &amp;lt;font color=&amp;quot;skyblue&amp;quot;&amp;gt;(+)&amp;lt;/font&amp;gt; &amp;lt;span style=&amp;quot;background-color:skyblue; color:white&amp;quot;&amp;gt;Tweet&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]&lt;br /&gt;
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.&lt;br /&gt;
:Megan:  Unsettling that your first instinct is &amp;quot;share it online.&amp;quot;&lt;br /&gt;
:Cueball: It's cool, I sanitized my phone before posting.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Coronavirus Genome]]&lt;br /&gt;
[[Category:Comics sharing name|Coronavirus Genome]]&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Biology]]&lt;br /&gt;
[[Category:Social networking]]&lt;/div&gt;</summary>
		<author><name>DMLL4305</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1000:_1000_Comics/1000_characters&amp;diff=192013</id>
		<title>1000: 1000 Comics/1000 characters</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1000:_1000_Comics/1000_characters&amp;diff=192013"/>
				<updated>2020-05-14T14:12:45Z</updated>
		
		<summary type="html">&lt;p&gt;DMLL4305: /* Table of 1000 characters */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{incomplete|Most explanations from 647 to 1000 are missing.  Address all red text.}}&lt;br /&gt;
{{notice|'''This is a work in progress''' I have been working on a table listing all figures in the comic [[1000: 1000 Comics]] after having added pictures like those on this page: [[1000: 1000 Comics/Numbered images]]. I have now finished the first 646 characters, three legs into the 2nd zero, just missing the left part, but still nothing from the third zero. The table has been updated to include room for all 1000 characters, so it will be possible to easily continue with the explanation of each of the remaining figure. I'm not sure I will be able to continue with this work at the moment... So please feel free to improve. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:44, 13 August 2016 (UTC)}}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;big&amp;gt;'''[[#Table of 1000 characters|Go To Table]]'''&amp;lt;/big&amp;gt;&lt;br /&gt;
==Explanation==&lt;br /&gt;
*There will eventually be a numbered list of the 1000 small drawings/characters from [[1000: 1000 Comics]].&lt;br /&gt;
**See the numbering system here [[1000: 1000 Comics/Numbered images]].&lt;br /&gt;
***There will also be links to relevant part of the pictures from the table, see below.&lt;br /&gt;
**Relevant categories for comics, characters and items should be added to the main page.&lt;br /&gt;
*This is a sortable table of (eventually) all 1000 characters. &lt;br /&gt;
**In this way it is possible to find all Ponytails or White Hats quickly, all comics with straightforward references, transcripts, objects or animals.&lt;br /&gt;
* ''&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A red text:&amp;lt;/font&amp;gt;'' has been used to indicate where something is not explained-&lt;br /&gt;
**This could be where a character is suspected to be from an earlier comic, where some object is unclear, where the text of a transcript is unreadable etc.&lt;br /&gt;
**Please help trying to improve the explanation by going through these red items.&lt;br /&gt;
**All those entries that are not yet explained will begin with “&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text:&amp;lt;/font&amp;gt;”  to make it easy to sort those.&lt;br /&gt;
**Only problem is that they do not come to the top, but they will be sorted at the bottom of the list if either all those without red text or after all those with no text at all...&lt;br /&gt;
&lt;br /&gt;
The columns explained:&lt;br /&gt;
#The first column gives the number from the [http://www.explainxkcd.com/wiki/images/c/c7/1000_Comics_-_The_entire_comic_with_numbers.png numbered image].&lt;br /&gt;
#However, given that this is a big image, and not easily over-viewed, then after the number there is a link to an image of the relevant section from the [[1000:_1000_Comics/Numbered_images#Explanation|thirteen sections]] the whole image has been divided into.&lt;br /&gt;
##This section link for the first and last character in each section will be written in bold to make it clear when this occurs. It will also be mentioned in the explanation.&lt;br /&gt;
##The “one” is one section, but the three “zeros” have been divided in top (T), right (R), bottom (B) and left (L), so for instance the second zero bottom will be labeled: Zero 2 B.&lt;br /&gt;
#The third column is a description of the character (or picture if there is more to it than a simply character).&lt;br /&gt;
##It always begins with the name of a known character, or if an unknown the sex if that is clear.&lt;br /&gt;
###For known characters, a link will be given on the name, but only the first time a character appears.&lt;br /&gt;
##After that it continues with a full description of the character and any other object, animal or specialty correlated with this number on the list.&lt;br /&gt;
##The description always include if the figure is standing (most are) or are in some other position (sitting, lying, dancing, flying etc.) and also if they are standing alone or together with other characters, animals or objects and if they look left or right (or straight, but then nothing is noted).&lt;br /&gt;
###Standing alone means there are no obvious interactions with other characters or animals.&lt;br /&gt;
###Left/right direction indicate the direction the face is turned or the direction the head points, in case they are lying down.&lt;br /&gt;
###The direction Cueball is looking is not always clear. But if there is any indication of the direction it will be noted. &lt;br /&gt;
#Explanation if there is anything to explain.&lt;br /&gt;
## If the character is just standing alone and is one of the well-known there will be no explanation.&lt;br /&gt;
##A number after a characters mentioned in either explanation or description refers to the number in the table/image; instead of writing Ponytail no. 20 it just says Ponytail 20.&lt;br /&gt;
#References to any comic or category, or anything else obvious, but not given in any comic.&lt;br /&gt;
##Comic references where the name of the comic is written in bold are for references where there is (almost) no doubt it is a direct reference to that particular comic. &lt;br /&gt;
##When not bold it can be debated but has been deemed reasonable to include here instead of only in the description.&lt;br /&gt;
#Transcript for the few characters/images where anything is written. &lt;br /&gt;
##It can often be hard to read, but sometimes the image helps with a good guess.&lt;br /&gt;
#Animals are often included along with the characters, but never alone. Here they can be listed for easy reference.&lt;br /&gt;
#Objects are often included along with the characters, but never alone. Here they can be listed for easy reference.&lt;br /&gt;
&lt;br /&gt;
==Table of 1000 characters==&lt;br /&gt;
{| class=&amp;quot;wikitable sortable&amp;quot; &lt;br /&gt;
|- &lt;br /&gt;
! # &lt;br /&gt;
! Section &lt;br /&gt;
! Character description &lt;br /&gt;
! Explanation &lt;br /&gt;
! References &lt;br /&gt;
! Transcript &lt;br /&gt;
! Animals &lt;br /&gt;
! Objects &lt;br /&gt;
|- &lt;br /&gt;
| 1 || '''[http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One]''' || [[Cueball]] standing alone || The very '''first character in one''' is of course the standard everyman Cueball, and no matter how one would count, this character would be the first encountered! || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 2 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || [[Megan]] standing turned right hand up towards Cueball 3 || Megan and Cueball 3 interact, she lifts her hand and he points at her. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 3 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing left pointing with an arm at Megan 2 || Megan 2 and Cueball interact, she lifts her hand and he points at her. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 4 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with black hair wide standing right looking at Cueball 7 || The hairdo is much wider at the shoulder than Megan’s so it cannot be her or any other known characters. She may be looking down at Cueball 7. See also 171 and 325. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 5 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 6 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right leaning || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 7 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left looking up at the woman 4 || He may be looking up at the woman 4. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 8 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || [[Hairy]] standing alone left || The hair is not as thick as normal for Hairy, spikier. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 9 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left behind a lectern with a microphone heading a hand up to his mouth || Cueball is addressing some audience not shown. This is a typical setting for the public speaking comics, although there seems to be no situation where there is a microphone on the lectern when Cueball speaks. || Category: [[:Category:Public speaking|Public speaking]] || || || [[1661: Podium|Lectern]] &lt;br /&gt;
|-&lt;br /&gt;
| 10 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 11 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan prone right drifting up as shown with three lines || Megan seems to be floating up into the air. Could be that Cueball 12 and 13 are looking after her? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 12 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right looking up || He may be looking up at Megan 11 floating together with Cueball 13? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 13 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left looking up || He may be looking up at Megan 11 floating together with Cueball 12? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 14 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Character with a black half sphere on the head left looking down || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: What is on the head?&amp;lt;/font&amp;gt; This may be either a military or other kind of helmet, or a special hairdo, and could be both male and female? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 15 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing right towards Guy 16 her head down with a white heart floating in front of her || Megan seems to be in love woith the spectacled guy 16 to her right, but he seems not to notice her. This may explain why her head is bent down. || || Megan: ♥ || || &lt;br /&gt;
|-&lt;br /&gt;
| 16 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with glasses (round) and no hair standing right away from Megan 15 and her heart || Like Cueball with round glasses. Megan 15 to his left may have a crush on him with the heart in front of her and her head down because he seems not to notice her. See also 42 where he has square glasses. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 17 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right leaning || He may be looking at Ponytail 18 spinning in her office chair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 18 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || [[Ponytail]] sitting right arms out. She is spinning around in an office chair as shown with several circling lines || Ponytail is having fun spinning around in her office chair so fast she yells out loud. Maybe Cueball 17 is looking at her, maybe he gave her a push? Could be that he is the one spinning in the referenced comic where the friction of office chair is correlated to how much work is being done. Too little friction andeveryone just spins in stead of doing any work. The next to sit in a chair is Cueball 340 (not counting the wheelchair in 49). Ponytail is also the first to sit on the ground in 185. || Comic: '''[[815: Mu]]''' || Ponytail: ''Wheeee'' || || Office chair &lt;br /&gt;
|-&lt;br /&gt;
| 19 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 20 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 21 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone making wavy arms and holding something in his hand towards left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: What his he holding. What is the name for what he is doing with his arms? Is there a reference to a comic? Update: Named the dance and described the object. Looked for a reference to a previous comic, couldn't find anything but I'm not convinced I didn't miss something.  &amp;lt;/font&amp;gt; Cueball seems to be doing a variant of the wave dance move, although his version would be impossible to do in real life since it would require more joints than humans have. He is holding an object towards the left. || || || || Cueball is holding an object that resembles a short dagger, with a wide crossbar and triangular blade.&lt;br /&gt;
|-&lt;br /&gt;
| 22 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 23 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 24 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 25 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || Maybe Cueball 30 waves at him. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 26 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with hat, white dome shaped standing alone right || This version of White Hat is the one from Idiocracy. It is used more than once in this comic, so here he will not be listed as White Hat. See also 324. || Comic: [[603: Idiocracy]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 27 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing right towards short haired woman 28 || Cueball looking at woman 27. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 28 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with short black hair like Megan on the head but stop above neck standing left towards Cueball 27 || The woman looking at Cueball 28 has much shorter hair than Megan. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 29 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with hair bun white standing alone right || This is not Hairbun as she has dark hair. This white hair bun woman is used more than once (see already in 43). || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 30 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right waving with the arm to the right || He may be waving upwards towards Cueball 25. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 31 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with hat locomotive shaped and no hair standing right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Any references to comics?&amp;lt;/font&amp;gt; Could be that this guy was a model train [[878: Model Rail|enthusiast]]? Seems like this hat is related to the hat on 65. || || || || Locomotive hat &lt;br /&gt;
|-&lt;br /&gt;
| 32 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball&amp;amp;nbsp;standing&amp;amp;nbsp;alone&amp;amp;nbsp;right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 33 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || [[Mrs. Roberts]] standing alone left with an oven-mitt on her hand to the left that holds a bun tray from the oven and in her other hand she holds down her laptop || Mrs. Roberts trademark image, almost as the one from her character page and directly a link to {{w|Leet}} (1337). || Comic: '''[[341: 1337: Part 1]]''' || || || Laptop, oven mittens, baking plate &lt;br /&gt;
|-&lt;br /&gt;
| 34 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 35 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with sunglasses and no hair standing left || The sunglasses are drawn so small that it is hard to see the left glass. Could be a headband… See other guys like this at 261, 349 and 638 and Hairbun 568 with sunglasses. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 36 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Ponytail standing left hands out towards a woolly sheep with spiral horns facing her while baaing || Could be that it was a ram that charged at her but maybe she just reach out to pat the sheep as there are no speed lines to indicate movement. Could also be Mary after her little lamb got bigger. The reference to the Sheep comic may be dubious but this is the only sheep in this comic and he has a comic with that name... || Comic: [[35: Sheep]] || Sheep: Baaa || {{w|Sheep}} || &lt;br /&gt;
|-&lt;br /&gt;
| 37 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 38 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with hair bun black, large and on top of her head with what appears to be two hairpins stuck into it standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it hairpins in a hair bun? Any reference to characters drawn previously&amp;lt;/font&amp;gt; Even though this Megan like character has a hair bun it is much too different from Hairbun's to be her. See also similar women 38 and 427 with hairpins in hair bun. || || || || Hairpins? &lt;br /&gt;
|-&lt;br /&gt;
| 39 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 40 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Hairy standing alone right || First standard version of Hairy in the comic. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 41 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 42 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with glasses (square) and no hair standing right || Like Cueball with square glasses. See also 16 where he has round glasses. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 43 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with hair bun white standing alone right || This is not Hairbun as she has dark hair. This white hair bun woman is used more than once (see first appearance at 29). || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 44 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 45 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone left arms up and out || Megan holds her arms out like to embrace someone, but she seems to be standing alone. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 46 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with glasses (round) and no hair standing left || Like Cueball with round glasses. See also 42 where he has square glasses. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 47 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 48 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 49 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Stephen Hawking with dark hair and dark glasses sitting in his wheelchair with a computer screen in front of him alone right looking down || The image here is the last in the comic bearing the name, {{w|Stephen Hawking}}, as the title -he is downcast after the events in the comic and thus is looking down. || Comic: '''[[799: Stephen Hawking]]''' || || || Wheel chair with computer screen &lt;br /&gt;
|-&lt;br /&gt;
| 50 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing right towards Megan 51 || Cueball looking at Megan 51 || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 51 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing left towards Cueball 50 || Megan looking at Cueball 50. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 52 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 53 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone left longer hair || This Megan has somewhat longer hair, but not Danish length… || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 54 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 55 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right leaning while pointing left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 56 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right with both arms up || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 57 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing left with a turtle to his right talking to him. Seems short || There is also a turtle in [[636: Brontosaurus]]. Later a stack of turtles was used in [[1416: Pixels]]. It could also be a {{w|tortoise}} as the one drawn only 37 comics later in [[1037:_Umwelt#Black_Hat|Black Hat's version]] of [[1037:_Umwelt]]. This Cueball here looks short, maybe he is a kid? || Comic: [[889: Turtles]] || Turtle: Hey. || {{w|Turtle}} || &lt;br /&gt;
|-&lt;br /&gt;
| 58 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 59 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 60 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 61 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || [[Beret Guy]] standing right looking up at the woodpecker flying away with a drill it holds in its claws in the wire || A direct reference to the comic Woodpecker where Beret Guy gives a woodpecker an electric drill as a birthday present. The bird flies away with it as depicted here, although first after Beret Guy has left. || Comic: '''[[614: Woodpecker]]''' || || {{w|Woodpecker}} || &lt;br /&gt;
|-&lt;br /&gt;
| 62 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing right towards Cueball 63 and character 64 with her hands in front of her mouth || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: The sex of 64 is unclear and makes this triangle 62-64 hard to analyze&amp;lt;/font&amp;gt; Seems like this Megan (with more loose hair than normal) is shocked to see Cueball 63 and the person 64 holding hands. Maybe she was in love with one of them and is shocked to see them together as a happy couple. Or if it is supposed to be two men she could at the same time be shocked that they are openly gay... || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 63 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing right holding hands with the person 64 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: The sex of 64 is unclear and makes this triangle 62-64 hard to analyze&amp;lt;/font&amp;gt; Cueball holding hand with the person in 64 who could be a girl in which case Megan in 62 could be jealous, or it could be a guy in which case this could be a gay scene and that cold shock Megan (as well). || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 64 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Character with short black hair with spikes in the front standing left holding hands with Cueball 63 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: The sex of 64 is unclear and makes this triangle 62-64 hard to analyze&amp;lt;/font&amp;gt; Cueball 63 is holding hand with this person who could be a girl in which case Megan in 62 could be jealous, or it could be a guy in which case this could be a gay scene and that cold shock Megan (as well). || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 65 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with a hat city-sky-line shaped and no hair standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is the hat a city sky line or something else? Any references to comics?&amp;lt;/font&amp;gt; Seems like this hat is related to the locomotive hat on 31. || || || || City sky line hat &lt;br /&gt;
|-&lt;br /&gt;
| 66 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with hair bun white hair black bun standing alone left. Her hair is short and white. The hair bun sits on top of her head it looks black but could be caused by two hairpins stuck into the bun || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it hairpins in a hair bun? Could also look like it is an antenna on her head. If so it may even be a man with an antenna cap? Any reference to characters drawn previously?&amp;lt;/font&amp;gt;As the hair is white, it is not Hairbun plus there are hairpins. See also similar women 38 and 427 with hairpins in hair bun. || || || || Hairpins? &lt;br /&gt;
|-&lt;br /&gt;
| 67 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 68 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Ponytail standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 69 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Soldier with helmet with camouflage pattern and machine gun barrel upwards standing alone left || A soldier with arms ready like in the referenced comic, but with a different helmet. || Comic: [[984: Space Launch System]] || || || Machine gun &lt;br /&gt;
|-&lt;br /&gt;
