<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Ericprud</id>
		<title>explain xkcd - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Ericprud"/>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php/Special:Contributions/Ericprud"/>
		<updated>2026-05-19T17:29:38Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.30.0</generator>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2940:_Modes_of_Transportation&amp;diff=343845</id>
		<title>Talk:2940: Modes of Transportation</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2940:_Modes_of_Transportation&amp;diff=343845"/>
				<updated>2024-06-05T20:53:44Z</updated>
		
		<summary type="html">&lt;p&gt;Ericprud: whined about helicopters being bricks&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;quot;There is no such thing as a gliding helicopter.&amp;quot; is a common misconception. Every helicopter pilot learns to [[wikipedia:Autorotation|autorotate]] reflexively when there is a power failure.&lt;br /&gt;
&lt;br /&gt;
I'd say a bicycle is way less dangerous than a car [[Special:Contributions/172.68.192.196|172.68.192.196]] 21:36, 31 May 2024 (UTC) (para 1/4)&lt;br /&gt;
:Considering only the two vehicles themselves, I would probably agree with you but this comic is about convenience and danger of various means of transport. Wouldn't you agree that using a bicycle for transport in crowded city traffic is rather more dangerous to the cyclist than using a car is to the driver? {{unsigned ip|172.69.60.138|21:46, 31 May 2024}}&lt;br /&gt;
:It depends on whether you're comparing worst case injuries versus injury rate. Since airliners are considered one of the safest, I think it's injury rate. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 22:07, 31 May 2024 (UTC)&lt;br /&gt;
:I'd say a bicycle is less dangerous than a unicycle, but apparently walking&amp;lt;unicycle&amp;lt;car&amp;lt;bicycle. No metric I can think of matches that order, neither danger in a vacuum, danger in a self-environment, danger in a car environment, or danger to others in any environment. I'm quite confused. --[[Special:Contributions/172.70.114.29|172.70.114.29]] 05:29, 1 June 2024 (UTC)&lt;br /&gt;
::On a per-passenger-mile basis, walking is over ten times more dangerous than driving, and trains are about four times as dangerous as planes. So this comic can't be about risk of death per mile. It must be something more like risk of death per hour, which is extremely low for unicycles since people don't usually ride them in life-threatening situations outside of circuses. Similarly, travelling to and from work on a pogo stick every day would be quite dangerous, but in practice, people hardly ever die on a pogo stick. So it depends how you measure it. [[User:EebstertheGreat|EebstertheGreat]] ([[User talk:EebstertheGreat|talk]]) 06:07, 1 June 2024 (UTC)&lt;br /&gt;
::: I can see the danger/hour, but surely the unicycle shouldn't count as a mode of transportation when it is used in a circus? You also don't want to count the hours when a car is stationary and the driver is waiting for someone to enter or leave (which is a significant amount of time for taxi's). So when it is used for actual transportation, it is most certainly more dangerous per hour than many other things on this graph. --[[Special:Contributions/172.70.110.99|172.70.110.99]] 23:58, 1 June 2024 (UTC)&lt;br /&gt;
:I think there is a couple that are off on here since I think light aircraft and helicopters are also less dangerous than cars when looking at accident rates vs trips or vs miles traveled. Cars are quite dangerous. They sure are convenient though. [[Special:Contributions/172.64.238.87|172.64.238.87]] 09:57, 1 June 2024 (UTC)&lt;br /&gt;
:Agreed: By any metric I can think of, this chart is grossly off on more than one form of transport. For one thing, inline skating is ''much'' safer than skateboarding in almost every scenario except approaching a bunch of mean kids. [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 21:59, 2 June 2024 (UTC)&lt;br /&gt;
: I think the metric he's using is actually ''perceived'' danger.[[Special:Contributions/172.70.90.145|172.70.90.145]] 08:19, 3 June 2024 (UTC)&lt;br /&gt;
:: I think the whole chart is on a &amp;quot;perceived&amp;quot; level. I would assume that &amp;quot;convenience&amp;quot; also would include &amp;quot;getting from A to B fast&amp;quot; for which cars and bicylces are too close together. And motorcycles are surely fun but if they were even closely as convenient as a car I would use the former more often than latter - which I don't as a car is MUCH more convenient. I think the meaningfulness of the chart is more like [[Fuck Grapefruit]] a matter of opinion than an actual analysis based on actual statistics. [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 08:39, 3 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
Most deaths are either due to involved cars or people doing races or stunts. [[Special:Contributions/172.68.192.196|172.68.192.196]] 21:36, 31 May 2024 (UTC) (para 2/4)&lt;br /&gt;
&lt;br /&gt;
I would not count &amp;quot;died because plane crashed onto road&amp;quot; into car dangers, as I would not count F1 driver death into the same bucket as car commuters. [[Special:Contributions/172.68.192.196|172.68.192.196]] 21:36, 31 May 2024 (UTC) (para 3/4)&lt;br /&gt;
:So I would do the same for bikes. [[Special:Contributions/172.68.192.196|172.68.192.196]] 21:36, 31 May 2024 (UTC) (para 4/4)&lt;br /&gt;
::Agreed. Deaths caused by cars should not count against bikes unless &amp;quot;plane crashed onto road&amp;quot; would count against cars &amp;amp; 'flying by nuclear rocket' would count against the poor people walking below.   &lt;br /&gt;
::[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 22:00, 2 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
It's not actually true that a hot air balloon has only one possible direction of travel. It seemed relevant so I added a couple of sentences to the explanation. I suspect Randall is aware of this of course, being a weather nerd. [[Special:Contributions/162.158.74.69|162.158.74.69]] 00:28, 1 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
Meh... A hot air balloon is not a &amp;quot;mode of transportation&amp;quot;, that is it's not a means to go from location A (on the ground) to location B (on the ground)  A hot air balloon is means of going ''Up'', and staying ''up'' for an reasonable period of time.  In most balloon rides, the &amp;quot;destination&amp;quot; is irrelevant, the purpose of the ride is to reach altitude, not travel horizontally. I feel Randall misses the point of balloons here. It shouldn't be only the graph, because it's not a &amp;quot;Mode of transport&amp;quot;.&lt;br /&gt;
[[User:Zeimusu|Zeimusu]] ([[User talk:Zeimusu|talk]]) 21:13, 1 June 2024 (UTC)&lt;br /&gt;
:The graph only addresses how convenient\dangerous things are as a form of transport. A Slip-N-Slide could easily have made the list, if Randall had viewed any such record attempts lately. Putting only practical modes of transport on the chart, would leave the lower right empty. If one wanted to know whether hot-air balloon ''was'' a practical mode of transport, one could theoretically consult a chart like this to find out that it isn't.   &lt;br /&gt;
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 21:59, 2 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
Are American hot air balloonists commonly fond of taking sniper rifles up with them? [[User:Kev|Kev]] ([[User talk:Kev|talk]]) 23:11, 31 May 2024 (UTC)&lt;br /&gt;
:From what I understand, it's considered unamerican not to.[[Special:Contributions/172.70.85.176|172.70.85.176]] 10:36, 3 June 2024 (UTC)&lt;br /&gt;
::Its not a commonly known law, but its actally illegal to enter a hotair balloon with anything less than a 12 gauge [[User:Apollo11|Apollo11]] ([[User talk:Apollo11|talk]]) 16:25, 3 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
Dangerous to whom is relevant. Yes, cars are less dangerous to the driver than bicycles and pedestrians, but that is because the main threat to bicyclists and pedestrians is cars. If you count victim deaths in addition to perpetrator deaths, then cars are the least safe vehicle. [[Special:Contributions/172.71.99.30|172.71.99.30]] 01:56, 1 June 2024 (UTC)Regret&lt;br /&gt;
:Cars aren't dangerous; drivers are...[[Special:Contributions/172.70.86.82|172.70.86.82]] 09:38, 3 June 2024 (UTC)&lt;br /&gt;
:In fact, even the first part isn't true. If you just count self-caused injury/death, cars are more dangerous to their occupants than bikes are to their riders or, er, feet are to those walking.[[Special:Contributions/172.70.162.18|172.70.162.18]] 10:39, 3 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
Are scooters really more convenient than bikes or does Randall just think they are cooler? Please discuss. [[Special:Contributions/172.69.58.128|172.69.58.128]] 04:17, 1 June 2024 (UTC)&lt;br /&gt;
:The convenience of scooters probably includes their relative storability/carryability between uses, easier to hop on and off (also you might get away with scootering down long corridors where a bike would be (more) frowned upon) and takes less maintenance. (Electric ones do have the additional fuss of charging (and ICE ones needing fuel/being more disruptively noisy), but hard to tell whether Randall means shove-along or motorised in any way). Probably he doesn't mean mopeds (also known as 'scooters', in some contexts), but they also may be considered like bicycles but marginally more convenient (when fuelled/serviced) and commensurately a little bit more dangerous (though I'd argue further over to near full-on-motorbikes, myself). But it's a lot of speculation either way. [[Special:Contributions/172.71.242.28|172.71.242.28]] 11:32, 1 June 2024 (UTC)&lt;br /&gt;