| 70 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 71 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Hairy standing alone very tall || This version of Hairy has more curly hair than normally and he seems to be a head higher than the Cueballs around him. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 72 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right one arm bent at the elbow || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 73 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with beard, full, and black hair standing alone left || First guy with a beard! Could be Joseph (father of Jesus) from the referenced comic. Another guy 470 also has as beard but not quite like Joseph || Comics: [[992: Mnemonics]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 74 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left with both arms up, seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 75 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with hair only around the neck standing alone left seems tall || This could be Donald Knuth from [[342: 1337: Part 2]] or George from [[587: Crime Scene]]. The hair is the same. See similar guys at 269, 406, 516 and 608. See also Guy 411 with similar hair but different appearence. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 76 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Character with short black hair standing alone right || Could be either sex, hair too short to be Megan, like the next Megan 77. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 77 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone left || As this is clearly Megan the person 76 is clearly not Megan. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 78 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 79 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Ponytail standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 80 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 81 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || [[Science Girl]] standing alone right || It is size wise clearly a girl with hairdo like Science Girl. But so far the only known instance of Science Girl looking like this comes after this comic. But she was already in [[585: Outreach]]. Her first known appearance looking more like this was in [[1058: Old-Timers]] less than half a year later. But this exact feature was first used in [[1352: Cosmologist on a Tire Swing]]. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 82 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with long hair white standing alone right || The first woman with long blonde hair in the comic. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 83 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 84 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 85 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan running alone left arms out hair hanging loose and curly behind her || The first running character. There has been a floating and a spinning character, but the rest seems to be standing still. She is not clearly running towards any other character. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 86 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Hairy standing alone left with flat hair || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 87 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right pointing one arm right and down || The posture is almost identical with Cueball 89. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 88 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 89 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing right pointing right at Cueball 90 || He points at and maybe accusing Cueball 90 of something since Cueball 90 has his arms crossed in front of his chest and looks away and down like he is insulted or angry, This Cueball posture is almost identical with Cueball 87. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 90 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing right arms crossed in front of his chest looking down away from Cueball 89 who points at him || Maybe Cueball 89 who points at this Cueball is accusing him of something since this one has his arms crossed in front of his chest and looks away and down from the other like he is insulted or angry. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 91 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 92 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with helmet white with a strap under his chin no hair standing alone left, seems short || Could be the Cueball with a bicycle helmet for skating from the referenced comic. This does not look like a soldier compared with 69. But could also be a soldier’s helmet as it looks like the one in [[984: Space Launch System]]. It could be a kid. || Comic: [[579: The Race: Part 3]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 93 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 94 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone left with less dark hair || Megan’s hair is not quite so black as usual here. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 95 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Hairy standing alone left with very large hair || Hairy's hair is maybe a little too wild to be the regular Hairy… || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 96 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with black on top of his head, either a small black hat or a little hair, is standing alone with one arm a little out to hold on to something hanging down in front of him || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: What is on his head and what is in front of him. Reference to a comic?&amp;lt;/font&amp;gt; The items he holds in front of him seems to be transparent but distorts his body behind it so it seems to wave forth and back before reaching the legs. Could be he is having a towel around his body and it is the junction of the two ends of the towel that makes it look like the body is visible behind it. This would better explain why the leg to the right is not visible above the bottom of the towel... || || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Something held in front of the body&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 97 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left, seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 98 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone right || As this is clearly Megan the person 99 is clearly not Megan. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 99 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Character with short black hair standing alone right || Could be either sex, hair too short to be Megan, like Megan 98 before. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 100 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || Of course number 100 would also be a Cueball… || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 101 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan sliding on a snow board alone right hair standing out behind her || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; As there are no wheels it cannot be a skateboard. The way she stands also does not fit with ski. Could be a surfboard, but where’s the surf… || || || || Snowboard &lt;br /&gt;
|-&lt;br /&gt;
| 102 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 103 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 104 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right, very tall || A very large version of Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 105 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball lying down on his back alone left resting his head on his arms behind him || The first character that lies down on the ground. See also lying Cueball 597, the second to lie down like this. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 106 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 107 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Hairy standing alone right flat hair || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 108 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Hairy standing alone right large hair || Almost an Afro hairstyle on this Hairy || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 109 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone left wind blowing her hair back right || Seems like she is facing a strong wind from the left. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 110 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right holding an item towards right looking like a short golf club || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: What is Cueball holding and is this a reference to a comic?&amp;lt;/font&amp;gt; Cueball holds an item with a stick and a head. It looks like a golf club but seems too short. It also has the shape of a pipe but then it is too big. || || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Short golf club?&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 111 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Character with black hair and strange appearance floating above Hairbun 112 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: What is this? Reference for comic?&amp;lt;/font&amp;gt; A strange appearance floats above Hairbun 112 (maybe interacting with her and the woman 113 whom Hairbun may be interacting with?) It could be a person lying down leaning on arms looking straight out. So only the arms and torso and head can be seen. Could be either sex. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 112 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || [[Hairbun]] standing right maybe interacting with character 111 above her and with woman 113 to her right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is she interacting with 111 and 113 and if so is there a reference to a comic?&amp;lt;/font&amp;gt; The first instance of a woman with hair bun without pins. This is thus the first that can be described as Hairbun, but it is not the typical hair do for her. She may be interacting with the strange character 111 above her as well as with the freezing cloaked woman 113 || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 113 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with black hair like Megan standing left in a long black cloak indicated to freeze or shake with nine wiggly lines around her || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is she interacting with 112 and 113 and if so is there a reference to a comic? Freezing or shaking?&amp;lt;/font&amp;gt; This woman who could be a Megan freezing in spite of her clock may be interacting with Hairbun 112, and if she is interacting with character 111 then also with that person. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 114 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 115 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || First of 6 Cueballs in a row. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 116 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 117 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 118 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 119 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 120 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone left || Last of 6 Cueballs in a row. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 121 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with hair bun white standing alone right || White hair so not Hairbun. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 122 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 123 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 124 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 125 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Guy with hat white that looks a little like a knit cap, but seems to go too high above his head no hair standing alone left looking up || If this was a knit cap it would be closer to his head, so it seems like this white hat has a band around the rim and it quite tall over the head. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 126 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 127 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Man with very spiky hair dragging a large sword behind him. || This is a drawing of [http://finalfantasy.wikia.com/wiki/Cloud_Strife Cloud] from Final Fantasy VII, dragging his Buster Sword behind him. In the game, Cloud carries the large sword with ease, but in real the life the weight would be staggering, requiring him to drag it.&amp;lt;br&amp;gt; Alternative explanation: It is Jesus with thorn crown dragging a strange cross || || Object drawn: Scraape || || Sword &lt;br /&gt;
|-&lt;br /&gt;
| 128 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 129 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 130 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Megan standing right leaning towards Woman with white hair bun 131 || Seems like Megan is facing and interacting with the woman with hair bun 131 as she leans towards her and is already close by. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 131 || [http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One] || Woman with hair bun white standing left with Megan 130 leaning towards her || White hair so not Hairbun. Seems like Megan 130 lean over to her. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 132 || '''[http://www.explainxkcd.com/wiki/images/5/56/1000_Comics_-_The_one_in_thousand_with_numbers.png One]''' || Cueball standing alone right || This is the '''last character in one''', of course it is a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 133 || '''[http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T]''' || Cueball standing right towards Science Girl 134 holding a kite flying above her head || This is the '''first character in the first zero''' - of course also a Cueball. Kites have been a recurring theme in xkcd but this comic [[235: Kite]] was the first and the kite looks the same. Wether the kite is flown also for Science Girl 134 is unclear.||  Category: [[:Category:Kites|Kites]] || || || Kite &lt;br /&gt;
|-&lt;br /&gt;
| 134 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Science Girl Standing left under Cueball 133 kite, drawn with two hair buns || Seems like she is part of the kite flying Cueball 133. Size wise clearly a girl with hairdo like Science Girl with two hair buns like in [[1058: Old-Timers]]. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 135 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 136 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 137 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 138 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone left holding his hand out with a small round bomb with a lit fuse || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Seems Cueball is holding a lit bomb ready to throw it (but not at anyone in particular in this comic). Seems like there is no situation where this happens in xkcd? A similar bomb is shown in [[968: Everything]] but Cueball is not carrying it and it is not lit. Cueball throws a smoke-bomb in [[486: I am Not a Ninja]] but it does not have a fuse or look like this. || || || || Bomb with lit fuse &lt;br /&gt;
|-&lt;br /&gt;
| 139 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Megan flying right with arms spread out swooping downwards at Hairy 140 with great speed indicated with two speed lines after her hands || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; It is not certain that Megan is aiming at Hairy 140, but she aims at his position. Megan flying was shown in [[438: Internet Argument]] but she was not swooping down with great speed like here. Maybe she has imported antigravity from [[353: Python]]. Later Megan also flew without speed in [1416:_Pixels#Clouds|the clouds]] deep down in [[1416: Pixels]] and a similar [http://xkcd.com/1663/art/2x-flying-fig.png flying Megan] could &amp;quot;[[http://www.explainxkcd.com/wiki/images/3/38/1663_garden_Blitz_Girls_UFO_taking_Megan_garden.png grow]] in [[1663: Garden]]. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 140 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairy standing right with flying Megan 139 coming right at him. Very thin hair. || This version of Hairy has very little hair, but it is clearly not a bald Cueball. It is not certain that flying Megan 138 is aiming at Hairy but she aims at his position. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 141 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Character with short black hair standing alone left || Could be either sex, hair too short to be Megan but too long to be Hairy. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 142 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone leaning left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 143 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairbun standing alone left with hair falling down from the bun || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 144 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 145 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Character with short white hair standing alone right, seems short || Could be either sex, and maybe it is a child. See similar kid in 446 and similar adult in 174. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 146 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone arms raised up || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 147 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 148 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right looking up || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 149 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 150 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing right looking at Cueball 151 with an exclamation mark and a white heart over his head || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Does this Cueball have a crush on Cueball 151. Could be the second gay related event already… It cannot be stated for sure that they are looking at each other. || || Cueball: !♥ || || &lt;br /&gt;
|-&lt;br /&gt;
| 151 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing left looking at Cueball 150 || Maybe Cueball 150 has a crush on this Cueball. It cannot be stated for sure that they are looking at each other. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 152 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Guy with knit cap with long top and pom-pom at the end, glasses, a cane and a west (or other clothing) standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it another character from a previous comic?&amp;lt;/font&amp;gt; This could be a black and white version of Wally or Waldo (in the US) from the {{w|Where's Waldo}} books. Randall included the color version in [[980: Money]] (though without glasses, but with eyes which Randall never draws in regular comics, so maybe glasses was added since Waldo should not be drawn without?) Then there would also be a Where's Waldo in this 1000 comic released only 20 comics later. || || || || Cane &lt;br /&gt;
|-&lt;br /&gt;
| 153 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right, seems short || Maybe a child? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 154 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 155 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right holding a briefcase by its handle in one hand || Cueball is holding a briefcase in the handle. This could be related to the referenced comic where he arrives home to find Black Hat trying to cover up a murder. || Comic: [[542: Cover-Up]] || || || Briefcase &lt;br /&gt;
|-&lt;br /&gt;
| 156 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Ponytail standing right with curly hair at her forehead. Seems to be looking at other woman with ponytail 157 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; The curly hair at her forehead in unusual for Ponytail. She seems to be looking at another curly haired woman 157 with a dark ponytail. Maybe they belong together (in a comic?) || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 157 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Woman with a ponytail dark and curly hair at her forehead standing left looking at Ponytail 156 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; She seems to be looking at Ponytail 156 also drawn with curly hair at her forehead which is unusual for Ponytail. Maybe they belong together (in a comic?) || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 158 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing right hands up to his mouth shouting as indicated with three lines in front of his mouth. Maybe he shouts as spinning Megan 159 || This Cueball seems to be shouting at Megan 159 maybe to stop her from spinning. This is not part of the comic that her spinning is related to. So maybe they are not connected. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 159 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Megan is spinning fast around herself as indicated with three circles around her body below her outstretched arms. She faces left towards Cueball 158 || This is a direct reference to the Angular Momentum comic but in that comic there was no shouting Cueball, but maybe he tries to make her stop before she throws up (see title text). Later the same spinning Megan was used in [[442: xkcd Loves the Discovery Channel]], but that was a call back to the other comic. See also Cueball 541 spinning. || Comic: '''[[162: Angular Momentum]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 160 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || [[Danish]] standing alone right || Danish can usually not be distinguished without her personality, but with this very long hair, much longer than Megan’s usually is, it is reasonable to assume it could be her. She looks quite a lot like the version of Danish in [[1014: Car Problems]] released a few weeks after this comic. Most of the comics she appears in were before 1000. See also Danish 373. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 161 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 162 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Ponytail standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 163 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 164 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 165 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 166 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 167 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Guy with glasses (square) and no hair standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 168 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right, seems short || Maybe a child? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 169 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 170 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 171 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Woman with black hair wide standing right looking at Cueball 172 || This is the second version of this woman with wider hair than Megan, and also this time she seems to be looking at a Cueball, this time 172. See also 4 and 325. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 172 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing left looking at woman 172 || Second time a Cueball seems to be looking at a woman 172 with wider hair than Megan. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 173 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 174 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Character with short white hair standing alone right || Could be either sex, but as opposed to the similar 145 it cannot be a child. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 175 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 176 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 177 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Guy with glasses (round) standing alone left with both arms out || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 178 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 179 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairbun standing alone right with very dark hair bun || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 180 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Ponytail standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 181 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 182 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairbun standing alone left with looser hair || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 183 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 184 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball dancing alone right one leg lifted up and bend at the knee body bend forward, both arms out and two lines both in front of the knee and behind his back to indicate the dancing || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Cueball seems to be enjoying a little dance alone. It would fit very well if he had been in front of Megan 286. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 185 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Ponytail sitting on the ground alone right leaning back on one hand, while the other hand seems to be lifted to her face like she is speaking on a phone. One leg is almost straight the other lifted up || Ponytail is the first person to sit on the ground, which she also does in 458 and 510. Previously Ponytail 18 was also seen sitting on a spinning office chair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 186 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairbun standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 187 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Aragorn with beard (full) and hair is standing alone right with his broken sword lifted up in one arm || {{w|Aragorn}} from the {{w|Lord of the Rings}} was depicted like this in the referenced comic. Towards the end of LOTR the broken sword Narsil is reforged and handed to Aragorn. || Comic: '''[[370: Redwall]]''' || || || Broken sword &lt;br /&gt;
|-&lt;br /&gt;
| 188 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 189 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairy standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 190 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 191 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 192 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Guy with glasses (round) standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 193 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairbun standing alone right with very dark hair bun || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 194 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone leaning left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 195 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Science Girl standing alone right with bun and hair down her back || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 196 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairy standing alone right, seems short || May be a kid like Science Girl 195 to his left || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 197 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone left, seems short || May be a kid, making it three in a row with 195 and 196 as well. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 198 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairy standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 199 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing left together with Cueball giant 200 || Together with giant Cueball 200 they look like the pair in panel four of the referenced comic. || Comic: '''[[68: Five Thirty]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 200 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball giant twice normal height standing left with Cueball 199 || Together with the normal sized Cueball 199 they look like the pair in panel four of the referenced comic. || Comic: '''[[68: Five Thirty]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 201 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Megan standing alone left, seems short || May be a kid. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 202 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 203 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing right looking at Cueball machine 204 || Seems like he is looking at Cueball machine 204 who encompasses him and Cueball 205 with his outstretched arms. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 204 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball torso with outstretched arms fused together with a platform standing on its three spider-like legs which looks mechanical. He seems to encompass Cueball 2023 and 205 on either side of him || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Seems like someone made an experiment with Cueball putting his torso on top of some platform that is supported by (at least) three sharp ended legs. He is now part man part machine, but not like a typical cyborg... Seems like he holds his arms out to the two Cueballs on either side of him 203 and 205, maybe they are his servants or creators? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 205 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Cueball standing left looking at Cueball machine 204 || Seems like he is looking at Cueball machine 204 who encompasses him and Cueball 203 with his outstretched arms. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 206 || [http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T] || Hairy standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 207 || '''[http://www.explainxkcd.com/wiki/images/b/b7/1000_Comics_-_The_first_zero_in_thousand_Top_with_numbers.png Zero 1 T]''' || Cueball standing alone right || This is the '''last character in the first zero top''', of course it is a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 208 || '''[http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R]''' || Cueball standing alone right || This is the '''first character in the first zero right''' - of course also a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 209 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Woman with long hair white but maybe also a hair bun standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; The way the hair comes down to her shoulders make her look different from any normal characters. She also seems to have some kind of hair bun, which does not fit with the hair. The color seems to be white, but with features on her forehead. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 210 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Hairy standing right towards Megan 211 with a white heart floating between them || A couple in love as indicated with the heart between Hairy and Megan 211. See also similar Cueball/Megan couple 590-591. || || Hairy/Megan: ♥ || || &lt;br /&gt;
|-&lt;br /&gt;
| 211 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing left towards Hairy 210 with a white heart floating between them || A couple in love as indicated with the heart between Megan and Hairy 210. See also similar Cueball/Megan couple 590-591. || || Hairy/Megan: ♥ || || &lt;br /&gt;
|-&lt;br /&gt;
| 212 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 213 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 214 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 215 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Woman with two hair buns on either side of her head standing || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 216 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 217 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing right looking at Megan 218 with her sign || Seems like he is reading Megan’s 217 sign. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 218 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing left showing a sign she is holding on a stick in one hand to Cueball 217 and Cueball 219 || Megan is the first to be listed of the nine characters that holds up a small sign showing a binary number which forms the shape of a heart if connected. As this heart begins at 0, she is the third of the nine forming the left of the upper left part of the heart. As she is drawn it seems like both Cueball 217 and 219 looks at her sign. || || Sign: 10 || || Sign on a stick &lt;br /&gt;
|-&lt;br /&gt;
| 219 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing left looking at Megan 218 with her sign || Seems like he is reading Megan’s 217 sign. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 220 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Woman with dark hair that seems to fall behind her, maybe like a ponytail She holds up a sign above her head with both hands. || This woman’s hair does not look like Megan’s, as it seems to fall only to her left side as if it has been collected in a ponytail. She is the second to be listed of the nine characters that holds up a sign showing a binary number which forms the shape of a heart if connected. As this heart begins at 0, she is the second of the nine forming the right of the upper left part of the heart. || || Sign: 1 || || Sign &lt;br /&gt;
|-&lt;br /&gt;
| 221 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball falling sideways alone right having bounced on the visible grassy ground twice, as indicated with three curved lines, and he is now positioned head down, arms out and legs flailing up in to the letters A of the sound he makes while tumbling further right || This Cueball represents ''The Man Who Fell Sideways'' from the referenced comic. The gravity pulls him wrongly along the ground thus he always falls, and only meet people when bumping into them, maybe the white haired character 222 is in for a surprise, but it doesn't seem like they are connected. || Comic: '''[[417: The Man Who Fell Sideways ]]''' || Cueball: Aaaaaaaaa || || &lt;br /&gt;
|-&lt;br /&gt;
| 222 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Character with short white hair standing alone right holding up a sign above the head with both hands || Could be either sex. This is the third to be listed of the nine characters that holds up a sign showing a binary number which forms the shape of a heart if connected. As this heart begins at 0, this is the fourth of the nine forming the outer part of the upper left part of the heart. || || Sign: 11 || || Sign &lt;br /&gt;
|-&lt;br /&gt;
| 223 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Ponytail standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 224 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing alone left, seems short || Maybe she is kid. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 225 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Ponytail is standing alone right looking into a large telescope standing on a platform that almost coincides with the helmet of the guy 230 below, but seems to not have any connection || In the referenced comic Ponytail looks into a much larger observatory like telescope to discover the Sun is dying. Seems like a mistake that this drawing overlaps with Guy 230 below. Actually hard to say if the platform is on his head or below the telescope as it seems the legs of the telescope goes below this platform instead of resting on it. || Comic: [[673: The Sun]] || || || Telescope &lt;br /&gt;
|-&lt;br /&gt;
| 226 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 227 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 228 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 229 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 230 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Guy with helmet white with a strap under his chin no hair standing alone right with what appears to be roller skates on his feet. Seems to be unstable as the movement lines indicate his feet are about to move apart. Is drawn so close to Ponytail 225 that the base of her telescope coincides with his helmet || This guy wears roller skates, something never drawn in xkcd so far. Looks like the Cueball with a bicycle helmet for skating from [[579: The Race: Part 3]]. It also looks like the soldier’s helmet in [[984: Space Launch System]]. Seems like a mistake that this drawing overlaps with Ponytail 225 above. Actually hard to say if the platform is on his head or below the telescope as it seems the legs of the telescope goes below this platform instead of resting on it. Could be some kind of device attached to the helmet. || || || || Roller skates &lt;br /&gt;
|-&lt;br /&gt;
| 231 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone right holding a sign level with his torso, one hand coming from above and one from below to hold it || This Cueball is the fourth to be listed of the nine characters that holds up a sign showing a binary number which forms the shape of a heart if connected. As this heart begins at 0, he is the fifth of the nine forming the lower left of the upper left part of the heart. || || Sign: 100 || || Sign &lt;br /&gt;
|-&lt;br /&gt;
| 232 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Guy with black hair going up in two spikes on each side of his head standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This hairdo is very special and not at all like Hairy's. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 233 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Woman with long curly white hair standing right towards Cueball 234. Seems to have something attached to both arms, that is disconnected from her hair that stops clearly above these items || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? What does she wear on her arms?&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 234 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing left towards curly haired woman 233 || Seems like he is looking at woman 233 with curly hair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 235 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 236 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Guy with Afro hairdo giant size standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; A very large hair on top of this guy compared to 248, close by, and also 565. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 237 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 238 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 239 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 240 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing right with a giant snail with a coiled shell with its head out displaying the two eyes tentacles. Its rear side is hidden behind Cueball. The snail seems to be moving right away from Cueball || Cueball and his giant pet snail. The only snail drawn in xkcd so far seems to be a sea snail at the bottom of the seas to the right in [[731: Desert Island]]. || || || {{w|Land snail|Snail}} || &lt;br /&gt;
|-&lt;br /&gt;
| 241 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 242 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 243 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone right, larger than normal || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 244 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 245 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 246 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Ponytail standing right towards Cueball 247 || Seem like she faces Cueball 247. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 247 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing left towards Ponytail 246 || Seems like he faces Ponytail 246. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 248 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Guy with Afro hairdo normal size standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; A more normal Afro hair than on 236, like 565. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 249 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left, seems short || Maybe a child? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 250 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 251 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Mephistopheles standing alone right with horns, tail with arrow and a trident held before him in one hand || The devil {{w|Mephistopheles}} has been used twice, but only in the referenced comic also with {{w|trident}}. He was first used in [[501: Faust 2.0] without trident. || Comic: '''[[533: Laptop Hell]]''' || || || Trident &lt;br /&gt;
|-&lt;br /&gt;
| 252 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing right towards Cueball 253 || Seems to be looking at Cueball 253 || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 253 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing left towards Cueball 252 || Seems to be looking at Cueball 252 || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 254 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Woman with white hair but not a simple hairstyle standing right almost touching the sword tip of Richard Stallman 255 || The woman is not looking like any regular figures. But In the [[:Category:1337|1337 series]] Stallman 255 was helping [[Elaine Roberts]], daughter of the hacker [[Mrs. Roberts]]. This woman could be meant to represent Elaine, but the hair is not drawn in the same way as in the comic, although both are white haired, so maybe it is just a coincidence that the sword tip almost touches her? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 255 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || [[:Category:Comics featuring Richard Stallman|Richard Stallman]] with beard and wild hair stands with two katana swords pointing right and left, the latter almost touching Woman 254 || {{w|Richard Stallman}} is a recurring character in xkcd, and he is always depicted with two {{w|katana swords}}. This depiction of Stallman is taken almost directly from the referenced comic in the Leet/[[:Category:1337|1337 series]]. He was first shown, also with swords, in [[225: Open Source]]. In the 1337 series he was helping [[Elaine Roberts]], daughter of the hacker [[Mrs. Roberts]]. The woman 254 could be meant to represent Elaine, but the hair is not drawn in the same way as in the comic, although both are white haired, so maybe it is just a coincidence that the sword tip almost touches her? || Comic: '''[[345:_1337:_Part_5]]''' || || || Katana swords, two &lt;br /&gt;
|-&lt;br /&gt;
| 256 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Hairy standing alone right, seems short || This really looks like a child. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 257 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 258 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 259 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 260 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Guy with spiky hair standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; The hairdo is much different than Hairy’s. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 261 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Guy with sunglasses and very thin black hair standing alone left || First time seen in 35. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 262 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 263 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 264 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 265 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Hairy standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 266 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 267 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 268 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 269 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Guy with hair only around the neck standing alone left || This could be Donald Knuth from [[342: 1337: Part 2]] or George from [[587: Crime Scene]]. The hair is the same. The first Guy with hair like this was 75. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 270 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Character with short black hair standing alone right || Could be either sex, hair too short to be Megan. Also the hair on top of the head is higher than usual for a Megan. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 271 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Guy with hat a peaked cap and a stick in one hand, and appears to only have one arm, the other ending in a black square next to his shoulder || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; At first it may appear to be a police officer with {{w|peaked cap}} and a {{w|baton}}, but it seems weird he only has one arm. Could of course be a drawing mistake, and after drawing a shoulder pad Randall may have forgotten to draw the arm. In that case it is a policeman. But if he only has one arm and some weapon in his hand, it could also be a pirate with a special peaked pirate cap. Black peaked caps has been drawn on police officers both in [[587: Crime Scene]] and [[617: Understocked]]. Also after this comic in [[1018: Good Cop, Dadaist Cop]], [[1105: License Plate]] and [[1251: Anti-Glass]] || || || || Stick/baton &lt;br /&gt;
|-&lt;br /&gt;
| 272 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Guy with spiky hair standing alone left, seems short || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Looks like a kid with crazy hair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 273 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Character with black hair in a high dome on top of the head standing alone left || Could be either sex, hair too short to be Megan. Also the hair on top of the head is higher than usual for a Megan. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 274 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Megan standing alone right shaking a round object with black strings up and down as indicated with two lines above and below || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? What is it she is shaking&amp;lt;/font&amp;gt; It could look like a Medusa head (or normal head) she is shaking. Do not look like a ball. || || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Round object with black strings&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 275 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 276 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Cueball swinging left on a robe as indicated with three lines behind his back while he is looking back over his shoulder at the short haired woman 277 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Is this Tarzan and then Jane as the woman 277? || || || || Robe &lt;br /&gt;
|-&lt;br /&gt;
| 277 || [http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R] || Woman with short hair standing left looking at Cueball 276 swinging by her. || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Is this Tarzan as Cueball 276 and then Jane is this woman? Her hair is too short for Megan, but long enough to look female. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 278 || '''[http://www.explainxkcd.com/wiki/images/a/a4/1000_Comics_-_The_first_zero_in_thousand_Right_with_numbers.png Zero 1 R]''' || Megan standing alone left || This is the '''last character in the first zero right''', finally a Megan not a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 279 || '''[http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B]''' || Megan standing alone right || This is the '''first character in the first zero bottom''', which is also a Megan not a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 280 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 281 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 282 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Hairbun standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 283 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Boy with hair like hairy, standing alone right || Obviously a child, a boy with hair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 284 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 285 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 286 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Megan dancing alone left one arm up and one arm held out, one leg held up and bent completely at the knee, three double lines indicating movement of arms and legs || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Megan seems to be enjoying a little dance alone. It would fit very well if she had been in front of Cueball 184. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 287 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Hairbun standing alone left, seems she has some hair hanging down her back || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 288 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Character with short white hair standing alone right || Could be either sex, see also similar characters at 174 and 222. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 289 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 290 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing right in a very tight embrace arms with around, legs between each others and kissing Cueball 291 with a white heart over their heads || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a characters from a previous comic?&amp;lt;/font&amp;gt; Obviously two Cueball's kissing in such a tight embrace is a gay reference. There are several of these throughout this comic. This could be the two Cueball's from [[65: Banter]] a little later… || || Cueballs: ♥ || || &lt;br /&gt;
|-&lt;br /&gt;
| 291 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing left in a very tight embrace arms with around, legs between each others and kissing Cueball 290 with a white heart over their heads || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a characters from a previous comic?&amp;lt;/font&amp;gt; Obviously two Cueball's kissing in such a tight embrace is a gay reference. There are several of these throughout this comic. This could be the two Cueball's from [[65: Banter]] a little later… || || Cueballs: ♥ || || &lt;br /&gt;
|-&lt;br /&gt;
| 292 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || He could be looking at the gay Cueballs couple 290-291, but seems offset from them. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 293 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || [[Blondie]] with very long white hair standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This may be the longest white hair on any woman drawn in xkcd. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 294 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Hairy standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 295 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 296 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Boy with a hat, a fez, standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Obviously a child, a boy with a {{w|fez}} with the characteristic shape and with a tassel attached to the top. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 297 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Hairbun standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 298 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball hanging in the air a little above the ground alone left arms stretched out, legs bend a little at the knee shadow beneath him on the ground || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Cueball could have just jumped and pulled his legs up, but is seems like he is floating in the air keeping his arms out for balance. He may later be the one falling down in 576. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 299 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Hairbun standing alone left with lots of hair also coming down her back || There is a clear hair bun but the hair down her back is more than usual for Hairbun || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 300 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 301 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Guy in an open lab coat with wild long hair and glasses standing alone left with both arms raised up || This may very well be meant to represent {{w|Emmett_Brown|Dr. Emmett L. Brown}} from {{w|Back to the Future (franchise)|Back to the Future}}, since a kid was dressed up looking like this, and in the same pose, in the referenced comic. Given that this does not look like a kid it could not be the kid, but rather the real person. Seems like he has not been drawn in any comic though. || Comic [[656: October 30th]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 302 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing with bend knees and arms out alone left bending his back backwards right but keeping his head above his feet || Could look like he was dancing but both feet are on the ground and there are no movement lines like say dancing Megan 286. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 303 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 304 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || Could be involved with Cueball 305 but this is not clear. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 305 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball running alone left with arms up like he is happy that he has just spotted a black rectangular shape on the ground in front of him || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a situation from a previous comic? What is the object on the ground and why is he happy to see it. Anything to do with Cueball 304 standing there?&amp;lt;/font&amp;gt; This running Cueball seems to be happy that for the object he finds on the ground. Could be his wallet lying open on the ground. Could also be some kind of sport, where he runs toward this object to kick it. In that case maybe he is playing with Cueball 304? || || || || Black rectangular object &lt;br /&gt;