:Very inconvenient, and definitely more dangerous. No way to transport anything except in a rucksack. Terribly small wheels. Muscle-powered very strenous compared to a bike. Electrical make you freeze to death in winter. Wear down very quickly (bearings in wheels and steering, brakes). Only use for scooters are flat, smooth passages, certainly indoors. --[[Special:Contributions/172.71.246.69|172.71.246.69]] 09:49, 2 June 2024 (UTC)&lt;br /&gt;
:I think Randall's use of &amp;quot;scooters&amp;quot; here, may include mopeds &amp;amp; ebikes, since ebikes aren't listed here, yet are roughly equivalent to (or even just ''are'') a moped, while mopeds &amp;amp; high-output ebikes &amp;lt;45MPH are often classed among &amp;quot;scooters&amp;quot;. [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 21:59, 2 June 2024 (UTC)&lt;br /&gt;
::A &amp;quot;high-output e-bike&amp;quot; is (or should) be classified under &amp;quot;motorbike&amp;quot;. And I already (before I read this) included reference to electrically-assisted bicycles under the Bicycles entry itself. There may be various distinctions recognised under different local laws, but power-assisted-pedalling versions (augmenting, but not making insigificant, the riders' 'normal' effort) and power-rather-than-pedalling versions (which would go all the way up to those with ''no pedals'', totally reliant upon the motor) would probably sit either side of the notional divide that might be recognised by those in charge of classifying them. [[Special:Contributions/172.69.79.182|172.69.79.182]] 22:43, 2 June 2024 (UTC)&lt;br /&gt;
:::I suspect what ProphetZarquon was getting at is that they are often ''referred to'' as &amp;quot;scooters&amp;quot;, as opposed to legally classed as such.[[Special:Contributions/172.70.163.121|172.70.163.121]] 10:41, 3 June 2024 (UTC)&lt;br /&gt;
::::&amp;quot;Scooter&amp;quot; for moped, yes. But though &amp;quot;moped&amp;quot; comes from &amp;quot;motor-assisted pedal cycles&amp;quot;, where I come from, they're mini-motorbikes and essentially classed as such (you need road training, driving licence, insurance, vehicle registration), divorced entirely from non-motorised bicycles and now (fudging the issue) those bicycles with electric motor assistance. It's perhaps confusing enough with &amp;quot;bike&amp;quot; being understood differently by the cycling and the motorcycling communities, but an &amp;quot;e-bike&amp;quot; that's a &amp;quot;scooter&amp;quot; is really going to be an &amp;quot;e-motorbike&amp;quot; to avoid this kind of ambiguity, and I invite anyone who might be more confused by the current crop of motor-assisted-bicycles being called &amp;quot;e-bikes&amp;quot; to submit their own more disambiguative term. [[Special:Contributions/172.70.90.65|172.70.90.65]] 21:58, 3 June 2024 (UTC) (PS, the CAPTCHA I was just presented with was asking about &amp;quot;Motorcycles&amp;quot; and, as usual, just contained several obvious mopeds/scooters... But I know from experience that I have to go along with supporting the CAPTCHA's technically miseducated classification system.)&lt;br /&gt;
:::::Thing is, in a technical sense, any ebike is literally a moped, &amp;amp; not only are mopeds commonly and legally classed with scooters, but there's also a '''big''' regulatory gap between ≤750W ebikes &amp;amp; the &amp;gt;12KW emotos that consistently require &amp;quot;motorcycle&amp;quot; registration. A low-power ebike ''is'' just classed as a bicycle in most US regions, &amp;amp; over 45 MPH you're ''always'' into motorcycle classifications, but the plethora of moderately assisted 2-wheelers ''in between'', are not nearly so powerful or fast as to require motorcycle registration in many states, &amp;amp; instead fall into the non-licensed &amp;quot;scooter&amp;quot; classification, ''right alongside the classic mopeds which their performance characteristics are most directly comparable to.'' Not legal on interstates or other high-speed routes, nor on non-motorized routes, but legal to ride on surface streets &amp;amp; generally without requiring licensure. A low-power ebike doesn't differ from the performance characteristics of a bicycle enough to merit a separate listing, &amp;amp; a high-powered emoto is literally just an EV motorcycle, but a 1500W &amp;quot;ebike&amp;quot; is ''technically'' most similar to a moped, &amp;amp; legally falls into that same &amp;quot;scooter&amp;quot; category in many jurisdictions, due to being utterly unable to attain highway speeds. So, to the extent that some ebikes ''are'' much faster than a bicycle yet slower than a motorcycle, I believe ''those'' would logically be classed (like mopeds) as scooters.   &lt;br /&gt;
:::::[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 01:47, 4 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
I would expect that unicycles are more dangerous than bicycles. For that matter, bicycles are probably more dangerous than tricycles, and those would be slightly less safe than quadcycles. There we probably hit the optimal point, but I doubt anyone has done an in dept study into this matter. Just for starters: a double blind test would not be particularly safe for the riders. [[Special:Contributions/172.71.98.101|172.71.98.101]] 07:00, 1 June 2024 (UTC)&lt;br /&gt;
:When you have learnt how to ride a bike, a tricycle can actually be ''harder'' to ride, due to having to unlearn your existing bicycling instincts. To turn (or not to turn) on a bicycle involves at least 'microleaning', as well as steering, which can actually work against the steering geometry on a tricyle (perhaps a quadricycle is less effected, as one reverts to car-like behaviour/has to account for uneven road surfaces even more differently). Before you have the bike-riding skills (especially on front-wheel-pedal kids' trikes, which have yet more things going on than proper road-cycling tricycles) you generally don't get into the wrong mode of balance where you actually veer off exactly the opposite way to what you intend and maybe start to lift one of the rear wheels off the ground, or more.&lt;br /&gt;
:For similar reasons, it's much better to have a completely new passenger ('stoker') on a tandem who is not a cyclist than one who is (but it being their first time on a tandem). The 'steersman' does not need too much complication from their &amp;quot;luggage&amp;quot; instinctively leaning on their own (or unconsciously tugging left/right on their fixed-handlebars), at least until they've practiced their coordination so that there's just the right amount of weight redistribution at the right time to make the whole machine correctly metastable for the circumstances. A non-cyclist can generally be asked to &amp;quot;just sit there and pedal&amp;quot; and not, despite being told, throw themselves around in various ways not related to the (synchronised with the steersman) pedal-revs. [[Special:Contributions/172.71.242.28|172.71.242.28]] 11:32, 1 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
There's a &amp;quot;jetpack&amp;quot; missing to the right of hot air ballons... [[Special:Contributions/108.162.221.61|108.162.221.61]] 10:26, 1 June 2024 (UTC)&lt;br /&gt;
:On the far right. Together with paragliding. --[[Special:Contributions/172.71.246.69|172.71.246.69]] 09:49, 2 June 2024 (UTC)&lt;br /&gt;
::Hey now, paragliding is quite safe &amp;amp; convenient, so long as you can locate updrafts, &amp;amp; have free airspace, &amp;amp; stay away from the back &amp;amp; sides of any upwind slopes, &amp;amp; don't bank too hard, &amp;amp; ... OK yeah, I can see it now. [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 22:20, 2 June 2024 (UTC)&lt;br /&gt;
:: And jetskis.[[Special:Contributions/172.70.90.177|172.70.90.177]] 08:25, 3 June 2024 (UTC)&lt;br /&gt;
::: Also, {{w|Lawnchair_Larry_flight|helium balloon chair}}.[[Special:Contributions/172.70.85.7|172.70.85.7]] 08:29, 3 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
Hot air balloons can be particularly dangerous in large groups, each being approximately 1.11% of an extinction level event. [[Special:Contributions/172.69.246.143|172.69.246.143]] 15:53, 1 June 2024 (UTC)&lt;br /&gt;
:That's only asserted to be true for the red ones... [[Special:Contributions/172.70.85.157|172.70.85.157]] 17:23, 1 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
The place where motorcycles are on the map is why my uncle calls them &amp;quot;donercycles&amp;quot; - so many of their riders are organ donors because they die so much.&lt;br /&gt;
:You mean people are scraping them up and using them to make kebabs?![[Special:Contributions/172.69.43.184|172.69.43.184]] 12:48, 4 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Other in-between modes of transport? ==&lt;br /&gt;
&lt;br /&gt;
So which modes of transports belong in the white band between the &amp;quot;Zone of specialty and recreational vehicles&amp;quot; and the Hot air balloons? I would suggest the Autogyro (see [[1972:_Autogyros|#1972]]) between the skis and the hot air balloon. Any other suggestions? [[User:Frog23|Frog23]] ([[User talk:Frog23|talk]]) 22:44, 31 May 2024 (UTC) &lt;br /&gt;
:A shovel? Tunneling is both dangerous &amp;amp; inconvenient...   &lt;br /&gt;
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 22:13, 2 June 2024 (UTC)&lt;br /&gt;
::Jet packs and guns https://whatif.xkcd.com/21/ [[User:Apollo11|Apollo11]] ([[User talk:Apollo11|talk]]) 16:28, 3 June 2024 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Explain &amp;quot;sign error&amp;quot; (done?) ==&lt;br /&gt;
&lt;br /&gt;
I came here to find out what a sign-error is, but the description assumes I already know. {{unsigned ip|162.158.74.69|22:58, 31 May 2024}}&lt;br /&gt;
: I think he means if you have erroneously given a negative as a positive, and thereby flipped your y-axis the wrong way up - making inconvenient things appear convenient.[[Special:Contributions/172.70.162.186|172.70.162.186]] 08:33, 3 June 2024 (UTC)&lt;br /&gt;
::''And'' flipped the x-axis. Or at least how you treat it. Note that one axis is &amp;quot;more is better&amp;quot; (convenience) and the other is &amp;quot;less is better&amp;quot; (danger), so any analysis that looks at comparative overall desirability has to treat one axis's position in a negative manner, whether seeking the coordinate with least deviation from perfection, the most deviation from  imperfection, the most desirable vector away from a midpoint or whatever. The choice of exactly how to compare might juggle the effective linear rank of all items, although it visually looks like Trains would always rank first in most treatments (except those with a very weird weighting between the two measures, or even an 'ideal' position not on the &amp;quot;not dangerous at all&amp;quot; edge but maybe at a 'comfortably desired' amount of thrill).&lt;br /&gt;
::So you need to apply exactly one sign-flip to identify the (normally) practical zone for being best (not &amp;quot;very convenient and very dangerous&amp;quot;, which is high+high seeking; nor &amp;quot;undangerous and inconvenient&amp;quot;, which seeks low+low). Apply that sign-flip to ''x'' instead of ''y'' (or vice-versa, depending upon your goal-seeking method) and you're identifying Hot Air Balloons as your perfect solution instead of (by Randall's apparent perception) Trains.&lt;br /&gt;
::At this point, you've not (just) flipped the Convenience axis over. Either you've flipped ''both'' around or you're now not doing the sanity-check on the original graph ''at all'' and just relying upon your doubly-missigned 'algorithm' (one input flipped, the other ''de''flipped).&lt;br /&gt;
::A related sign-error coordinate thing is in 3D data, where left-handed and right-handed coordinate systems are just a single sign-flip away (or all three flipped!), but often also combined with whether you should go with ''z'' being 'into' (or out of!) the paper graph (standard x-along and y-up, from 2D graphing) or it being 'up' (or 'down'!) with x/y being both laid horizontally. Both can be made true on a 'tabletop map', but less obvious which is the best way to use on a vertical screen. All this before you start applying other rotations, of course, to the data you initially define in whichever choice of fundemental coordinates you wish. But it can be confusing if you're unsure as to which baseline (left/right-handed, and &amp;quot;which axis is ''z''&amp;quot; probably less certain than subsequently filling in where the other two are) either to implement yourself or to interact with when you start work atop another basic implementation. I probably had more designs come up sideways (in some manner) than I ever did have them accidentally mirrored, whenever I started to dabble in a new 3D platform. [[Special:Contributions/172.69.195.230|172.69.195.230]] 10:37, 3 June 2024 (UTC)&lt;/div&gt;</summary>
		<author><name>Ericprud</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2298:_Coronavirus_Genome&amp;diff=299698</id>
		<title>Talk:2298: Coronavirus Genome</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2298:_Coronavirus_Genome&amp;diff=299698"/>
				<updated>2022-11-23T18:04:47Z</updated>
		
		<summary type="html">&lt;p&gt;Ericprud: + proposal for Japanese spell checkers&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Epigenetics is a pun, right? I think it's a pun but I don't know what and it's maddening. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 23:03, 24 April 2020 (UTC)&lt;br /&gt;
:...{{w|Epigenetics}} is a real thing&amp;amp;mdash;the study of how changes in things other than the genome itself can be passed down between generations. An example is conditioning a mouse to be scared of the smell of oranges/cherries/almonds by having them associate the scent of acetophenone with an electric shock, then testing whether its pups also have the same fear of that smell: they do, but this obviously can't be by the genome itself changing (no component of this has a lot of ionizing radiation{{Citation needed}}). Whatever causes this is the topic of actual epigenetics. --[[User:Volleo6144|Volleo6144]] ([[User talk:Volleo6144|talk]]) 00:12, 25 April 2020 (UTC)&lt;br /&gt;
::I know that, I added the link to the article. But afaik that has nothing to do with how the genome is formatted in Word, and I think it's a pun. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 00:31, 25 April 2020 (UTC)&lt;br /&gt;
since when does notepad have spellcheck? [[Special:Contributions/172.68.226.46|172.68.226.46]] 23:05, 24 April 2020 (UTC)&lt;br /&gt;
:Neither notepad nor wordpad have spellcheck.  I suspect he combined two jokes and the spellcheck to word link was not better established.[[User:Quinoje|Quinoje]] ([[User talk:Quinoje|talk]]) 19:35, 27 April 2020 (UTC)&lt;br /&gt;
: Word does, so maybe she is using Word instead? Kind of contradictory. [[Special:Contributions/172.69.34.46|172.69.34.46]] 23:14, 24 April 2020 (UTC)&lt;br /&gt;
:I assumed Randall meant Wordpad, which ifrc is an upgrade from notepad but has a really thinned out set of Word's features. Maybe there's a spellcheck in there? (haven't used it in ~10 years) [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 07:47, 27 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Very disappointed that she's using Notepad and not  Notepad++ . I mean,really...   [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 15:38, 27 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
When Dr. Theall first scanned Finnegans Wake, he had to tell Microsoft the language was Old Icelandic.&lt;br /&gt;
&lt;br /&gt;
The OCR kept trying to spellcheck Finnegans Wake.15:11, 26 April 2020 (UTC)&lt;br /&gt;
:True Story: In the 1980s, as part of the Work Experience initiative at my school, I was assigned to one of my local council's offices (I'd applied for their computer department, but someone else got that). I don't ''think'' the word-processor I used at home (Psion Exchange) had spellcheck, but the one the office used (Lotus? Can't actually recall, but it, like most things, was DOS-based) definitely had, and it was very easy to edit in new words. Inspired by the chemistry lessons I'd recently had, and some 'reports' I was asked to write (keeping the kid busy, more like!) that dealt with chemical degradation of concrete under the action of salt and suchlike, I of course added &amp;quot;NaCl&amp;quot; then absolutely any other chemical formulae I could think of. &amp;quot;H2SO4&amp;quot; was an early one (partial subscript formatting wasn't relevent to the spill-chucker) but I eventually got round to CH4, C2H6, C3H8, etc, and then as many of the derived alcohols, alkenes, alkynes, etc that I could be bothered to type in. Which were a lot. By the end I was 'confident' that nobody would ever type ''any'' correct chemical formula into that machine (no network-shared resources!) and have to worry about false-positive typo alerts. Yeah, well, I was still at school and thought I knew ''everything''. [[Special:Contributions/162.158.159.70|162.158.159.70]] 23:37, 24 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Can confirm: virus genomes are looked at in notepad. I worked at one of the national laboratories for a summer, experimenting with ways to check for the length of a gene and strength of genetic expression in various circumstances in E. coli. We used notepad because even old computers can open very large files without difficulty, and all our scripts were in Perl, which can easily output to .rtf or .txt file formats. These files are huge, by the way. If you hold down on the scroll bar so it's zooming to the bottom, you could be waiting 20 minutes to reach the end depending on the number of kilobase pairs in your microbe. And epigenetics is not a pun. It's a real word. [[Special:Contributions/172.68.143.192|172.68.143.192]] 00:15, 25 April 2020 (UTC)&lt;br /&gt;
:''even old computers can open very large files without difficulty'' - Depending on what you mean by &amp;quot;old&amp;quot; and &amp;quot;very large&amp;quot; that may well not be true. In Windows 3.x, Notepad could open files as large as 54Kb, increasing to 64Kb in Windows95, 512Mb in Windows 8 and 1Gb in Windows 10. I don't know which of those would fit a typical virus genome, but I'm guessing it's not all of them. [[Special:Contributions/162.158.187.151|162.158.187.151]] 13:43, 27 April 2020 (UTC)&lt;br /&gt;