|-&lt;br /&gt;
| 306 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 307 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right looking up || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 308 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right, seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 309 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 310 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 311 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 312 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 313 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing right leaning slightly toward Megan 314 || Looks like he is with Megan 314 || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 314 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Megan standing left leaning slightly toward Cueball 313 || Looks like she is with Cueball 313 || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 315 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball inside a hamster ball is rolling right down a steep slope alone. He is at this moment face down, head to the right a little lower than his feet and arms out. The drawing is smaller than the others, so he is not a kid, just further away. The slope is also drawn and it continues with two more lines to indicate that it is long behind Megan 316 and stops in front of the feet of Cueball 317, without they are involved. Behind the hamster ball there are two lines to indicate the rolling motion. Above the Hamster ball is a word that is not easily readable || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: What is the word above the hamster ball?&amp;lt;/font&amp;gt; Hamster ball is a recurring theme in xkcd, see the referenced category, and was first featured in [[152: Hamster Ball]], but this scene with Cueball rolling down a hill is not from any comic. The only scene with something falling down (a stair) in a hamster ball was a robot in [[413: New Pet]]. However, much later in [[1608: Hoverboard]], there was a [http://www.explainxkcd.com/wiki/images/5/53/1608_0987x1075y_Hamsterball_bowling.png scene with a girl] running downhill inside a hamster ball. || Category: [[:Category:Hamster Ball|Hamster Ball]] || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Cueball: Tho??a&amp;lt;/font&amp;gt; || || Hamster ball &lt;br /&gt;
|-&lt;br /&gt;
| 316 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Megan standing alone right, seems tall || This Megan seems taller than the surrounding figures, the Cueball 317 next to her, seems short, maybe he is her child? Behind her is part of the slope from the hamster ball Cueball 315, but she is not part of that scene. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 317 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right, seems short || This Cueball seems short, maybe he is a kid, or it is just because Megan 316 is extra tall. Maybe she represents his mother. Just left of his feet is part of the slope from the hamster ball Cueball 315, but he is not part of that scene. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 318 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Megan standing alone right || This Megan is obviously shorter than Megan 316, but does not seem like a child. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 319 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 320 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Character with something black on the head, seems short || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; The character looks short, maybe it is a kid? The black shape on the head seems a little like a flat hat, and the black along the back of the head could be a strip holding it in place. It could also just be short black hair, but then not clear what sex the character has. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 321 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Megan standing right towards Cueball kid 322, she also seems short || This Megan here looks short, maybe she is a kid? But then the boy looking like Cueball 322 to her left, much shorter than her, is definitely also a kid. Maybe her little brother. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 322 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Boy looking like Cueball standing right, may be together with Megan 321 || This kid looking like Cueball is certainly too short to be Cueball. He is standing near Megan 321 who, although clearly taller, is short compared to most characters, so maybe she is also a child and could be his older sister? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 323 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left, seems tall || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 324 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Guy with hat, white dome shaped with wide brim standing alone left || This version of White Hat is the one from Idiocracy. It is used more than once in this comic, so here he will not be listed as White Hat. The hat seems to have a wider brim than 26. || Comic: [[603: Idiocracy]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 325 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Woman with black hair wide standing alone right || This is the third version of this woman with wider hair than Megan. See also 4 and 171. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 326 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 327 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 328 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || [[White Hat]] standing alone right || This is the first standard version of White Hat in this comic. The previous two with white hat was the shape from [[603: Idiocracy]], see 324. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 329 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left, with a face that almost has a heart shape, rather than round || Seems like this face has been drawn sloppily, not like those with clearly different shapes later. Although the shape here almost resembles a heart. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 330 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball wearing a mask with a long nose and a strip around his neck standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Seems like there is no comic with a guy in a mask like this with a long nose. Could be a {{w|Guy Fawkes mask}} which was referenced shortly before this comic in [[960: Subliminal]], but not on a Cueball. A guy wearing a mask is seen nine comics before this in [[991: Phantom Menace]], but it is not that kind of mask here. || || || || Mask wit long nose &lt;br /&gt;
|-&lt;br /&gt;
| 331 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 332 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Ponytail standing alone right || Her head is turned to the ponytail is partly hidden behind her head. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 333 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 334 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Guy with hat black bowler standing alone right || There have been two guys with black bowler hats in [[344: 1337: Part 4]] and [[344: 1337: Part 5]], but they looked somewhat different more high and slim, so not quite like this guy. Similar difference between this guy and Black Hat as White Hat and the [[603: Idiocracy]] guy. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 335 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left looking down at his hand which holds something small and slim like a smartphone || Could be Cueball from the referenced comic, where he holds a smartphone looking at it like this Cueball. See also Cueball 523, maybe also holding a smartphone. || Comic: [[864: Flying Cars]] || || || Smartphone &lt;br /&gt;
|-&lt;br /&gt;
| 336 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right, seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 337 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 338 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Character with short curly standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Could be either sex with this short curly hair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 339 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Character with short white hair standing alone right || Could be either sex, see also similar characters at 174, 222 and 288. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 340 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball sitting alone left leaning back in an armchair legs straight in front of him || There are several comics with Cueball sitting in an armchair but in the references comic Cueball is seen sitting in a very similar position having been watching {{w|The Matrix}}. Previously only Ponytail 18 has been seen sitting in a chair (an office chair). || Comic: [[566: Matrix Revisited]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 341 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Hairy standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 342 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone right || He could be looking at two Cueballs with present 343-344. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 343 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing right towards Cueball 344 who is holding up a present || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Seems like he receives a present from Cueball 344. Maybe Cueball 342 is also in on this party? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 344 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing left towards Cueball 343 holding a wrapped present up in one hand || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic? Is it a present?&amp;lt;/font&amp;gt; Seems like he offers the present he holds up to Cueball 343. Maybe Cueball 342 is also in on this party? The drawing of the present is not very clear, and it doesn't look like the wrapping goes down below the box. || || || || Box looking like a wrapped present &lt;br /&gt;
|-&lt;br /&gt;
| 345 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Ponytail standing alone left, seems short || The Ponytail here looks short, maybe she is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 346 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Woman with white hair and pigtails standing alone || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; There have been two girls with pigtails in xkcd, the first was a parody not in the style of xkcd in [[142: Parody Week: Megatokyo]], and the other is a girl in [[573: Parental Trolling]], with dark hair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 347 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 348 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 349 || [http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B] || Guy with sunglasses standing alone left || First time seen in 35. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 350 || '''[http://www.explainxkcd.com/wiki/images/5/5c/1000_Comics_-_The_first_zero_in_thousand_Bottom_with_numbers.png Zero 1 B]''' || Cueball standing alone left || This is the '''last character in the first zero bottom''', again it is a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 351 || '''[http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L]''' || Cueball standing alone leaning right || This is the '''first character in the first zero left'', again it is a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 352 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 353 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Woman with hair bun white standing alone right || This is not Hairbun as she has dark hair. This white hair bun woman is used more than once (see already in 43 and above here 420). Maybe the next character 354 is also this woman or maybe a guy with knit cap? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 354 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Character with either hair bun white or it could be a knit cap with a pom-pom on top standing alone left || Could be either sex, depending if it is a woman with hair bun (which would make it two next to each other with 353) or a guy with knit cap. {{w|Knit cap|Knit caps}} has been [[1350:_Lorenz#Knit_Cap_Girl|used several times]] in xkcd but only after this comic. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 355 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || [[:Category:Comics featuring Cory Doctorow|Cory Doctorow]] in his cape and googles are flying swooping head first downwards and left alone with his cape out behind him and two speed lines along the edges of his cape || This is the typical representation of Cory Doctorow, who is featured twice in this section of this first zero (see 398 as well). Cory Doctorow has been shown in several comics and this flying version is from the referenced comic. Normally his cape is drawn in red, but there is no color in this comic. || Comic: '''[[442: xkcd Loves the Discovery Channel]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 356 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 357 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 358 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 359 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Hairbun standing alone right || She is standing above and left of the woman with white hair bun 353 who is near another character 354 perhaps with bun (or knit cap with pom-pom), but it is a close cluster of characters with buns or poms. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 360 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 361 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 362 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 363 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Hairy standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 364 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone leaning right, seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 365 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Hairy standing alone left || Hairy’s hair is spiky || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 366 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 367 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Hairy standing alone left || Hairy’s hair is messy || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 368 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 369 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 370 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Guy wearing some kind of black head gear standing alone seems like the top of the head can be seen in the middle, so it could just be a head band. || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? What is it on his head?&amp;lt;/font&amp;gt; A guy is wearing something on his head. Is it a hat, is it hair is it a hairband. Given that some of the head seems to be visible at the top maybe that. Could also be two large horns a little like Mephistopheles 251, but not at all like him. Could also be a crown with two peaks on either side, which the head gear may look to have, and that would be able to go low enough to show the top of the head. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 371 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 372 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Woman with long black hair generally much larger in all directions than Megan’s || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This woman’s hair is so much more thick and long than Megan’s usually is, and not at all like the depiction of Danish either like 373 || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 373 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Danish standing alone left || Danish can usually not be distinguished without her personality, but with this very long hair, much longer than Megan’s usually is, it is reasonable to assume it could be her. She looks quite a lot like the version of Danish in [[1014: Car Problems]] released a few weeks after this comic. Most of the comics she appears in were before 1000. Very much different from the other longer than Megan haired woman in 372. See Danish 160 || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 374 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Hairy standing alone right || Hairy’s hair stands up || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 375 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball sitting right on the ground straight back supported with on one hand behind him, while the other hand resting on the knee of one leg which is lifted up and bend at the knee getting close to his head. Maybe he rests his chin on his arm on the knee. The other leg is almost straight out but bends a little at the knee. Maybe Megan 376 is looking down on him. || This Cueball is the second person to sit on the ground. Previously Ponytail 185 also sat on the ground, and later Cueball 439 and Cueball as Rob 602 will sit on the ground as well. Cueball 340 sat in an armchair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 376 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing left maybe looking down on sitting Cueball 375 || Megan maybe looking at sitting Cueball 375, but it is not clear. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 377 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || This is the first of nine Cueballs in a row from 377-385. However, not all of them are placed together due to the numbering system. Particularly this Cueball is two rows below the full row from 379-383. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 378 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 379 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || Cueballs 379-383 constitutes a full line across the right part of the first zero only with Cueball. They are part of the nine Cueballs in a row. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 380 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 381 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 382 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left, seems tall || This Cueball is taller than the others in this group of nine. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 383 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || Cueballs 379-383 constitutes a full line across the right part of the first zero only with Cueball. They are part of the nine Cueballs in a row. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 384 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left, seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 385 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || This is the last of nine Cueballs in a row, but given the numbering system not all of them are close together. But he is the top of a group of five Cueballs close together. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 386 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing right is holding a hand out to a sitting squirrel, it looks big she looks short || This Megan here looks short, maybe she is a kid? She seems to reach out to maybe pad the squirrel which is drawn almost exactly as in [[776: Still No Sleep]] but here it is with Cueball. Squirrels are a recurring theme as shown in the reference. || Category: [[:Category:Squirrels|Squirrels]] || || Squirrel || &lt;br /&gt;
|-&lt;br /&gt;
| 387 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone left, seems short || This Megan together with Megan 386 may both be kids. Maybe she looks on Megan 386 and her squirrel?. Those two girls and the guy 391 are more or less surrounded by a ring of nine Cueballs, with even more of them close by. One of the most Cueball-lized areas so far. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 388 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 389 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Character with short loose hair standing alone || Could be either sex, not really hair like a Hairy. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 390 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone, seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 391 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Guy with black knit cap standing alone right || This looks very much like a guy with knit cap. {{w|Knit cap|Knit caps}} has been [[1350:_Lorenz#Knit_Cap_Girl|used several times]] in xkcd but only after this comic. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 392 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball dancing alone left one leg slightly lifted and crossing over the other leg on the ground body bend slightly both arms out and one is higher up and three times two lines at his arms and behind his back indicate the dancing || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Cueball seems to be enjoying a quiet little dance alone. As he did in 184 but more vigorously. Megan 186 is also dancing. Seeing this Cueball &amp;quot;hanging&amp;quot; above the two characters next to him 391 and 393 is could look like he was floating up in the air. But the lines do not indicate this and there is no shadow below him as for floating Cueball 298. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 393 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 394 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left arms out || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 395 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 396 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Ponytail standing alone right, seems short || This Ponytail here looks short, maybe she is a kid? It would be the second Ponytail in a row after 395. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 397 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Hairy standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 398 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cory Doctorow in his cape and googles standing left, left arm lifted up || This is the typical representation of Cory Doctorow, who is featured once before in this section of this first zero (see 355 as well). Cory Doctorow has been shown in several comics and this version is probably from the first depiction of him in the referenced comic , which is actually not of him but of a guy trying to look like him, Normally his cape is drawn in red, but there is no color in this comic. || Comic: '''[[239: Blagofaire]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 399 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 400 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 401 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 402 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 403 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 404 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Boy looking like Cueball standing right, seems like he is holding a snake in its tale shaking it by the tail so it flows out from his arm snaking in the air || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a snake and does it refer to a previous comic?&amp;lt;/font&amp;gt; This boy child (much shorter than regular Cueballs) seems to be holding a snake, but it is not clear if it is a snake or represents some weird long arm on the kid? See similar boy with branch 475. || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Snake?&amp;lt;/font&amp;gt; || &lt;br /&gt;
|-&lt;br /&gt;
| 405 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone right, may be looking toward the guy 406 || There is some distance but she is facing the next guy 406. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 406 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Guy with hair only around the neck standing alone left, maybe looking at Megan 405 || This could be Donald Knuth from [[342: 1337: Part 2]] or George from [[587: Crime Scene]]. The hair is the same. The first Guy with hair like this was 75. See also 411 just above him, which does not really look like this guy but same style of hair. He may be looking at Megan 405 even though there is some distance between them. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 407 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 408 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 409 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 410 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 411 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Guy with hair only around the neck standing alone right, head is very thin || This does not really look like the other guy 406 with hair like this just below him. The head shape is weird like it has been squeezed together. The first Guy with hair like this was 75 but he did not quite look like this guy. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 412 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Guy with hair short white and spiky standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Seems a special type of hair, that has not been seen before in this comic. Not looking like similar described 491. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 413 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone right, may be looking toward the Cueball 414 || Could be looking at Cueball 414. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 414 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left, may be looking toward the Megan 413 || Could be looking at Megan 413. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 415 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 416 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Guy with glasses (square) and hair black standing alone right || Most of those with glasses so far have been bold as Cueballs, but this one has hair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 417 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 418 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 419 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 420 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Woman with hair bun white standing alone right || This is not Hairbun as she has dark hair. This white hair bun woman is used more than once (see already in 43, and below here in 353) || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 421 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 422 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Hairbun standing alone left || Hairbun with her dark hair looks in the direction of the white haired woman with hair bun 420. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 423 || [http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L] || Ninja dressed in black with black cloth around his head so only a small part of the face is visible and a broad and curved sword in hand standing alone right || There have been several references to {{w|ninjas}} before this comic. But in neither of these does they look much like this one with this particular curved sword. First time with ninjas was in [[225: Open Source]] and there is also one in the first comic of [[820: Five-Minute Comics: Part 2]]. Cueball has also noted that [[486: I am Not a Ninja]]. || || || || Ninja sword &lt;br /&gt;