:: Well, Sars-Cov-2 has around 30 kb, and that's considered big already. Since a base is a letter and thus a byte, a viral genome usually fits in the old notepad. But here is the catch: when people align things you get the number multiplied by whatever many genomes they are looking at. And don't even talk about the {{w|Nucleocytoviricota}}-whatsoever-twats.--[[Special:Contributions/162.158.179.12|162.158.179.12]] 06:11, 5 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Concurrent to the work in the medical community, work is underway in various open source software communities to fix bugs and other issues with software (eg genome analysis tools) that is useful to the scientists combatting COVID-19. These include the Debian &amp;quot;biohackathon&amp;quot; (https://lwn.net/Articles/816280/) as well as support from Mozilla (https://lwn.net/Articles/816386/). Parallel to these efforts, the FSF (Free Software Foundation) has focused on the shortage of medical equipment: https://lwn.net/Articles/816392/ [[Special:Contributions/108.162.242.5|108.162.242.5]] 00:34, 25 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
I’m suddenly inspired to write a DNA-edit-mode for Emacs (if it doesn’t have it already) which would allow for the virus spell check as described in this comic. [[Special:Contributions/172.69.63.153|172.69.63.153]] 04:16, 25 April 2020 (UTC)&lt;br /&gt;
: the dna-mode for emacs does exist. Google for it. It is not very useful for real work, though. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Derek Lowe has some insights about actual coronavirus mutations [https://blogs.sciencemag.org/pipeline/archives/2020/04/21/watching-for-mutations-in-the-coronavirus here], if you are interested.&lt;br /&gt;
&lt;br /&gt;
Given coronavirus has an RNA genome, shouldn't all the 'T's be replaced by 'U's?&lt;br /&gt;
: It is standard practice no to use U's in public sequence database. It simplifies things. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
The sequence in the transcript does not actually appear on the [https://www.ebi.ac.uk/ena/data/view/MT344963&amp;amp;display=text site] mentioned in the explanation. In fact, when I google for 'TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA' I only get this particular site. {{unsigned ip|141.101.104.221|07:00, April 25, 2020}}&lt;br /&gt;
:To find this (or any) sequence go to [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&amp;amp;PAGE_TYPE=BlastSearch&amp;amp;LINK_LOC=blasthome|Nucleotide Blast]] and paste the query into the box. You will receive a list of a number of best matches (10, 50 or 100 in standard search), this should look like [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&amp;amp;PAGE_TYPE=BlastSearch&amp;amp;VIEW_SEARCH=on&amp;amp;UNIQ_SEARCH_NAME=A_SearchOptions_1jST3G_gRB_dgzLunnk2EC_23turP_1HUFpP|this]] &lt;br /&gt;
Interestingly, this is an US-specific strain of the virus (top result currently is &amp;quot;Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/NC_0025/2020&amp;quot;).[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 23:21, 25 April 2020 (UTC)&lt;br /&gt;
:Well, ''obviously'' it's a new variant, yet unknown to other clinical studies. Of RNA that has switched to looking like DNA, so this is a hot discovery! [[Special:Contributions/162.158.159.142|162.158.159.142]] 12:05, 25 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
: The site shows several views into the public database entry that are easier to understand by humans than the raw sequence. Click the link at 'View: TEXT'. and scroll down. The relevant lines look like this:&lt;br /&gt;
{{#tag:pre|&lt;br /&gt;
     aatccagtaa tggaaccaat ttatgatgaa ccgacgacga ctactagcgt gcctttgtaa     26220&lt;br /&gt;
     gcacaagctg attagtacga acttatgtac tcattcgttt cggaagagac aggtacgtta     26280}}&lt;br /&gt;
:As you can see, these are not meant to be search for and compared in &amp;quot;a notepad&amp;quot;. For the same reason, google does not index DNA sequence database entries. There are specialised tools for that.&lt;br /&gt;
:The sequnces were published this month, so they are available only in the most recent sequence database updates. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)&lt;br /&gt;
 &lt;br /&gt;
&lt;br /&gt;
I have had trouble opening .txt files of even a hundred KB in Notepad! Sometimes it even crashes... It's one of the reasons I started using Notepad++. Notepad++ also happens to have a very extensible spellcheck, &amp;amp; language-specific formatting options. Since I often need to use Windows machines, it's one of my most frequently installed apps, after 7Zip.&lt;br /&gt;
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 18:03, 25 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
The Grammar Checker concept only has a {{w|Colorless_green_ideas_sleep_furiously|limited analytical sophistication}}, though I don't doubt it'd still be enough to get a Nobel given the complexity of the task of deriving trivially feasible sequences from total codswallop. I also added the &amp;quot;next step&amp;quot; (probably much more than a single step), when I revised things, but that might actually be overstepping the explanation of the comic and removable. [[Special:Contributions/162.158.155.122|162.158.155.122]] 20:32, 25 April 2020 (UTC)&lt;br /&gt;
:Thanks for mentioning this in the discussion area, as I wondered what that &amp;quot;next step&amp;quot; line meant when I read it a little while ago, let alone how it related to the comic.  I'll go ahead and trim that last &amp;quot;next step&amp;quot; sentence off the end, as I think it is unnecessary. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 03:36, 26 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is using Notepad to analyse RNA sequences more or less sane than using a spam filter to play chess? - [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 00:43, 27 April 2020 (UTC)&lt;br /&gt;
: Is that filter used to prevent emails pretending to be from Czech mates looking to give you a knight to remember in a message full of pawn images? [[Special:Contributions/162.158.158.211|162.158.158.211]] 15:10, 27 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Just stumbled on this. I wonder if Japanese spell checker tech (like many [https://en.wikipedia.org/wiki/Logogram logographic scripts], words aren't separated by whitespace) would work for strings of nucleotide letters. Normally, you try to match the longest possible strings with algorithms like BLAST, but maybe the spellcheckers get so much optimization that they're more efficient. Or maybe spellcheckers should use BLAST. [[User:Ericprud|Ericprud]] ([[User talk:Ericprud|talk]]) 18:04, 23 November 2022 (UTC)&lt;/div&gt;</summary>
		<author><name>Ericprud</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2525:_Air_Travel_Packing_List&amp;diff=295859</id>
		<title>2525: Air Travel Packing List</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2525:_Air_Travel_Packing_List&amp;diff=295859"/>
				<updated>2022-10-02T14:39:18Z</updated>
		
		<summary type="html">&lt;p&gt;Ericprud: + reference to Japanese toilet shoes&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2525&lt;br /&gt;
| date      = October 6, 2021&lt;br /&gt;
| title     = Air Travel Packing List&lt;br /&gt;
| image     = air_travel_packing_list.png&lt;br /&gt;
| titletext = I know the etiquette is controversial, but I think it's rude when the person in front of me reclines their seat into the bell of my trumpet.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
This comic is another in a [[:Category:COVID-19|series of comics]] related to the {{w|COVID-19 pandemic}}. &lt;br /&gt;
&lt;br /&gt;
The comic is about a proposed air-travel packing list, and the humor stems from the fact that many people have not been flying during the pandemic, and thus they might have forgotten what to pack. So [[Randall]] is so kind as to provide a packing list with 20 items. However, apart from the first item, the rest is not something you would or even should normally bring on an airplane.&lt;br /&gt;
&lt;br /&gt;
Many of the items are already found on passenger airplanes, some items would seem like they could be useful on a plane, while others could actually be useful in case of a plane crash (but only if you survive), while many others would be counter-productive to safe air travel, even in the event of a crash. Below in [[#Table of items|the table]] is a quick summary of each item.&lt;br /&gt;
&lt;br /&gt;
The title text references the idea that there is a trumpet for each passenger provided by the airline, which is item number 16 on the list. This items also states that you, because of the COVID-19 pandemic, should remember to bring your own mouthpiece for the trumpet as a safety measure. &lt;br /&gt;
&lt;br /&gt;
The trumpet idea is then combined with the common debate regarding reclining your seat in airplanes. About half of the people think that reclining is rude as it takes up the space of the person behind you. The other half think that seats recline for a reason and the person in a seat has the rights to the space behind them. See for instance this [https://www.youtube.com/watch?v=08A30v8isRs video] about such a debate. Reclining a seat has resulted in actual [https://www.independent.co.uk/news/world/americas/crime/fight-airplane-man-punch-video-b1895402.html physical fights] on board airplanes.&lt;br /&gt;
&lt;br /&gt;
Here it seems that Randall sides with the anti-recliners, although maybe only in the context of the comic, because he states that reclining would prevent him from playing his trumpet, as the seat hits the bell of the trumpet. The person in front could certainly argue that playing the trumpet behind them would be very annoying, to which Randall could reply that because the trumpet is provided by the airline, he has the right to play it. This would add a new layer to the debate. This could also be Randall's way of arguing against the right to recline a seat, just because it is possible.&lt;br /&gt;
&lt;br /&gt;
===Table of items===&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Item&lt;br /&gt;
! Explanation&lt;br /&gt;
|-&lt;br /&gt;
|Seat cushion&lt;br /&gt;
|This item is a play on sports stadium bleachers (sports stadiums were another venue commonly closed during the pandemic), because many sports fans find stadium bleachers uncomfortable and prefer to bring their own seat cushions. Airlines usually provide their own seat cushions for passengers, which are specially designed to float in water in the event of a plane crash.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Parachute}}&lt;br /&gt;
|Parachutes are normally used to slow down your falling out of the sky to a relatively safe speed in case of a severe problem with your aircraft, and are routinely used as a safety device by (para)glider pilots, test pilots, military aircraft crew and in similar situations when being unable to land safely is a significant concern. A parachute won't be very useful in a typical passenger airplane (even a small one) as there is no easy way to safely exit such a plane in-flight. Even the airplanes used for {{w|skydiving}} need to be specifically designed or modified for that purpose, such as having wide sliding doors that are unaffected by airflow. However, there were individual cases of people being ejected or sucked out of a passenger airplane, often during partial or complete break-up of the aircraft; in such case a parachute could arguably be useful.{{Citation needed}} Famously, [[:Category:Comics featuring D. B. Cooper|D.B. Cooper]] jumped from an airplane in flight, with a parachute but was never knowingly seen again.&lt;br /&gt;
|-&lt;br /&gt;
|Wing glue&lt;br /&gt;
|Probably to repair wings in the event of damage, potentially in a crash. This would be tricky (but not necessarily impossible) to apply mid-flight. This is the first of several items that are potentially useful to the flight crew or maintenance teams, but would not be useful or appropriate for passengers to bring aboard. Minor repairs (including to the wings) can be made by service personnel using {{w|speed tape}}, tape specially designed for high-speed applications. Speed tape might be mistaken for ordinary duct tape by passengers.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Air horn}}&lt;br /&gt;
|An air horn uses compressed air to make a very loud noise, very easily. This may be important for drawing attention to yourself in the event of a crash. Typically, emergency life-jackets on a plane are provided with a light and whistle for this purpose. The noise of an air horn might prove more effective for this purpose than a whistle, but it would become useless as soon as the compressed air ran out. Its inclusion is probably meant to suggest that the word 'air' in its name indicates that it's designed for use in an aircraft. Using one in a non-emergency situation would infuriate everyone else on the plane.{{citation needed}}&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Sextant}}&lt;br /&gt;
|In combination with star charts, a sextant can be used to determine your position based on the location of stars in the night sky. Alternately, in combination with an accurate clock, a sextant can be used to find the position of the sun relative to the aircraft to determine the vehicle's position.  In a crash, you could use this to find your way to a safe place, but sextants are rarely used, and most people are not trained on how to operate one. GPS will also allow you to find your position, is built into many phones, and is faster and easier to use than a sextant. If you've got a homing beacon, it probably makes more sense to just activate that and wait for help to arrive.&lt;br /&gt;
&lt;br /&gt;
Until the early 1980s, long-range airplanes had a {{w|Air_navigation#Flight_navigator|flight navigator}} who used sextants and {{w|celestial navigation}} to determine the position of the airplane. Interestingly, it was much more accurate than early {{w|inertial navigation system}}s, and the accuracy of celestial navigation is still useful today. What made the sextant redundant was the INS' lower workload - the error accumulated by the INS during a long oceanic flight could always and easily be mitigated by other means, for example with {{w|VHF omnidirectional range|VOR}}/{{w|Non-directional beacon|NDB}} radio beacons.&lt;br /&gt;
&lt;br /&gt;
A form of the sextant has also famously been used in {{w|Apollo_PGNCS#Optical_units|spacecraft navigation}} and similarly applied {{w|star tracker}}s have been used extensively to guide space-going craft ranging from suborbital missiles to interplanetary probes.&lt;br /&gt;
|-&lt;br /&gt;
|Nose plugs and goggles for pressure&lt;br /&gt;
|Nose plugs and goggles are commonly used in swimming but would be useless for dealing with cabin pressurization or depressurization. Since your mouth and nose are interconnected, nose plugs would be useless on their own. Trying to hold your breath in a sudden depressurization event will cause lung damage, so nose plugs wouldn't be a good thing, even if you could also seal off your mouth. Goggles would also not be useful. During depressurization, the air would just seep out. During pressurization, they would just become uncomfortable and difficult to remove.&lt;br /&gt;
&lt;br /&gt;
Goggles were a typical piece of equipment for pilots of open cockpit airplanes, whose popularity peaked before the pandemic.{{Citation needed}} Nose plugs may be a reference to the spark plugs used on the engines of such vehicles.&lt;br /&gt;
&lt;br /&gt;
Or nose plugs may be mentioned as it is similar to, but a silly mistake to use in place of, the ear plugs some people use on airplanes to help prevent discomfort as a result of a change in pressure.&lt;br /&gt;
&lt;br /&gt;
|-&lt;br /&gt;
|Airplane shoes&lt;br /&gt;
|Airlines typically don't require the use of special footwear for passengers, nor do they provide special shoes. Before emergency egress, certain shoes (like high heels) must be discarded, though. Aircrew are also prohibited from wearing such shoes. May also be a reference to {{w|boat shoe|boat shoes}}, which are designed to reduce slipping on the wet decks of watercraft, or Japanese {{w|Toilets_in_Japan#Toilet_slippers|toilet shoes}}, which are put on as a sanitation measure when entering a toilet.&lt;br /&gt;
|-&lt;br /&gt;
|Navigation crystal&lt;br /&gt;
|Mystical form of navigation, presumably either for navigation during flight or to help you get home after a crash.&lt;br /&gt;
Crystals that polarize light can be used as a compass [http://www.polarization.com/viking/viking.html], but even then, their utility would be limited.&lt;br /&gt;
|-&lt;br /&gt;
|Spare batteries in case the plane runs out&lt;br /&gt;
|Airplanes will generally use more power than any battery small enough to be easily packed in a bag could provide. The aircraft will generally use either 115V AC at 400Hz or 28V DC, both of which are very uncommon outside of aviation. The airplane will almost never use its own batteries in-flight anyway, getting its electric power from the main engines, the APU, or, in emergencies, the ram air turbine or similar generating device. The batteries are generally only used on the ground when the engines are not running. Could be to charge a phone or similar device if the plane runs out of outlets.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Birdseed}}&lt;br /&gt;
|So one can attract birds. In practice, this wouldn't work for multiple reasons (high speed, altitude, and sealed windows being some of most obvious ones) and would pose a significant hazard of birds getting stuck in an engine if it did. Spreading birdseed before boarding ''could'' work to attract birds, but would be seen as misconduct by airport authorities, as attracting birds close to aircraft would pose a danger to the aircraft. Alternatively, birdseed can be used to attract birds after surviving a crash, e.g. to catch them for food.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Homing beacon}}&lt;br /&gt;
|Once activated, a homing beacon will send out a continuous radio signal so that rescuers can find your location. These can be very useful in a plane crash, but airplanes already carry them ({{w|Emergency position-indicating radiobeacon}}s), so you don't need to pack one yourself. Incidentally, the {{w|COSPAS-SARSAT}} system for locating distressed airplanes and ships was a cooperation started by the United States and the Soviet Union, and it was an elegant and simple solution that uses the {{w|Doppler effect}} of radio signals for accurate location - long before the {{w|Global Positioning System}}.&lt;br /&gt;
|-&lt;br /&gt;
|Meteorite antidote&lt;br /&gt;
|Meteorites are pieces of space rocks that make it all the way to the ground. They can cause injury but they aren't generally poisonous{{Citation needed}}, so an antidote would not help. The antidote could be an antidote to something else, possibly snakebite and be derived from meteorites but meteorites also lack verified medicinal properties.&lt;br /&gt;
|-&lt;br /&gt;
|USB wing connector&lt;br /&gt;
|This is just a wire connector, but because it has wing in the name is on the list. Alternatively, the plane wings connect by USB, and this can be used to reattach wings. Airplanes usually use the {{W|ARINC 429}} protocol (or, increasingly, TCP/IP, RS427, RS232, or even CANBUS) instead of USB protocols to facilitate electronic communication between flight computers and the engines, for example.&lt;br /&gt;