|-&lt;br /&gt;
| 424 || '''[http://www.explainxkcd.com/wiki/images/0/06/1000_Comics_-_The_first_zero_in_thousand_Left_with_numbers.png Zero 1 L]''' || Cueball standing alone || This is the '''last character in the first zero''', again it is a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 425 || '''[http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T]''' || Cueball standing alone right || This is the '''first character in the second zero''' - of course also a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 426 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 427 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Woman with hair bun black, large and on top of her head with what appears to be two hairpins stuck into it standing alone right looking down arms out || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it hairpins in a hair bun? Any reference to characters drawn previously&amp;lt;/font&amp;gt; Even though she has a hair bun it is much too different from Hairbun's to be her and with the pins in. See also similar women 38 and 66 with hairpins in hair bun. || || || || Hairpins? &lt;br /&gt;
|-&lt;br /&gt;
| 428 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 429 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right, seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 430 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left balancing (or dancing) on one leg with the other lifted up and bend by the knee arms out || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Could it be that he is about to kick the squirrel above the smoke of Cueball 439?&amp;lt;/font&amp;gt; Seems like this Cueball is balancing on one leg, but could also be that he is dancing. However, a few others that clearly danced had lines to indicate movement, which is not the case here. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 431 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 432 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 433 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Character with short dark hair standing alone left || Could be either sex. See also 586. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 434 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 435 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right arms out, seems short || This Cueball here looks short, maybe he is a kid? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 436 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left pushing with both arms, one leg lifted behind him, on the hilt of a sword that is just protruding out of a large stone. The stone has a jagged edge to the left, and is a bit lower where the sword is pushed in. Sound effect and lines to show the pushing is drawn over Cueballs hands || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This is clearly a reference to the sword in the stone ({{w|Excalibur}}). The legend says that whoever pulls on the {{w|hilt}} of that sword, to get it out of the stone will be the king of England. However, either Cueball is desperate not to get that honor, or he is the one that is about to place it there making it hard to get out. There seem to be now direct reference fro before this comic, but much later a comic titles exactly [[1521: Sword in the Stone]], references a situation where a person getting the sword declines the honor after reading about England. Read the explanation for that comic on more about the sword. There are however what appears to be the hilt a sword sticking out of a stone in right pile in the second panel of [[968: Everything]]. Maybe it is this stone Cueball has prepared for Megan in that comic. || Other: {{w|Excalibur#Excalibur_and_the_Sword_in_the_Stone| Sword in the Stone}} || Sound: ''Puhs push'' || || Hilt of a sword sticking out of a large stone &lt;br /&gt;
|-&lt;br /&gt;
| 437 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right arms out on top of a balance board looking like a skateboard with only one large wheel in the middle. Four times two movement lines on either side of Cueball and the wheel shows he is balancing and not moving || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Cueball is using a {{w|balance board}} (and not a one wheeled skateboard) and is managing to hold the balance even though movement lines indicate that he shifts left and right on the board. There have been many comics with skateboards or electrical skateboards, but seems like there are none with a balance board. || || || || Blance board &lt;br /&gt;
|-&lt;br /&gt;
| 438 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Boy with hair like hairy, standing alone left || Obviously a child, a boy with hair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 439 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball sitting on the ground right straight back supported with on one hand behind him, while the other hand resting on the knees which are lifted up is holding the pipe he is smoking. The smoke rises straight but then seems to hit a shelve above it on top of which sits something that looks like a squirrel, but could also be licking flames. Maybe together with Cueball 440 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? What is happening here? Does the smoke support a shelve with a squirrel or is it flames above the smoke? Do Cueball try to smoke out the squirrel? Do this belong with the Cueball 440 or is the squirrel a part of Cueball 430 trying to kick it?&amp;lt;/font&amp;gt; This is a very difficult situation to decipher. Best guess at the moment is that Cueball is tired of the squirrel sitting above him and is trying to smoke it out. [[:Category:Squirrels|Squirrels]] are a recurring theme and in [[382: Trebuchet]] a trap to get rid of squirrels are mentioned, although more effective than smoke in getting rid of them. It is unclear if there is any relation with Cueball 440 with his plant but they are closer together than most other characters, but maybe that is just the smoke and the plant's fault and not the two figures? This is the second Cueball sitting on the ground, the first being 375. || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Squirrel?&amp;lt;/font&amp;gt; || Pipe with smoke and a shelfe above it (with flames or squirrel?) &lt;br /&gt;
|-&lt;br /&gt;
| 440 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing right with a potted plant behind him. It is a thin stem with a few leafs. At the top it reaches Cueballs shoulders and bends towards him. He stands close to Cueball 439 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? Has he any relation to the Cueball 439? Is it a potted plant?&amp;lt;/font&amp;gt; Looks like Cueball is standing with his plant looking away from Cueball 439. It is unclear if there is any relation with Cueball 439 with his pipe and smoke but they are closer together than most other characters, but maybe that is just the smoke and the plant's fault and not the two figures? There is a potted plant in the office in [[393: Ultimate Game]]. Later a more similar potted plant next to a kid looking away (like Cueball here) was [http://www.explainxkcd.com/wiki/images/3/3e/1608_1033x1095y_The_rotary.png seen in the rotary] inside the Destroyer in [[1608: Hoverboard]]. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 441 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Woman with lots of spikes in her hair on the back of her head standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? What is it with her hair. Is it hair or is something sitting on her head, not a hat?&amp;lt;/font&amp;gt; This Megan style woman has a weird hair style or something with spikes has attached itself to her head? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 442 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball with antenna on his head standing right towards Cueball three arms 443 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? What is it on his head? Maybe it should not be listed as Cueball if it is hair or a hat?&amp;lt;/font&amp;gt; This Cueball seems to have a small antenna on his head. Could also be a single hair? Maybe this freak belongs together with the three armed Cueball 443? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 443 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left all three arms out, hands on the two arms to the left. Maybe together with Cueball 442 || This is the Cueball clock with three arms from panel five in the referenced comic. He even has the same position and hands on two (though not all three) arms. He may be together with the other freak Cueball 442 with antenna on his head? || Comic: '''[[68: Five Thirty]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 444 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Woman with hair long and loose standing alone right with a scarf around her neck hanging down her back. She holds her arms up to keep it over her throat as she makes a sound like she is freezing || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This woman is not Megan. Her hair is different and looks weird over her head. Maybe it should look like some kind of hat? She obviously freezes with the sound and the scarf. Although this is not Megan, Megan is seen here with a scarf: [[726: Seat Selection]]. || || Woman with scarf: ''Brrr'' || || Scarf &lt;br /&gt;
|-&lt;br /&gt;
| 445 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 446 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Character with short white hair standing alone left, seems short || Could be either sex, and maybe it is a child. See similar kid in 145 and similar adult in 174. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 447 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Woman with hair short black and with a bump in the neck standing alone left, seems short || This woman here looks short, maybe she is a kid? Her hair is short compared to Megan and there is a small hair bun like bump in the neck, but it does not really look like a hair bun and not at all like Hairbun. See also similar woman 481. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 448 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Guy with hair or some kind of hat standing alone || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a cap or hair on his head? It would change the direction he looks!&amp;lt;/font&amp;gt; This guy seems to have either some thin hair or maybe some hat, like a cap? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 449 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 450 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 451 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Hairy standing alone right, with thin hair || This Hairy has very thin hair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 452 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right looking down || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 453 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Megan standing alone left with hair flowing behind her || Seems like Megan is facing wind into her face which blows her hair out behind her, giving her a different look from normal Megan. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 454 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Guy with thick hair is either standing with some sword hanging up his back, or it is part of the chair he is sitting in. His hands are toward what appears to be a bird bath with a duck in it&amp;lt;/font&amp;gt; || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? Hopefully it is because it is impossible to see what happens here. What is the thing in front of him? Is he standing with sword or sitting in a chair?&amp;lt;/font&amp;gt; It looks like a [http://www.explainxkcd.com/wiki/images/e/e8/1663_garden_Cueball_talks_to_deer_duck_in_birdbath.png duck in a birth bath] in front of this person who either have a sword or sits in a chair? Seems small too, but would be even smaller if sitting on a chair. || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Duck?&amp;lt;/font&amp;gt; || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Bird Bath?&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 455 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 456 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right holding the remote control for a radio controlled toy helicopter flying up as indicated with two lines above and below || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Cueball is playing with his radio-controlled helicopter. One of those was also shown later in [[1110: Click and Drag]] where Beret Guy [http://imgs.xkcd.com/clickdrag/1n1e.png chases it with a butterfly net]. || || || || Remote controlled helicopter and remote &lt;br /&gt;
|-&lt;br /&gt;
| 457 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Boy with party hat with a strap under the chin. Around him lies confetti on the ground || This is one of the kids from the Malaria party in the referenced comic. The hat and the items on the ground are taken directly from the comic. || Comic: '''[[51: Malaria]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 458 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Ponytail sitting on the ground alone right leaning back on one hand, while the other hand rest on her bend knees || This is the second Ponytail to sit straight on the ground, the first being 185. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 459 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball is hanging in the air alone above a five tipped star drawn on the ground. There are five loose lines coming up from each corner of the star which seems to make Cueball float || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic? Seems like it would be taken from another comic?&amp;lt;/font&amp;gt; Cueball is floating in the air above a five pointed star (not quite a pentagram, no circle). It seems a very sinister scene. It is not possible to day if Cueball floats, falls or is being lifted. The lines from the star could indicate all three things. || || || || Star on the ground &lt;br /&gt;
|-&lt;br /&gt;
| 460 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Character with dark hair, maybe down the back, maybe short standing alone right || Could be either sex. The hair on the head does not look like Megan, and it is difficult to determine if the hair stops above or below the shoulders. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 461 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Boy with hair short black standing alone right arms up holding something in the arm to the left, maybe a ball || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: What is in his hand&amp;lt;/font&amp;gt; Clearly this is a kid holding some object, could be a ball he is about to pass? || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Ball?&amp;lt;/font&amp;gt; || &lt;br /&gt;
|-&lt;br /&gt;
| 462 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Woman with black ponytail standing alone left || This is not Ponytail as she has white hair. There is a similar woman in [[882: Significant]]. Later a girl looking very much like this was [http://www.explainxkcd.com/wiki/images/d/d0/Garden_Stilt_walker.png seen on stilts] in [[1663: Garden]]. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 463 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 464 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Guy with hat black beret and black beard only on his chin standing alone right smoking a pipe, smoke coming out and drifting up beginning with a round black cloud and then above two white clouds || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? Is he supposed to look French?&amp;lt;/font&amp;gt; There are some smoking pipe in xkcd (see for instance [[923: Strunk and White]]) but none with smoke like this and no only looking anything like this black beret guy. || || || || Pipe with smoke &lt;br /&gt;
|-&lt;br /&gt;
| 465 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Guy with hat black but much larger than Black Hats although similar shape, but soft in the middle standing alone right. A large wing is hanging out from the hat on the left side || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This winged hat seems to be related to the locomotive hat. There seems to be only one wing, and with the white ends it seems like it is feathers, although there is some bat wing over the drawing. Maybe a joke on the phrase ''{{w|A feather in your cap}}'' but no with an entire wing instead? || || || || Wing on hat &lt;br /&gt;
|-&lt;br /&gt;
| 466 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 467 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left with a large head and a camera or a mask held in front of his face with both hands || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this from a previous comic? Is it a big camera he is holding or a mask?&amp;lt;/font&amp;gt; Unclear what Cueball is holding in front of his head. The head seems rather large, maybe a drawing mistake due to the camera or mask he is holding up to his head? || || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Camrea or mask?&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 468 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 469 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 470 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Guy with beard, full, and black hair standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Does not look like guy with beard 73. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 471 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Guy with pumpkin face with slits for eyes and a curvy mouth standing alone right || This is one of the pumpkin men from the referenced comics 6th panel. || Comic: '''[[68: Five Thirty]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 472 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 473 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || There may be indication of thin hair, but could be a sloppy end to the circle of the head || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 474 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right while bending in the knees leaning over them back bend arms stretched out for balance || Could be that he is preparing to jump? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 475 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Boy looking like Cueball standing right seems like he is holding a branch in one end so it hangs out in the air to the right. At the end there is a split in two parts. || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a branch or a snake like in 404 and does it refer to a previous comic?&amp;lt;/font&amp;gt; This boy child (much shorter than regular Cueballs) seems to be holding a branch out, but it is not clear how he holds this or if it is a branch? See similar boy with snake 404. || || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Branch?&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 476 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 477 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 478 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Ponytail standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 479 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 480 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball running alone right towards something that gives off smoke with a sound. Seems like he is holding a bow and maybe he has just shot an arrow at the smoking object, the arrow missing hitting the ground with a sound || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? Quite unclear what happens here?&amp;lt;/font&amp;gt; Best guess is that something is being aimed at by Cueball's bow and arrow but he misses the target (he burns his shot) and the target burns releasing smoke while hissing. || || Smoking object: Ssss &amp;lt;br&amp;gt; Arrow: Thump || || Bow, arrow and smoking object &lt;br /&gt;
|-&lt;br /&gt;
| 481 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Woman with hair short black and with a bump in the neck standing alone left, seems short || This woman here looks short, maybe she is a kid? Her hair is short compared to Megan and there is a small hair bun like bump in the neck, but it does not really look like a hair bun and not at all like Hairbun. See also similar woman 447. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 482 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 483 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing right speaking to a butterfly that flies in front of him with two times two lines around the wings away from Cueball and one two times one line close to Cueball || This is a direct reference to the referenced comic where real programmers use butterflies and it turns out e-macs has a command that does this which begins with C-x as Cueball says, and then continues to give this sentence: ''C-x M-c M-butterfly.'' || Comic: '''[[378: Real Programmers]]''' || Cueball: C-x || Butterfly || &lt;br /&gt;
|-&lt;br /&gt;
| 484 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Megan standing alone right, rather long hair || This Megan does not look like Danish. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 485 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 486 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right || His face shape is a little squeezed at the top, so his head is not close to being round. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 487 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Blondie standing alone left || It is not a ponytail but long hair going down her back. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 488 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Hairy standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 489 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 490 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Boy looking like Cueball standing alone || Clearly a kid much smaller than Cueball normally is. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 491 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Guy with hair short white and spiky standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Seems a special type of hair, that has not been seen before in this comic. Not looking like similar described 412. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 492 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Megan standing right looking slightly down at Cueball with Boombox 493 || This is the named Megan from the referenced comic, hair even drawn a little different like in that comic. She listens to Cueball 492's music from his Boombox. || Comic: '''[[159: Boombox]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 493 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing left holding a playing boombox high up over his head in both hands, playing music for Megan 492 || This is Cueball with the boombox playing for Megan 492 from the referenced comic. The music playing is a reference to the title text, as it is not ''Ice Ice Baby''. || Comic: '''[[159: Boombox]]''' || Boombox: Under presssure || || Boombox &lt;br /&gt;
|-&lt;br /&gt;
| 494 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || WOPR (War Operation Plan Response) supercomputer, a box with a lid and a black line below this (looking like a Xerox machine) with its name written in front of the panel talking to Boy 495 || This is the sentient {{w|AI}} in the form of the WOPR (War Operation Plan Response) computer from the movie {{w|WarGames}} talking with a boy 495. The boy should then represent David played by {{w| Matthew Broderick}} (see also buy 495). It wants to play a game and in the movie this almost results in nuclear war where the only winning move is not to play. A similar AI has been featured in [[601: Game Theory]] where it analyzed love like the WOPR analyzed nuclear war. It determines that you always lose in love even if you say no to playing! This is the only one of the 1000 characters that has no human shape what so ever- But that it's an independent intelligence cannot be doubted, and hence it must be seen as one of the 1000 characters. || Movie: {{w|WarGames}} || WOPR: Would you like to play a game?&amp;lt;br&amp;gt;Boy 495: No.&amp;lt;br&amp;gt;On WOPR: WOPR || || WOPR (although not seen as an object here) &lt;br /&gt;