|-&lt;br /&gt;
|Emergency siren&lt;br /&gt;
|Very much like air horn, would be useful for helping with locating you in the event of crash. It shares many of the same downsides, but would also more likely get damaged by water in case of a water landing.&lt;br /&gt;
|-&lt;br /&gt;
|Spare {{w|Flap (aeronautics)|flaps}}&lt;br /&gt;
|Flaps can be moved to adjust the lift/drag ratio of a wing, and are generally deployed during takeoff and landing when the aircraft's speed is slower. Flaps are very large and mounted on the wing, outside the passenger compartment, so bringing spares would be very difficult and completely useless. Flaps failing to deploy can usually be remedied by just landing at a longer runway.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Mouthpiece (brass)|Mouthpiece}} (pandemic restriction; airlines still provide the trumpet)&lt;br /&gt;
|A part of a brass instrument like a trumpet. Randall jokes that trumpets are provided on airplanes (which would be very obnoxious to other passengers), but due to the pandemic you cannot use a shared mouthpiece. (You shouldn't share mouthpieces for anything anyway, in general.)&lt;br /&gt;
|-&lt;br /&gt;
|Luggage {{w|ballast}}&lt;br /&gt;
|Likely to make plane more balanced. While balancing weight in a plane is indeed a real problem, it is solved by rearranging luggage and adjusting engine power slightly. Introducing ballast would mean additional weight for no real reason.&lt;br /&gt;
Alternatively, while a common passenger issue is to have hand- and/or hold-luggage that exceeds the airline's personal allowance, this person has ''under''weight baggage and does not wish to 'waste' the difference, so bulks it up. (Noting that someone already with the rest of the items on this list is unlikely to suffer this 'problem'.)&lt;br /&gt;
|-&lt;br /&gt;
|Flag (international flights)&lt;br /&gt;
|To identify your country of origin. Other flags are also used to communicate between boats without electricity, in the event the boats are in distress, so they could be used in the event of a crash.&lt;br /&gt;
|-&lt;br /&gt;
|Decoy tickets&lt;br /&gt;
|Maybe these would used as a distraction so you can sneak onto the plane without paying?&lt;br /&gt;
But also a typical trope for fictional (and real life?) attempts to evade being tracked or followed. Buy tickets for one destination, that one assumes the opposition will be fully aware of, but also arrange for another set (probably with a 'clean' identity) for your intended destination and switch to using those once in the chaos of the departure-lounge.&lt;br /&gt;
|-&lt;br /&gt;
|Keys to the plane&lt;br /&gt;
|Although some people pushed for it after an airplane was stolen in the {{w|2018 Horizon Air Q400 incident}}, most commercial planes do not require keys to start the engine(s) like a car does. Likewise, plane doors are not locked with a key. Instead, they are secured with a tamper seal. If a seal is found broken, the plane is thoroughly checked for any wrong-doing.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[A lists of 20 items is given in two columns with 10 items in each. Each item is preceded by a checkbox. Most items only take up one line, but in the left column two items take up two and in the right one item take up three, so they take up the same space. Above is a large heading, with an explanation beneath it.]&lt;br /&gt;
:&amp;lt;big&amp;gt;&amp;lt;big&amp;gt;Air Travel Packing List&amp;lt;/big&amp;gt;&amp;lt;/big&amp;gt;&lt;br /&gt;
:&amp;lt;big&amp;gt;If you haven't flown in a while, you might not remember what you need to bring. Use this handy checklist to pack!&amp;lt;/big&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:[Left column:]&lt;br /&gt;
:☐ Seat cushion&lt;br /&gt;
:☐ Parachute&lt;br /&gt;
:☐ Wing glue&lt;br /&gt;
:☐ Air horn&lt;br /&gt;
:☐ Sextant&lt;br /&gt;
:☐ Nose plugs and goggles for pressure&lt;br /&gt;
:☐ Airplane shoes&lt;br /&gt;
:☐ Navigation crystal&lt;br /&gt;
:☐ Spare batteries in case the plane runs out&lt;br /&gt;
:☐ Birdseed&lt;br /&gt;
&lt;br /&gt;
:[Right column:]&lt;br /&gt;
:☐ Homing beacon&lt;br /&gt;
:☐ Meteorite antidote&lt;br /&gt;
:☐ USB wing connector&lt;br /&gt;
:☐ Emergency siren&lt;br /&gt;
:☐ Spare flaps&lt;br /&gt;
:☐ Mouthpiece (Pandemic restriction; airlines still provide the trumpet)&lt;br /&gt;
:☐ Luggage ballast&lt;br /&gt;
:☐ Flag (International flights)&lt;br /&gt;
:☐ Decoy tickets&lt;br /&gt;
:☐ Keys to the plane&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Aviation]]&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Animals]]&lt;/div&gt;</summary>
		<author><name>Ericprud</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2639:_Periodic_Table_Changes&amp;diff=288115</id>
		<title>2639: Periodic Table Changes</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2639:_Periodic_Table_Changes&amp;diff=288115"/>
				<updated>2022-07-03T12:47:43Z</updated>
		
		<summary type="html">&lt;p&gt;Ericprud: s/chemicals like carbon/elements like carbon/&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2639&lt;br /&gt;
| date      = June 29, 2022&lt;br /&gt;
| title     = Periodic Table Changes&lt;br /&gt;
| image     = periodic_table_changes.png&lt;br /&gt;
| titletext = It's nice how the end of the periodic table is flush with the edge these days, so I think we should agree no one should find any new elements after #118 unless they discover a whole row at once.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a Cool Magnet - Please change this comment when editing this page. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
The {{w|periodic table}} is a table used to arrange {{w|chemical elements}} according to their chemical and physical properties. This comic proposes &amp;quot;changes&amp;quot; to the periodic table that would be more pleasant aesthetically or make the periodic table look more regular. Some of these are (somewhat) practical changes to element abbreviations that could improve clarity in English, though changing documents to use different abbreviations would probably be more trouble than it's worth. However, other changes move elements around without taking into account that elements would stop being arranged by their properties. The periodic table would stop being useful after such changes unless said changes were meant to physically change the material properties of the elements, which would be impossible{{citation needed}}, although the comic plans to solve the problem with &amp;quot;free training&amp;quot; to their atomic behavior.&lt;br /&gt;
&lt;br /&gt;
Other modifications make up new elements or remove existing ones from the table, which would not be a reasonable decision given that the periodic table is supposed to include all existing elements, whether they make the table neater or they don't.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Proposed change !! Explanation&lt;br /&gt;
|-&lt;br /&gt;
|Move helium over here. It fits nicely!||Helium is moved from the upper right corner to the second column next to hydrogen.  However, the reason it is placed at the far-right Group 18 and not Group 2 is because it is a {{w|noble gas}}, rather than a reactive {{w|alkaline earth metal}}. You could say helium is in group 2 because it has two electrons in its outer shell, but normal periodic tables place it in group 18, the noble gases, with which it has far more in common. Hydrogen has similar problems being in group 1, as it's a non-metal and the elements below it are metals which don't have much in common with it chemically. There are periodic tables that show hydrogen floating above the periodic table for that reason.&lt;br /&gt;
&lt;br /&gt;
Group 18 was not known at the time of the original table, which used I-VII (1-7) for the otherwise full-height columns, which turns out to reflect the number of free ('valence') electrons in their outer 'orbit', in one useful understanding of the atomic model. When added, the new final column was called either VIII (having a full outer shell) or Group 0 (having none free) and placed to the right of VII. It was originally thought that these so-called &amp;quot;noble gases&amp;quot; (no relation to Alfred Nobel of explosives and science prize fame) were unable to react with other elements. However, xenon compounds were discovered in 1962, and many other {{w|noble gas compounds}} have been discovered since then under a variety of conditions.&lt;br /&gt;
&lt;br /&gt;
From the fourth row downwards the inserted block of Transition Metals represent a larger electron shell with more positions for free electrons and those elements to the right would have more electrons than those above them, by this measure, but their physical properties are still best dictated and aligned by the complement to the valence (i.e. the gap-size). The current numbering system shows the outer-shell electrons accurately in the rows where the ten new columns are, but the upper rows of columns 13-18 have ten more (or sixteen more, for Helium) than is the case. Similarly, once lanthanides and actinides are considered, the group number and outer-shell count becomes disconnected again in the opposite way. But it still seems useful enough to currently label in this manner under current {{w|IUPAC}} guidance.&lt;br /&gt;
|-&lt;br /&gt;
|Elements in this corner are cool. Add more!|| TBD (to be determined). Elements in that corner, such as carbon, oxygen, phosphorous, and nitrogen, participate in covalent bonding and are the primary elements involved in biochemical reactions, which may be why they are considered cooler than other elements. &lt;br /&gt;
|-&lt;br /&gt;
|Sp (Spite element)||Wedged between fluorine and neon. This is a reference to spite houses, houses jammed into a narrow space to block other construction, or spite fences, which are fences built to annoy neighbors. However, such an element would have an atomic number greater than fluorine's (9) but less than neon's (10).&lt;br /&gt;
|-&lt;br /&gt;
|Merge these boring metals with titanium to make *tixanium*||Tixanium (Tx) replaces five metals, including titanium (Ti). This may be a reference to the term &amp;quot;UX&amp;quot; (user experience) being used instead of &amp;quot;UI&amp;quot; (user interface) as more of an umbrella term.&lt;br /&gt;
&lt;br /&gt;
While titanium certainly has an impressive name, and is used in the aerospace industry and other high-performance applications, the others are hardly boring; manganese, for example, was part of the cover story for the top-secret {{w|Project Azorian}}.&lt;br /&gt;
|-&lt;br /&gt;
&lt;br /&gt;
|Update Latin/Neo-Latin symbols to match names. This isn't ancient Rome.&lt;br /&gt;
* Sodium: Na (Natrium) =&amp;gt; So&lt;br /&gt;
* Potassium: K (Kalium) =&amp;gt; Pm&lt;br /&gt;
* Iron: Fe (Ferrum) =&amp;gt; I&lt;br /&gt;
* Silver: Ag (Argentum) =&amp;gt; Sv&lt;br /&gt;
* Gold: Au (Aurum) =&amp;gt; Gd&lt;br /&gt;
* Tin: Sn (Stannum) =&amp;gt; Tn&lt;br /&gt;
* Lead: Pb (Plumbum) =&amp;gt; Ld&lt;br /&gt;
|Since I is already used for Iodine, it gets a new abbreviation Io, and Gadolinium is re-abbreviated to Gm to free up Gd.&lt;br /&gt;
&lt;br /&gt;
Note that most of these changes will actually make the table less readable if one considers languages other than English. For example, in European languages, 'I' for iron will work for Irish (but not for Dutch, as 'ijzer' doesn't really start with 'i' but with 'ij'. It would be capitalized, e.g. at the start of a sentence, as 'IJzer'.) while 'Fe' currently matches in French, Italian, Portuguese, and most of the languages in Spain. Similarly, Natrium is still used in most Germanic languages.&lt;br /&gt;
&lt;br /&gt;
This group of changes doesn't include antimony (Sb -- stibium), but that’s because it gets replaced by “carbon III” (see below). Nor is copper changed from its &amp;quot;Cu&amp;quot; for &amp;quot;cuprum&amp;quot;.&lt;br /&gt;
|-&lt;br /&gt;
|Replace the blander post-transition metals with new kinds of carbon||&lt;br /&gt;
* Indium (In) -&amp;gt; C II.&lt;br /&gt;
* Antimony (Sb) -&amp;gt; C III.&lt;br /&gt;
* Tellurium (Te) -&amp;gt; C IV.&lt;br /&gt;
* Thallium (Tl) -&amp;gt; C V.&lt;br /&gt;
* Bismuth (Bi) -&amp;gt; C VI.&lt;br /&gt;
Carbon can make four covalent bonds, which means it can form a huge range of chemicals, above all ones vital to life. The post-transition metals don't have this level of interest. If there were more elements like carbon, it could allow more exciting chemistry and perhaps new kinds of life. &lt;br /&gt;
|-&lt;br /&gt;
|That W annoys me|| Tungsten: W (Wolfram) -&amp;gt; Tg.&lt;br /&gt;
&lt;br /&gt;
Another element whose symbol doesn't match its English name. &amp;quot;Wolfram&amp;quot; is the name for tungsten in some languages and is derived from the mineral wolframite, which comes from the name &amp;quot;wolf rām&amp;quot; in Middle High German (wolf soot). &lt;br /&gt;
&lt;br /&gt;
Oddly, despite changing Latin and German abbreviations to English, Randall does not change the symbol for mercury (Hg from the Greek &amp;quot;hydrargyrum&amp;quot;).&lt;br /&gt;
&lt;br /&gt;
|-&lt;br /&gt;
|3.4% of all elements are named after Ytterby, Sweden (pop. 3,000). Let's keep Yttrium, but rename the other 3 after bigger cities (Tokyium, Delhium, and Jakartium?) to be more fair.&lt;br /&gt;
|Four elements -- yttrium (Y), ytterbium (Yb), terbium (Tb) and erbium (Er) -- are named after {{w|Ytterby}}, a Swedish village where they were discovered. Scandium (Sc), thulium (Tm), holmium (Ho) and gadolinium (Gd) were isolated from minerals found in the same quarry. Randall suggests naming 3 of them after some other major world cities, despite those cities having no connection to those elements. &lt;br /&gt;
* Terbium (Tb) -&amp;gt; Tokyium (Ty) - Tokyo&lt;br /&gt;
* Erbium (Er) -&amp;gt; Delhium (Dh) - Delhi&lt;br /&gt;
* Ytterbium (Yb) -&amp;gt; Jakartium (Jk) - Jakarta&lt;br /&gt;
Randall may be using using 2010 census data (2946); Ytterby mine is located on the island of Resarö, found under 0187TB103 in table [https://www.scb.se/en/finding-statistics/statistics-by-subject-area/environment/land-use/localities-and-urban-areas/pong/tables-and-graphs/localities-2020-population-land-area-population-density-per-locality/ MI0810], population 3212 (2020 census).&lt;br /&gt;
&lt;br /&gt;
Interestingly, [https://en.wikipedia.org/wiki/Isaac_Asimov Isaac Asimov] made essentially the same remark in his science essay ''The Multiplying Elements'', saying that it was a waste of element names that could have been used to honor great contributors to chemistry. One obvious candidate would be [https://en.wikipedia.org/wiki/Henry_Moseley Henry Moseley] (mentioned in another of Asimov's essays, ''The Nobel Prize That Wasn't'') who used early X-ray spectroscopy to resolve the confusion over rare earth elements, finally put the Periodic Table on a firm ground and conceived the idea of &amp;quot;Atomic Number&amp;quot;.&lt;br /&gt;
|-&lt;br /&gt;
|Inserting the lanthanides and actinides properly makes the table too wide. Triage is needed. Each element will be offered free training to help adjust to its new column.||Though the lanthanides and actinides typically are placed underneath the bottom of the table, they actually belong in the 6th and 7th rows of the table between the 2nd and 3rd columns, as they are numbered elements 57-70 and 89-102. This section of the table is typically excised to give the overall shape more appealing dimensions; including this section in the main table [https://sciencenotes.org/wp-content/uploads/2017/01/PeriodicTableExtended.png extends the length dramatically]. This proves rather unwieldy especially when referencing the table for the lower-numbered elements, which are generally more common, and/or elements far to the sides of the table, which are often more influential in chemical reactions. Randall recommends that a subset of these elements be placed in a new row at the bottom of the table (making them elements 93-110) and they will receive &amp;quot;training&amp;quot; to adjust to their new columns. &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The title text suggests discovering elements only in entire rows at once. Elements with more protons than 118 could be discovered in future by collisions in particle accelerators, but aren't likely to be discovered in an entire row at a time.&lt;br /&gt;
&lt;br /&gt;
Changing the periodic table was also the topic of [[2214: Chemistry Nobel]], and the red-ink style of &amp;quot;aesthetic&amp;quot; revision over a complex and established diagram is highly reminiscent of [[1902: State Borders]] and [[2351: Standard Model Changes]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:Changes I would make to the periodic table&lt;br /&gt;
:[A modified periodic table is shown, with changes in red.]&lt;br /&gt;
&lt;br /&gt;
:[Helium is moved from the upper right corner to the second column next to hydrogen.]&lt;br /&gt;
:Move helium over here. It fits nicely!&lt;br /&gt;
:[Two elements labeled TBD are added to the left of boron and aluminium.]&lt;br /&gt;
:Elements in this corner are cool. Add more!&lt;br /&gt;
:[A narrow triangular shape is wedged between fluorine and neon.]&lt;br /&gt;
:Sp (Spite element)&lt;br /&gt;
:[Tx replaces five elements: scandium, titanium, vanadium, chromium and manganese.]&lt;br /&gt;
:Merge these boring metals with titanium to make *tixanium*&lt;br /&gt;
:[The symbols of sodium, potassium, iron, silver, gold, tin and lead are changed to use letters from their English names.]&lt;br /&gt;
:Update Latin/Neo-Latin symbols to match names. This isn't ancient Rome.&lt;br /&gt;
:[The symbols of indium, antimony, tellurium, thallium and bismuth are changed to symbols containing the letter C followed by Roman numerals II to VI, respectively.]&lt;br /&gt;
:Replace the blander post-transition metals with new kinds of carbon&lt;br /&gt;
:[The symbol of tungsten is changed from W to Tg.]&lt;br /&gt;
:That W annoys me&lt;br /&gt;
:[Neodymium is highlighted.]&lt;br /&gt;
:Neodymium can stay—magnets are cool&lt;br /&gt;
:[A subset of lanthanides and actinides are to be placed under the bottom of the main table into a single row.]&lt;br /&gt;
:Move&lt;br /&gt;
:Inserting the lanthanides and actinides properly makes the table too wide. Triage is needed. Each element will be offered free training to help adjust to its new column.&lt;br /&gt;
:[The symbols of terbium, erbium and  ytterbium are changed to Ty, Dh and Jk, respectively.]&lt;br /&gt;
:3.4% of all elements are named after Ytterby, Sweden (pop. 3,000). Let's keep yttrium, but rename the other 3 after bigger cities (tokyium, delhium, and jakartium?) to be more fair.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Chemistry]]&lt;br /&gt;
[[Category:Comics with color]]&lt;/div&gt;</summary>
		<author><name>Ericprud</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2317:_Pinouts&amp;diff=193162</id>
		<title>2317: Pinouts</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2317:_Pinouts&amp;diff=193162"/>
				<updated>2020-06-10T14:56:26Z</updated>
		