|-&lt;br /&gt;
| 495 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Boy looking like Cueball standing left talking with the WOPR 494 || If this is the boy from the movie {{w|WarGames}} talking with the WOPR (War Operation Plan Response) computer, then his name is David Lightman and he was played by {{w|Matthew Broderick}}. In the movie WOPR asks David he would like to play a game and they end of playing a game of Global Thermonuclear War which almost leads to this in real life. Either this is after so David is cleverer or it is another clever boy, because he simply declines the offer of the WOPR. He could also have played tic-tac-toe but then no one would win, but also no one would lose as shown here [[832: Tic-Tac-Toe]]. If he dared he could have played the strip version of Global Thermonuclear War as mentioned in the title text of [[696: Strip Games]]. || Movie: {{w|WarGames}} || || || &lt;br /&gt;
|-&lt;br /&gt;
| 496 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right looking up while throwing two objects into the air, one a round shape the other a snake shape || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic? What is it he throws?&amp;lt;/font&amp;gt; Cueball is throwing something into the air, not clear what or why. || || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Two objects thrown up?&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 497 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Woman with black hair and safety glasses standing alone right leaning back while holding an Erlenmeyer flask (a conical laboratory flask) up in the air in one outstretched hand || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Cueball is seen holding a similar flask up in [[520: Cuttlefish]]. || || || || Erlenmeyer flask &lt;br /&gt;
|-&lt;br /&gt;
| 498 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Boy looking like Cueball standing alone right || Clearly a kid much smaller than Cueball normally is. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 499 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Science Girl with Ponytail standing alone right arms held out from her body || This is the early version of Science Girl from [[585: Outreach]]. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 500 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Boy with hair like Hairy || Clearly a kid much smaller than Cueball normally is. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 501 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Girl with hair like Danish || Clearly a kid much smaller than the adult Danish. There is a whole group of kids here, see the previous three and 490 as well. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 502 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone looking right while holding a gun out in his arm to the left (where there is no one nearby) || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Cueball also holds a gun like this, but looking the same direction and pointing it on another Cueball in [[68: Five Thirty]].|| || || || Gun &lt;br /&gt;
|-&lt;br /&gt;
| 503 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone left looking down at a large gravestone on a big base. There are three patches of grass around the stone || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Gravestones has been used several times, also with this shape but not with Cueball standing in front of it. See [[584: Unsatisfied]], [[599: Apocalypse]] and [[736: Cemetery]]. || || || || Gravestone with grass around it &lt;br /&gt;
|-&lt;br /&gt;
| 504 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || Cueball standing alone right holding a trumpet up to his mouth with both hands blowing a flower out of the other end of the instrument || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic? Is it a trumpet or is it a large opening for a gun shooting the flower out?&amp;lt;/font&amp;gt; Seems like the items Cueball holds in front of him send a flower out, either when he blows into it, or fires it. Depending on if this is a trumpet or a gun? || || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Trumpet or gun with flower?&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 505 || [http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T] || [[Black Hat]] standing alone left || This is the first time Black Hat appears, here with a little wider hat than usual. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 506 || '''[http://www.explainxkcd.com/wiki/images/e/ea/1000_Comics_-_The_second_zero_in_thousand_Top_with_numbers.png Zero 2 T]''' || Hairy running alone left with his arms up || This is the '''last character in the second zero top''', this time not a Cueball but a running Hairy. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 507 || '''[http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R]''' || Cueball standing alone left with a head that seems more egg shaped, with the tip up || This is the '''first character in the first second right''' - again a Cueball, but one of those with a peculiar shaped head. Here the head is more egg shaped. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 508 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Astronaut in a spacesuit standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; A spacesuit, which there seems to be no one of in the first 1000 comics? || || || || Spacesuit &lt;br /&gt;
|-&lt;br /&gt;
| 509 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 510 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Ponytail sitting on the ground alone right leaning back on one hand, while the other hand is resting on her knee which is lifted up, the other leg also bend but less. Seems like the ground is rough beneath her, and both one arm and one leg seems to rest on small rocks || This is the third Ponytail to sit straight on the ground, the first being 185. || || || || Rocks on rough ground &lt;br /&gt;
|-&lt;br /&gt;
| 511 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Skeleton walking right towards Cueball 512 with his sword and Megan 514. The bones are clearly not joined together, the black eye sockets almost protruding from the skull. It has its arms held out || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; Seems like Cueball 512 is facing this skeleton with his sword in a valiant attempt to defend Megan 514 who’s looking on the skeleton. The idea of being able to fight a skeleton is mentioned in the title text of [[1587: Food Rule]]. It could be a coincidence as they are not very close. There seems to be no skeletons drawn in the first 1000 comics? Even though this is not a living creature (but an undead) it is obviously counted as one of the 1000 characters. || || || || Skeleton (although not seen as an object here) &lt;br /&gt;
|-&lt;br /&gt;
| 512 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing left brandishing a sword behind him to the right as he faces the skeleton 511 walking towards him with its arms out. Maybe he protects Megan 514 || It could look like Cueball is waiting to take a swing with his sword at the skeleton 511 walking his way with its arms out, a valiant attempt to defend Megan 514 looking on the scene. The idea of being able to fight a skeleton is mentioned in the title text of [[1587: Food Rule]]. It could be a coincidence as they are not very close. Seems like Cueball only holds a sword in [[68: Five Thirty]], but it doesn't really look like that sword. || || || || Sword &lt;br /&gt;
|-&lt;br /&gt;
| 513 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Woman with hair long and white standing alone right arms out. Seems like some sort of very long ponytail hangs down below her waist || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? What's with the hair down the back?&amp;lt;/font&amp;gt; The &amp;quot;ponytail&amp;quot; down to below her waist seems strangely shaped, very thin and uneven. Could also be some sort of scarf, as there is a large black area around the neck, which could also just be hair? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 514 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Megan standing left looking up at skeleton 511, being protected by sword Cueball 512 || Megan seems to be part of the skeleton 511 vs. Cueball 512 scene. Maybe Cueball is defending her from the walking skeleton with his sword. It could be a coincidence as they are not very close. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 515 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball is abducted by an alien spacecraft looking like the typical flying saucer. It is sucking him up in a tractor-beam while he hangs suspended arms out and one leg bend || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; This is a reference of a typical alien abduction where a {{w|flying saucer}} uses a {{w|tractor beam}} to suck a human (Cueball) up into the space craft for further investigation and [https://vimeo.com/107376483insertion of anal probes] etc. Or just for practice - see [https://www.youtube.com/watch?v=zkYcK3z5Go4 Lifted]. Seems like there are no flying saucers in the first 1000 comics? Could be that Cueball 522 sees this scene and reacts by taking his hand to his mouth? The spaceship is not seen as an individual character, as it is not alive or conscious (like the AI in the WORP 494). || Other: {{w|Alien abduction}} || || || Flying saucer using tractor beam &lt;br /&gt;
|-&lt;br /&gt;
| 516 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Guy with hair only around the neck standing right maybe towards science Girl 519 || This could be Donald Knuth from [[342: 1337: Part 2]] or George from [[587: Crime Scene]]. The hair is the same. The first Guy with hair like this was 75. Although the appearance of the girl 519 he may be facing is that of Science Girl, there are some similarities with her and [[Elaine Roberts]] as she appears together with Donald Knuth in the mentioned comic... || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 517 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Ponytail standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 518 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 519 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Science Girl with bun and ponytail, standard appearance, standing left maybe towards Guy 516 || Although this is the standard appearance of Science Girl she may be facing Guy 516 which may be Donald Knuth from [[342: 1337: Part 2]] . In that comic [[Elaine Roberts]] is as a young girl drawn with ponytail (white though) so there are some similarities between a scene in that comic. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 520 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Boy looking like Cueball with arms out standing right towards Cueball 521 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Clearly a kid much smaller than Cueball normally is. Seems like he is explaining something to Cueball 521 who scratches his head for that reason. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 521 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing left scratching his head with a small black cloud(?) over his head as he tries to understand what the boy 520 is showing him || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Cueball is reacting to the boy showing him something, scratching his head. The black cloud over his head may indicate that he doesn't comprehend what the boy wishes to show him or that he does but is dismayed. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 522 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing right looking up, hand to his mouth, maybe because he sees the alien abduction of Cueball 515 above him? || Could look like he was reacting to the alien abduction scene 515 as he looks that way and has his hand to his mouth. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 523 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone right looking at something he holds in his hand lifted up in front of his face something small and slim like a smartphone || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a smartphone in his hand or something else?&amp;lt;/font&amp;gt; Could be that Cueball holds a smartphone, but it is not clear. Cueball in [[864: Flying Cars]] also holds a smartphone but not in the same position as this Cueball. That was more the case for Cueball 335. || || || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Smartphone?&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 524 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Old man with a white hat (looking a bit like a beret, but could also a sailor cap seen from the front) and a cane standing alone left || This is not an old version of Beret Guy but the old version of Cueball from the referenced comic, as he would look if he turned and stared straight out of the panel. The cap at on his sailor hat would then look like the middle part of the hat does here, which makes it look like Beret Guy’s beret. The cane and the wrinkles that match those from the comic, is helping prove this. || Comic: '''[[572: Together]]''' || || || Cane &lt;br /&gt;
|-&lt;br /&gt;
| 525 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 526 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Hairy standing alone left with high hair and long face || A little strange head and hair shape, but still Hairy like. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 527 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing left talking to the ants in the ant hill by his feet || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Cueball is thankful to the ants. There have been many mentions of ants in xkcd, but not seem to fit this picture. See for instance the later comic [[1610: Fire Ants]], but also the much referenced comic [[68: Five Thirty]] has an ant in the last panel. A [http://www.explainxkcd.com/wiki/images/d/d2/1608_1078x1095y_Ant_Queen_in_Destroyer.png giant ant queen] was inside the Destroyer in [[1608: Hoverboard]]. || || Cueball: Thanks ants || Ants || Ant hill &lt;br /&gt;
|-&lt;br /&gt;
| 528 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 529 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 530 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 531 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Guy with black hair and a bald patch on the top of his head standing alone right || Seems like there is no hair on the top of the head. Could be a drawing mistake but else it is either a bald patch, or it is supposed to be some head gear going around his head? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 532 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 533 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Hairy standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 534 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 535 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 536 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Hairy standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 537 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing right towards boy 538 holding a large axe in both hands with the head towards the boy || This Cueball interacts with the buy 538, which again is a reference to the boy being an {{w|troll (internet)|internet troll}} that was slain in the referenced comic. Although there it was not as a real life {{w|troll}}, and not by an axe. See more on 538. || Comic: '''[[591: Troll Slayer]]''' || || || Axe &lt;br /&gt;
|-&lt;br /&gt;
| 538 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Boy with hair and lots of pimples standing left facing the axe wielding Cueball 537 || This is the pimpled boy that {{w|troll (internet)|trolls}} {{w|Stephenie Meyer}} in the referenced comic. She then slays him using her {{w|Twilight (novel series)|Twilight novels}} as her weapon of choice. Given that it is the boy who is the troll slain, it makes sense here to put this little boy in front of a Cueball 537 with an axe big enough to slay real {{w|trolls}}. || Comic: '''[[591: Troll Slayer]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 539 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Hairy standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 540 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Megan standing alone right hair blowing out behind her || Seems like this Megan has the wind in her face her hair billowing out behind her. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 541 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball spinning around on one leg facing right alone doing a pirouette with arms held together over his head one leg up and bend close to his body and three circle lines left and right of his body and around the leg that supports him || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Cueball is performing a {{w|Turn_(dance_and_gymnastics)#Pirouette|pirouette}}. It is not similar to the scene in [[162: Angular Momentum]] referenced by spinning Megan 159. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 542 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 543 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 544 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Girl sleeping drawn in silhouette alone with her head to the left snoring as indicated with a sound || This drawing can be a little confusing since the end of it, is very close to guy 545's face and could even be seen as smoke coming from him. But the snoring sound gives it away as the [[7#Trivia|very first drawing]] Randall released on the [[:Category:First_day_on_LiveJournal|very first day]] of releasing comics on [[LiveJournal]] from [[:Category:Comics posted on livejournal|before]] he began posting on xkcd.com (where it then got number 7 for some reason?) So of course it should be included in this comic. Given that she is not even closely related to the stick figures constituting the rest of the 1000 characters she had to be drawn like this in silhouette to make her blend in. But it would be easy to misinterpret the drawing, but the three ''zzz'' helps a lot. Those were not included in the original drawing. The comic that later received the number 1 spot on xkcd is also here as Barrel Boy 643 at the bottom in the same side of this zero. || Comic: '''[[7: Girl sleeping (Sketch -- 11th grade Spanish class)]]''' || Girl: Zzz || || &lt;br /&gt;
|-&lt;br /&gt;
| 545 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Guy with hat black, high and round standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This is clearly not Black Hat (as the next character 546) as the hat is not square but rounded and higher. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 546 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Black Hat standing alone, with a more massive hat than usual || Although this must be described as Black Hat, as opposed to the guy 545 before this with a rounded black hat, the hat seems more massive broader and higher than the usual style of Black Hat. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 547 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball hanging alone left in one arm from the string of a white balloon rising up. That he is up in the air is indicated with a shadow on the &amp;quot;ground&amp;quot; beneath him || There seems to be no direct reference to a comic with such a Cueball, although a Cueball like kid is lifted in a balloon string, but not by the balloon, in [[121: Balloon]]. It more resembles the opening frame in [[1110: Click and Drag]], but that was first released more than eight months later (and the balloon there was black). || || || || Balloon on a string &lt;br /&gt;
|-&lt;br /&gt;
| 548 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Megan standing right towards Cueball 549 on stilts || It is not clear if she is with Cueball 548, but they are very close and she looks straight at him. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 549 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball walking on stilts towards left while looking right. The stilts are broader at the ground. He may be together with Megan 548 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; It seems like Megan 548 is looking at him, but it is unclear if they belong together. There also seems to be no comic with Cueball walking on stilts like this, but in [[482: Height]] there is a Cueball walking on the world’s tallest stilts. Much later two game comics showed persons on stilts, [http://www.explainxkcd.com/wiki/images/8/89/1608_1038x1095y_Hamsterball_and_stilts_room.png inside] the Destroyer in [[1608: Hoverboard]] and as a [http://www.explainxkcd.com/wiki/images/0/0c/1663_garden_One_color_Between_Light_yellow_and_yellow_First_thing_stilts.png grown item] in [[1663: Garden]]. || || || || Stilts &lt;br /&gt;
|-&lt;br /&gt;
| 550 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Guy with hat black peaked cap standing alone right || Looks like one of the often occurring police officers usually drawn with a black peaked cap, a police cap. Mostly these caps are though also drawn with a white emblem, but that might have been too small here. See for instance [[617: Understocked]]. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 551 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing right towards woman 552 || Seems like he is facing woman 552. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 552 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Woman with white hair long and loose, could be Blondie but might be in a ponytail, standing left towards Cueball 551 || It could be both Blondie and Ponytail, but at first it looks like long white hair that hangs loose down her back. She seems to be facing Cueball 552. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 553 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Woman with white hair in a bun with a ponytail below it standing alone left || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This is not a standard hairstyle in xkcd. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 554 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 555 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 556 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Megan driving left on a Segway alone, three lines behind her indicates her motion and speed also clear as her hair flows somewhat back || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Megan drives a {{w|Segway PT}}. There seems to be no comics where this happens, but Segway is referenced both in the description of people who likes the {{w|Dymaxion map|Dymaxion projection}} in [[977: Map Projections]] as well as in the title text of [[296: Tony Hawk]]. || || || || Segway PT} &lt;br /&gt;
|-&lt;br /&gt;
| 557 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Guy with hat baseball cap standing with Cueball 558 both looking right || There are not many wearing baseball caps in xkcd. There was on in the background of [[954: Chin-Up Bar]]. One was shown long after in [[1221: Nomenclature]], it could almost be those two from that comic that this guy and Cueball 557 should represent, but the other guy is also wearing a hat in the comic. Also it cannot be a reference as it is a later comic. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 558 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing with Guy 557 both looking right || Seems like he may be watching something together with baseball cap guy 557. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 559 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone arms up || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 560 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone right holding an octopus out in one arm || This is the biologist from the referenced comic. || Comic: '''[[435: Purity]]''' || || Octopus || &lt;br /&gt;
|-&lt;br /&gt;
| 561 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 562 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball driving left on an electric skateboard having the radio control remote in his hand. Behind him are three lines next to the antenna of the control (and there are no wires) so this is either indication of speed or radio waves. The skateboard is driving slightly downwards and Cueball stand still on the middle. The two next &amp;quot;girls&amp;quot; 563-564 are running after him || This is a clear reference to the referenced comic. The [:[Category:Electric skateboard|electric skateboard]] here (a recurring theme in xkcd) seems to have radio control, as there is no wire to the board as in the comic. But the two &amp;quot;girls&amp;quot; 563-564 running after him is two of the three chicks in the comic that cheered Cueball when he got to his destination. || Comic: '''[[139: I Have Owned Two Electric Skateboards]]''' || || || Electric Skateboard &lt;br /&gt;
|-&lt;br /&gt;
| 563 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Ponytail running left after Cueball 562 and his skateboard || Ponytail is running, together with Megan 564, after Cueball 562 because he is so cool with his electric skateboard, a clear reference to the comic where both &amp;quot;girls&amp;quot; also admire Cueball on his gadget. || Comic: '''[[139: I Have Owned Two Electric Skateboards]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 564 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Megan running left after Cueball 562 and his skateboard || Megan is running, together with Ponytail 563, after Cueball 562 because he is so cool with his electric skateboard, a clear reference to the comic where both &amp;quot;girls&amp;quot; also admire Cueball on his gadget. || Comic: '''[[139: I Have Owned Two Electric Skateboards]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 565 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Guy with Afro hairdo normal size standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; A more normal Afro hair than on 236, like 248. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 566 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Megan standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 567 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 568 || [http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R] || Hairbun with sunglasses standing alone left || This is how {{w|Trinity (The Matrix)|Trinity}} from {{w|The Matrix)} is drawn in the referenced comic. First guy with sunglasses see 35. || Comic: [[566: Matrix Revisited]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 569 || '''[http://www.explainxkcd.com/wiki/images/f/fe/1000_Comics_-_The_second_zero_in_thousand_Right_with_numbers.png Zero 2 R]''' || Cueball standing alone right || This is the '''last character in the second zero right''', and again a Cueball. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 570 || '''[http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B]''' || Guy with extremely spiky hair standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This is the '''first character in the second zero bottom''', for once an unnamed character. This hair reminds of some kind of {{w|Punk fashion}}. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 571 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing right towards Cueball 572 || Seems like he is looking at Cueball 572. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 572 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing left towards Cueball 571 || Seems like he is looking at Cueball 571. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 573 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 574 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone right holding one arm slightly out right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 575 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone left arms a little of balance bending in one leg || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 576 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball falling headfirst down alone left while flailing with his arms and legs as indicated with two lines on either side, and four lines above him indicate the speed of the fall || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 577 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 578 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Guy with hair in a Mohawk standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; This guy seems to sport a {{w|Mohawk hairstyle|Mohawk}}. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 579 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Hairy standing alone left || This Hairy has flat hair. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 580 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Girl with long black hair standing alone right holding her arms up || Clearly a girl much shorter than the adults around her. Hari style could be like Megan’s, but it's hard to see for the raised arms || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 581 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone doing the arm wave || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Cueball is doing the [https://www.youtube.com/watch?v=6CPtOe3GVwk arm wave], hip-hop style… || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 582 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Ponytail standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 583 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 584 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 585 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Science Girl with small bun at the base of her neck and hair hanging down behind it standing alone right holding up a model rocket in one hand || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; There seems to be no comics where anyone holds up such a rocket. It is the standard version of a rocket that can be used for space launch. || || || || Model rocket &lt;br /&gt;
|-&lt;br /&gt;
| 586 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Character with short dark hair standing alone right || Could be either sex, see also similar characters at 433. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 587 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 588 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Woman with a ponytail dark standing right looking at Genie 589 || Seems like this woman has just rubbed the lamp of the Genie 589 and is now ready to make a wish. A similar {{w|genie}} was drawn in the referenced comic, although together with Cueball. Genies have been mentioned several times in xkcd, see more in the referenced comic. See also woman 157 with dark ponytail. || Comic: '''[[152: Hamster Ball]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 589 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Genie rising smoke like out of an oil lamp standing on the ground facing left towards Woman 588. The genies body materializes out of the smoke getting more solid from the waist up. It has its arms held into its sides. On its head it has a turban. || It seems that woman 588 has just rubbed the lamp from where the Genie protrudes and it now ready to fulfill her wishes. A similar {{w|genie}} was drawn in the referenced comic, although together with Cueball. Genies have been mentioned several times in xkcd, see more in the referenced comic. In the referenced comic Cueball wishes for a hamster ball, and gets one. See Cueball 618 inside his hamster ball just below and left of here. || Comic: '''[[152: Hamster Ball]]''' || || || Oil lamp &lt;br /&gt;
|-&lt;br /&gt;
| 590 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing right towards Megan 591 with a white heart floating between them || A couple in love as indicated with the heart between Cueball and Megan 591. See also similar Hairy/Megan couple 210-211. || || Cueball/Megan: ♥ || || &lt;br /&gt;
|-&lt;br /&gt;
| 591 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Megan standing left towards Cueball with a white heart floating between them || A couple in love as indicated with the heart between Megan and Cueball 590. See also similar Hairy/Megan couple 210-211. || || Cueball/Megan: ♥ || || &lt;br /&gt;
|-&lt;br /&gt;
| 592 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing right towards Ponytail 593 || Seems like Cueball faces Ponytail 593. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 593 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Ponytail standing left towards Cueball 592 || Seems like Ponytail faces Cueball 592. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 594 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball running right towards Cueball 595 holding a long stick in both hands over his head. Towards the end of the stick there is a broader part of the stick, but at the very end it is again as thin as the rest of the stick || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Cueball seems to be in the process of attacking Cueball 595 with some kind of weapon. But it neither seems like a spear or an axe with the protrusion on the stick he is wielding neither looking like an axe head or it at the tip like on a spear? || || || || Stick with protrusion at one end &lt;br /&gt;
|-&lt;br /&gt;
| 595 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing left towards charging Cueball 594 || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Seems like Cueball 594 is in the process of attacking this Cueball with some kind of weapon. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 596 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Hairy standing alone left with very thin hair || This Hairy has thin but not flat hair || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 597 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball lying down on his back alone left resting on one arm behind him, the other arm down along his body one leg bent a lot the other only slightly at the knees || The second character that lies down on the ground. See the first Cueball 105 to do so. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 598 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 599 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Hairy standing alone right || He may be looking at Hamster Ball Cueball 618 - as all other in front of him in this general area looks at it. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 600 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone right || He may be looking at Hamster Ball Cueball 618 - as all other around him in this general area looks at it. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 601 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone right || He may be looking at Hamster Ball Cueball 618 - as all other around him in this general area looks at it. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 602 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || [[Rob]] sitting alone right legs curled up to his body arms holding tight around them || This is [[Rob]] from the referenced comic after his nephew has scared him with his fact of life. This is the third Cueball-like character sitting on the ground, the first being 375. || Comic: '''[[647: Scary]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 603 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Megan with her hair falling backwards alone right. She seems to have lost the balance, having only one leg on the ground the other up in the air and bendy leaning far behind the leg on the ground. The arms seem to be flailing up and down so fast that three arms are drawn on either side. The hair is also standing up || This is Megan from the referenced comic after the LSD she has been given makes her believe that there are spiders all over her. The three arms on either side because of her flailing arms make this connection clear. || Comic: '''[[790: Control]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 604 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone right eating an ice cream cone || Seems like Cueball never eats an ice cream cone in the first 1000 comic but his daughter Science Girl does so next to him in [[585: Outreach]]. || || || || Ice cream cone &lt;br /&gt;
|-&lt;br /&gt;
| 605 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Hairbun standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 606 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing right facing a finger gun assault by Hairy 607 || Seems he is being finger gun attacked by Hairy 607. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 607 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Hairy standing left brandishing two finger guns, one pointed at Cueball 606 the other held up in the air || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Hairy has shaped both his hands into finger guns (which is thus one of the rare occasion where hands are shown). He seems to be pointing one of the hand guns towards Cueball 606. || Other: {{w|Finger gun}} || || || &lt;br /&gt;
|-&lt;br /&gt;
| 608 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Guy with hair only around the neck standing alone left something black under one hand || This could be Donald Knuth from [[342: 1337: Part 2]] or George from [[587: Crime Scene]]. The hair is the same. See Guy 75, the first with this type of hair. The black dot under his hand seems to be a drawing mistake? || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 609 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 610 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Megan standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 611 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 612 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing right towards Ponytail 611 brandishing a lightsaber pointed up towards her || Seems like Cueball threatens Ponytail 613 with his {{w|lightsaber}}. This is a general reference to the {{w|Star Wars}} universe which is a recurrent topic on xkcd. Lightsabers are often referenced and drawn, but there is not really a particular scene that looks like this. Most closely comes the look of the lightsaber in the 6th comic from [[Five-Minute Comics: Part 4]] which was published by mistake. Also in one of the intentionally published comics in that series, [[820: Five-Minute Comics: Part 2]], are there lightsabers. Just three weeks prior to this comic a toy lightsaber was held by Cueball in [[991: Phantom Menace]]. Later a comic named after the weapon was published in [[1433: Lightsaber]] and they were displayed more than once in [[1608: Hoverboard]], both [http://www.explainxkcd.com/wiki/images/b/bc/1608_1012x1078y_Bridge_on_the_Rebel_Blockade_Runner.png with Ponytail] and [http://www.explainxkcd.com/wiki/images/2/20/1608_1006x1095y_Pinata_and_Cueball_with_lightsaber_at_top_of_hull.png with a kid] looking like Cueball. || Category: [[:Category:Star Wars|Star Wars]] || || || Lightsaber &lt;br /&gt;
|-&lt;br /&gt;
| 613 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Ponytail standing left towards Cueball 612 and his lightsaber || Seems like she is being threatened by Cueball 612 and his lightsaber. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 614 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball driving a motorcycle alone right doing a wheelie, two movement lines at the back wheel showing the progress || This is the {{w|Linux}} using Cueball from the referenced comic doing his {{w|wheelie}} stunt from the comic. || Comic: '''[[272: Linux User at Best Buy]]''' || || || Motorcycle &lt;br /&gt;
|-&lt;br /&gt;
| 615 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Megan standing right towards Cueball 616 pointing at him as he walks away || Seems like this Megan might be accusing Cueball 616 of something and he just walks away from her. Could also be that she points at Hamster Ball Cueball 618 - as all those behind her in this general area looks at it. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 616 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball walking right away from pointing Megan 615 || Seems like he is walking away from Megan 615 who points after him like she is accusing him of something. Could also just be that after being alerted to it by Megan pointing it out he walks towards at Hamster Ball Cueball 618 - as all other behind him in this general area looks at it. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 617 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Ponytail standing right touching Cueball 618's hamster ball || Ponytail is either pushing, holding back or holding on to the hamster ball. See interpretations and details at Cueball 618. || Category: [[:Category:Hamster Ball|Hamster Ball]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 618 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing right inside a large hamster ball waving his arm to the left up and down indicated with two lines above and below. He also waves his other arm forward right indicated with two small lines. The hamster ball is surrounded by characters 617-621 interacting with the ball || This is by far the most complex scene in the entire comic. Hamster balls is a recurring theme in xkcd, see the referenced category, and was first featured in [[152: Hamster Ball]], where a genie delivers such a ball to Cueball as it is his one and only wish. That genie can be seen in 589. But this scene has some similarities also with [[211: Hamster Ball Heist]] where a rock-star (not Cueball) is being pushed around inside a hamster ball by several people like here, (but against his will, so it is not a direct reference that comic either). The four characters around this ball, Ponytail 617 left, Woman with black hair 619 on top, Megan 620 floating right and Cueball 621 lying to the right, are all interacting with it. There may be several other characters that &amp;quot;see&amp;quot; this scene, like Megan 615 that might point at this (rather than Cueball 616, who might walk towards it). And on the other side Megan 622 may also be looking on as does Cueball 623. Similarly Cueball 600 and 601 also looks that way as does Hairy 599 but he is quite far away, but all in that direction look towards the ball. It is hard to say exactly what happens with the ball, as it seems to stand still (no movement lines). But this can hardly be the case as Ponytail 617 seems to push (could be holding on), the woman 619 on top of the ball seems to walk left forcing the ball right, and Cueball 621 seems to have been knocked over by the ball. Megan 620 is the mystery as she seems to float/fly near the hamster ball. Of course if Ponytail tries to hold it, and Cueball inside is showing to stop and they have just hit Cueball 621 the hamster ball may just have stopped at this very moment. Another possible interpretation, where the ball is moving right, is that the three women respectively tries to get up, is on top and has been on top. So Ponytail will hold on to the ball, being dragged up as the ball moves, while the woman on top moves the ball and eventually she will, like Megan has just done, fall down the right side, this would mean that Megan is now falling towards Cueball. He could also just have fallen off like this, but as he holds on to his face it seems more like he has been hit in the face by the moving ball and knocked back on the ground. || Category: [[:Category:Hamster Ball|Hamster Ball]] || || || Hamster ball &lt;br /&gt;
|-&lt;br /&gt;
| 619 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Woman with hair black and large on top of her head walking left on top of Cueball 618's hamster ball while looking down while holding her arms back, the right arm mainly hidden behind her &amp;quot;high&amp;quot; hair, only the hand can be seen to the right of the hair || This woman may have a hair bun, but it is hard to tell and she does not at all look like Hairbun. She seems to be walking left on the hamster ball which would be meaningful if it moved right, and she might thus stay on top, maybe even helping with moving the ball that way. See interpretations and details at Cueball 618. || Category: [[:Category:Hamster Ball|Hamster Ball]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 620 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Megan falling, floating or flying face towards left looking down along the side of Cueball 6187's hamster ball. One leg bent at the knee || Megan is either one of those that flies come the see what the fuss is about, or rather she has just been on top of the hamster ball like woman 619 and has just fallen off on the way down to hit Cueball 621. See interpretations and details at Cueball 618. || Category: [[:Category:Hamster Ball|Hamster Ball]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 621 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball lying on his back towards right face towards left supporting himself on one arm behind him and holding the other hand to his face looking up at Cueball 618's hamster ball looming over him. One leg is stretched the other bend at right angle at the knee || Cueball seems to have been knocked over by the hamster ball although it is unclear if it rolls. If so he seems to have taken a hit in the face seeing as he holds a hand up to it. He may also have fallen off from on top of the ball. See interpretations and details at Cueball 618. || Category: [[:Category:Hamster Ball|Hamster Ball]] || || || &lt;br /&gt;
|-&lt;br /&gt;
| 622 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Megan standing left looking at Cueball 618's hamster ball || This Megan has looser hair on her head than normally. It seems like she is looking at the hamster ball scene at Cueball 618. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 623 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing left looking at Cueball 618's hamster ball || Cueball seems to be looking at the hamster ball scene at Cueball 618. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 624 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Guy with hat with two tassels or horns and a full beard standing alone right || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic? And what kind of hat is this? In relation to the locomotive hat it could also be a hat showing a ship with two chimneys sinking...?&amp;lt;/font&amp;gt; A guy with a strange hat that either has two tassels or two horns. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 625 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone right || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 626 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Guy with hair only around the neck standing alone right - hair seems to be quite thick || Although the hair is of the same type as Guy 75 he does not really look like him as the hair seems much thicker and further out from the neck. Had it not been because of the stance makes it clear that he faces right, then it could even look like some kind of googles... || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 627 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Woman with long hair like Megan but thinner standing alone left or maybe looking at all the black hats on Black Hat 641 below her || This woman’s hair has a white section in front, so although similar hair as Megan, it does not seem to be quite like her. She may be looking down at the black hats of Black Hat 641. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 628 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Ponytail standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 629 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Guy with a long cloak below his Cueball like head standing right looking at Cueball throwing boomerang || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is it a character from a previous comic?&amp;lt;/font&amp;gt; There seems to be some resemblance to a Jedi Knight like Obi-Wan Kenobi, the thought could be lead this direction with the lightsaber at Cueball 612 just above to the right. He may represent a coach for the boomerang throwing Cueball 630 next to him, who has been shown before to not be very good with boomerangs. Acting as a mentor for Luke Skywalkers lightsaber training was Kenobi’s task in Star Wars. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 630 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball throwing a boomerang to the right so it rotates as indicated by a curling line. Two other lines show how he has swung his arm. Seems like the guy in cloak 629 is looking on || Cueball has been shown to be quite hopeless in throwing boomerangs as has been shown in the referenced comic and its sequel, and boomerangs are a [[:Category:Boomerangs|recurring theme]] in xkcd. In this situation it seems like the cloaked guy 629 is supervising his throw. Maybe he is a mentor, looking a little like a Jedi knight form Star Wars, see interpretation at 629. || Comic: '''[[445: I Am Not Good with Boomerangs]]''' || || || Boomerang &lt;br /&gt;
|-&lt;br /&gt;
| 631 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone right looking up || This Cueball is particularly not looking in the direction of Cueball 618 and his hamster ball to his right. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 632 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone left || This Cueball looks away from the nearby hamster ball at Cueball 618. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 633 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || {{w|Lucy van Pelt|Lucy}}, from Peanuts drawn like Megan, standing right towards Charlie Brown 634 offering him an American football || This is a reference to the comic strip ''{{w|Peanuts}},'' and the running gag where Lucy (drawn here as Megan) would hold the {{w|American football}} for lovable loser Charlie Brown, with his single hair on his head, thus drawn like Cueball with one hair in 634. He 'd come running at it full speed, only to have Lucy pull the football away at the last moment and send Charlie Brown crashing to the ground. This repeating scene was referenced in the title text of [[423: Finish Line]] || Carton: {{w|Peanuts}} || || || American football &lt;br /&gt;
|-&lt;br /&gt;
| 634 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || {{w|Charlie Brown}}, from Peanuts drawn like Cueball with a single hair, standing left towards Lucy 633 offering him an American football || This Cueball's single hair together with the ball offered by Lucy 633 makes it clear that this is the Charlie Brown. See more in 633 || Carton: {{w|Peanuts}} || || || &lt;br /&gt;
|-&lt;br /&gt;
| 635 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Megan standing towards right, right up against a very thin sheet of material that Ponytail 636 holds up between them || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic?&amp;lt;/font&amp;gt; Seems like Megan’s forehead touches the thin sheet of material Ponytail 636 holds up between them. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 636 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Ponytail standing towards left holding a very thin sheet of material up in both hands between her and Megan 635 who stands flush up against this. She speaks an almost unreadable line || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Is this a scene from a previous comic? What is it she holds up, and what does she say&amp;lt;/font&amp;gt; Ponytail holds some very thin sheet of material up between her and Megan 636. || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text:Ponytail: Rach????&amp;lt;/font&amp;gt; || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text:Thin sheet of material?&amp;lt;/font&amp;gt; &lt;br /&gt;
|-&lt;br /&gt;
| 637 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball with a square head standing alone right || This Cueball is drawn with a perfectly square face. This is related to the Cueball with a triangular face || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 638 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Guy with sunglasses and no hair standing right || First guy with sunglasses see 35. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 639 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing right towards Black Hat 641 with many hats || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 640 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing right towards Black Hat 641 with many hats, seems short || This Cueball here looks short, maybe he is a kid? Could also be a Black Hat that has just lost his hat to Black Hat 641 who seems to be stealing Black Hats. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 641 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Black Hat standing left towards Cueball 639 and 640 with no less than seven black hats balancing on top of his head and each other. Maybe woman 627 is looking down at his hats || This is a continuation of the scene from the referenced comic, where Black Hat meets another Black Hat but one with two hats. Solo Black Hat then retraces his steps away from this dangerous double Black Hat as if he just realized that his hat might soon be the third on top of the two other black hats. There is also another double Black Hat in this comic, but this one has already acquired five more than that so there are six ore hats than a normal Black Hat, seven in total. This may explain why there are so many Cueballs and so few Black Hats in this comic, since at least five, maybe six have lost their hat to this guy (and if six, then also seven with the other two hat guy). The two Cueball's looking at him 639-640 may have been Black Hat's a moment ago, when this one only had five hats... || Comic: '''[[455: Hats]]''' || || || &lt;br /&gt;
|-&lt;br /&gt;
| 642 || [http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B] || Cueball standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 643 || '''[http://www.explainxkcd.com/wiki/images/e/e1/1000_Comics_-_The_second_zero_in_thousand_Bottom_with_numbers.png Zero 2 B]''' || [[:Category:Barrel|Barrel Boy]] sitting in his barrel on the ocean with the horizon behind him || This is the '''last character in the second zero bottom'''. This drawing is of the Barrel Boy from comic no. 1 on xkcd, the first in the [[:Category:Barrel|Barrels series]]. Originally it was the [[1#Trivia|fifth drawing]] Randall released on the [[:Category:First_day_on_LiveJournal|very first day]] of releasing comics on [[LiveJournal]] from [[:Category:Comics posted on livejournal|before]] he began posting on xkcd.com (where it then was moved to number 1, for good reason, as it is a perfect little story of the unpredictability of life and also constitutes a series. So of course he should be included in this comic. Given that he is not even closely related to the stick figures constituting the rest of the 1000 characters he had to be drawn like this without his eyes. The very first comic to be released, now [[7|number 7]], is also here as sleepy girl 544 further up in the same side of this zero. || Comic: '''[[1: Barrel - Part 1]]''' || || || Barrel in an ocean &lt;br /&gt;
|-&lt;br /&gt;
| 644 || '''[http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L]''' || Cueball standing right towards Hairy 645 || This is the '''first character in the second zero left'', again it is a Cueball. He seems to be facing Hairy 645 || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 645 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || Hairy standing left towards Cueball 644 || This Hairy has thick hair and seems to be facing Cueball 644. || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 646 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || Megan standing alone left || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 647 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 648 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 649 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 650 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 651 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 652 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 653 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] ||Ponytail is standing right holding up a hairy guy with spots, 654, with her ray gun || This is Joanna from the referenced comic that are ready to ban the poor guy 654 from the internet. || Comic '''[[322: Pix Plz]]''' || || || Ray gun for melting computers&lt;br /&gt;
|-&lt;br /&gt;
| 654 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 655 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] ||[[Cueball]] is holding a sign with the number 101 on it, most likely a binary number. || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 656 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 657 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 658 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 659 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 660 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 661 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 662 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 663 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 664 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 665 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 666 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 667 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 668 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 669 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 670 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 671 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 672 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 673 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 674 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 675 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 676 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 677 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 678 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 679 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 680 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 681 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 682 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 683 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 684 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 685 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 686 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 687 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 688 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 689 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 690 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 691 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 692 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 693 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 694 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 695 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 696 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 697 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 698 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 699 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 700 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 701 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 702 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 703 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 704 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 705 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 706 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 707 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 708 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 709 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 710 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 711 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 712 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 713 || [http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 714 || '''[http://www.explainxkcd.com/wiki/images/2/2d/1000_Comics_-_The_second_zero_in_thousand_Left_with_numbers.png Zero 2 L]''' || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 715 || '''[http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T]''' || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 716 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 717 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 718 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 719 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 720 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 721 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 722 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 723 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 724 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 725 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 726 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 727 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 728 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 729 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 730 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 731 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 732 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 733 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 734 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 735 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 736 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 737 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 738 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 739 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 740 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 741 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 742 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 743 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 744 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 745 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 746 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 747 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 748 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 749 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 750 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 751 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 752 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 753 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 754 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 755 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 756 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 757 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 758 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 759 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 760 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 761 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 762 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 763 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 764 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 765 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 766 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 767 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 768 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 769 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 770 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 771 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 772 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 773 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 774 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 775 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 776 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 777 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 778 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 779 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 780 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 781 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 782 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 783 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 784 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 785 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 786 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 787 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 788 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 789 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 790 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 791 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 792 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 793 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 794 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 795 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 796 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 797 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 798 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 799 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 800 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 801 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 802 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 803 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 804 || [http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 805 || '''[http://www.explainxkcd.com/wiki/images/e/ed/1000_Comics_-_The_third_zero_in_thousand_Top_with_numbers.png Zero 3 T]''' || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 806 || '''[http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R]''' || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 807 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 808 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 809 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 810 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 811 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 812 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 813 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 814 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 815 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 816 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 817 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 818 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 819 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 820 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 821 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 822 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 823 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 824 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 825 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 826 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 827 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 828 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 829 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 830 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 831 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 832 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 833 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 834 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 835 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 836 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 837 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 838 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 839 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 840 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 841 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 842 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 843 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 844 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 845 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 846 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 847 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 848 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 849 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 850 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 851 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 852 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 853 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 854 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 855 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 856 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 857 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 858 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 859 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 860 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 861 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 862 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 863 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 864 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 865 || [http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 866 || '''[http://www.explainxkcd.com/wiki/images/3/39/1000_Comics_-_The_third_zero_in_thousand_Right_with_numbers.png Zero 3 R]''' || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 867 || '''[http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B]''' || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 868 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png zero&amp;amp;nbsp;3&amp;amp;nbsp;B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 869 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 870 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 871 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 872 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 873 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 874 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 875 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 876 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 877 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 878 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 879 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 880 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 881 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 882 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 883 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 884 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 885 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 886 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 887 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 888 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 889 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 890 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 891 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 892 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 893 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 894 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 895 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 896 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 897 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 898 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 899 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 900 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 901 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 902 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 903 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 904 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 905 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 906 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 907 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 908 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 909 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 910 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 911 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 912 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 913 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 914 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 915 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 916 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 917 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 918 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 919 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 920 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 921 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 922 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 923 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 924 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 925 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 926 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 927 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 928 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 929 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 930 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 931 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 932 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 933 || [http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 934 || '''[http://www.explainxkcd.com/wiki/images/1/1c/1000_Comics_-_The_third_zero_in_thousand_Bottom_with_numbers.png Zero 3 B]''' || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 935 || '''[http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L]''' || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 936 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 937 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 938 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 939 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 940 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 941 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 942 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 943 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 944 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 945 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 946 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 947 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 948 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 949 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 950 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 951 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 952 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 953 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 954 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 955 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 956 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 957 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 958 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 959 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 960 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 961 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 962 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 963 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 964 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 965 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 966 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 967 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 968 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 969 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 970 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 971 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 972 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 973 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 974 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 975 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 976 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 977 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 978 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 979 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 980 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 981 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 982 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 983 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 984 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 985 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 986 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 987 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 988 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 989 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 990 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 991 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 992 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || Science Girl standing alone || || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 993 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 994 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 995 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 996 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 997 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 998 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 999 || [http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L] || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|-&lt;br /&gt;
| 1000 || '''[http://www.explainxkcd.com/wiki/images/3/38/1000_Comics_-_The_third_zero_in_thousand_Left_with_numbers.png Zero 3 L]''' || || &amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;A Red Text: Explanation missing&amp;lt;/font&amp;gt; || || || || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Explanations==&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
{{DEFAULTSORT:1000}}&lt;br /&gt;
[[Category:Comic subpages]]&lt;/div&gt;</summary>
		<author><name>DMLL4305</name></author>	</entry>

	</feed>