		<summary type="html">&lt;p&gt;Ericprud: Labs *and hospitals*...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2317&lt;br /&gt;
| date      = June 8, 2020&lt;br /&gt;
| title     = Pinouts&lt;br /&gt;
| image     = pinouts.png&lt;br /&gt;
| titletext = The other side of USB-C is rotationally symmetric except that the 3rd pin from the top is designated FIREWIRE TRIBUTE PIN.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a FIREWIRE TRIBUTE PIN. Should include a column for the actual purpose of the pin. Do NOT delete this tag too soon.}}&lt;br /&gt;
Electronics connectors are designed to transport both information and power. A {{w|pinout}} diagram describes the function of each pin such as to communicate data, transport power, physical function (keying), etc. In this comic there is an absurd alternative to the actual pins used in connectors. The pin labels are references to many tech issues and attributes, and not all may be documented correctly here.&lt;br /&gt;
&lt;br /&gt;
Hardware hobbyists might feel excitement at seeing a unified specification for these common connectors, but the comic is of course humorous. The real life diagrams are as follows: [http://unitedtechnologies.com.pk/Nti/image/10ci.png HDMI], [https://www.arrow.com/en/research-and-events/articles/micro-connector-usb-pinout Micro USB], [https://www.allaboutcircuits.com/technical-articles/introduction-to-usb-type-c-which-pins-power-delivery-data-transfer/ USB-C].&lt;br /&gt;
&lt;br /&gt;
=== HDMI ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Label !! Explanation !! Pin No. !! Actual purpose&lt;br /&gt;
|-&lt;br /&gt;
| +3.3V DC&lt;br /&gt;
| 3.3V is a typical voltage in digital electronics. The &amp;quot;+&amp;quot; Indicates a voltage positive with respect to ground.&lt;br /&gt;
| 1&lt;br /&gt;
| TMDS Data2+&lt;br /&gt;
|-&lt;br /&gt;
| Data&lt;br /&gt;
| Most digital communications cables contain at least one wire that carries data. {{w|Serial communication}} protocols have one data line. Typically there will be a more descriptive name if there are multiple data pins. &amp;quot;Data&amp;quot; and &amp;quot;3.3V&amp;quot; set up the appearance of a normal pinout diagram to experienced readers.&lt;br /&gt;
| 2&lt;br /&gt;
| TMDS Data2 Shield&lt;br /&gt;
|-&lt;br /&gt;
| -3.3V DC&lt;br /&gt;
| Negative voltages were used more frequently in the past; however, modern systems typically generate any negative voltages they might require internally from the given positive voltages. This could be a reference to frustration specification implementers have to go through when handling hardware quirks: negative voltages are very abnormal, and would require design alteration to meet, but the designers of a ubiquitous plug can do whatever they want.&lt;br /&gt;
| 3&lt;br /&gt;
| TMDS Data2-&lt;br /&gt;
|-&lt;br /&gt;
| +5V&lt;br /&gt;
| 5V is a typical voltage in digital electronics. The &amp;quot;+&amp;quot; Indicates a voltage positive with respect to Ground. Typically this is assumed to be DC. V is also the Roman numeral for 5.&lt;br /&gt;
| 4&lt;br /&gt;
| TMDS Data1+&lt;br /&gt;
|-&lt;br /&gt;
| Tx&lt;br /&gt;
| &amp;quot;Tx&amp;quot; typically refers to pins used to transmit as opposed to &amp;quot;Rx&amp;quot; (receive).&lt;br /&gt;
| 5&lt;br /&gt;
| TMDS Data1 Shield&lt;br /&gt;
|-&lt;br /&gt;
| +6VI&lt;br /&gt;
| V is usually used to represent volts, but here, VI represents the Roman numeral 6. (See Pin 4)&amp;lt;br&amp;gt;Voltages above 5 are not usually used in micro-circuitry cables.&amp;lt;br&amp;gt;The product VI (Voltage * Current) is equal to Power.&lt;br /&gt;
| 6&lt;br /&gt;
| TMDS Data1-&lt;br /&gt;
|-&lt;br /&gt;
| Wx&lt;br /&gt;
| &amp;quot;Wx&amp;quot; does not typically exist in the &amp;quot;Tx&amp;quot;/&amp;quot;Rx&amp;quot; scheme. In the weather forecasting community, Wx means &amp;quot;weather&amp;quot;.&lt;br /&gt;
| 7&lt;br /&gt;
| TMDS Data0+&lt;br /&gt;
|-&lt;br /&gt;
| +7VII&lt;br /&gt;
| V is usually used to represent volts, but here, VII represents the Roman numeral 7, continuing the pattern from above.&lt;br /&gt;
| 8&lt;br /&gt;
| TMDS Data0 Shield&lt;br /&gt;
|-&lt;br /&gt;
| Rx Only&lt;br /&gt;
| &amp;quot;Rx&amp;quot; typically refers to pins used to receive as opposed to &amp;quot;Tx&amp;quot; (transmit). This description might also be related to the fact that most Ethernet devices can exchange the Rx and Tx port automatically, if needed, in order to eliminate the need for crossover cables and the fact that it is possible to insert the USB-C connector rotated by 180°.&amp;lt;br&amp;gt;Additionally, &amp;quot;Rx&amp;quot;, standing for the Latin &amp;quot;recipe&amp;quot; is a common abbreviation for {{w|medical prescription}}s. Some medicines are prescription only or, in other words, &amp;quot;Rx Only&amp;quot;. &lt;br /&gt;
| 9&lt;br /&gt;
| TMDS Data0-&lt;br /&gt;
|-&lt;br /&gt;
| Antidata&lt;br /&gt;
| Some ports use differential signaling, where a signal and its inverse are sent over a pair of pins (e.g. D+ and D-). The combined signal is more robust to interference. This mixes that practice with a humorous reference to the notion of matter versus antimatter. Currently there is no such thing as antidata. Antidata pins could be needed in the future as low-entropy or high-entropy source in quantum communication connectors to securely dispose of data.&lt;br /&gt;
| 10&lt;br /&gt;
| TMDS Clock+&lt;br /&gt;
|-&lt;br /&gt;
| Unknown&lt;br /&gt;
| Occasionally extra pins will be included for future use; however they will typically be labeled &amp;quot;reserved&amp;quot; to point out that their usage is not yet defined. The use of &amp;quot;unknown&amp;quot; suggests that this pinout is based on an incomplete reverse-engineering of the HDMI format, instead of on the official documentation, or maybe the official documentation doesn't explain it and this pin's function is being kept as a secret by the ones who designed it.&lt;br /&gt;
| 11&lt;br /&gt;
| TMDS Clock Shield&lt;br /&gt;
|-&lt;br /&gt;
| Water&lt;br /&gt;
| Labs and hospitals often have ports connecting to common sources of various supplies (oxygen, water, fuel, vacuum).&lt;br /&gt;
| 12&lt;br /&gt;
| TMDS Clock-&lt;br /&gt;
|-&lt;br /&gt;
| +240V DC&lt;br /&gt;
| This is a reference to heavy-duty home and commercial appliances, which use 240V AC for power. Additionally, many cable specifications try to provide a way to power devices over them (PS/2, USB, Power over Ethernet,) but these small communication cables usually carry only DC and not AC electricity.&lt;br /&gt;
High voltage power is only sometimes used in small communications connectors. It might help to keep the current of power lines low to avoid generating excess heat. With +240V DC inside the HDMI cable, monitors would not need any longer a separate power plug. This is similar to Power-over-Ethernet, which does not exceed 60V, or ISDN, which goes up to 110V depending on country, and helps surveillance cameras or telephones to work with one connecting cable only. But with this much voltage on such a small cable, a short could lead more likely to melting the insulation and wiring in a sudden burst of toxic smoke. The produced thermal power through a short with resistance R_short that is building up is U²/R_short, increasing with the square of the voltage (also the breakdown voltage of the isolation is more easily reached). However, a high voltage reduces the chance of a peripheral drawing too much current, which could cause a fire on thin wires otherwise: The current through the cable for a device, needing a given power of P, is I = P_dev/U, the thermal power of the cables with resistance R is P_cables = R_cables*I² = R_cables*P_dev²/U², so it is reduced by the square of the voltage.&lt;br /&gt;
| 13&lt;br /&gt;
| CEC&lt;br /&gt;
|-&lt;br /&gt;
| Vacuum&lt;br /&gt;
| Labs often have ports connecting to common sources of various supplies (oxygen, water, fuel, vacuum).&lt;br /&gt;
| 14&lt;br /&gt;
| Reserved (1.0-1.3a), Utility (1.4+, optional)&lt;br /&gt;
|-&lt;br /&gt;
| 5V AC&lt;br /&gt;
| Pins often supply low voltage direct current to devices. This pin supplies 5V {{w|alternating current}}, which is not typically supplied. AC is used in {{w|Electric power transmission|electrical transmission}} because it can be stepped up to high voltage to minimize transmission losses, then stepped down to more useful voltages right before loads. DC power is required for logic circuitry like in computers. Conversion between the the two kinds of power everywhere would make for transformers being embedded in most modern devices, taking extra materials to manufacture and losing a significant percentage of all electricity in the conversion. Having both is not entirely unheard of: the Commodore 64 power supply provides both DC, for the logic of the motherboard; and AC, for powering the tape drive.&lt;br /&gt;
| 15&lt;br /&gt;
| SCL (I²C serial clock for DDC)&lt;br /&gt;
|-&lt;br /&gt;
| Amazon Copyright Pin&lt;br /&gt;
| HDMI can optionally be protected by a {{w|digital rights management}} (DRM) scheme, known as {{w|High-bandwidth Digital Content Protection|HDCP}}. This pin humorously implies the presence of a different DRM scheme specific to {{w|Amazon (company)|Amazon}} the company, as well as poking fun at the fact that copyright is an explicit part of the HDMI protocol (although it is not assigned to a specific pin). This is likely a reference to how chips and cables and specifications often have specific strange additions or functionality in them to meet the requests of various bodies invested in the design process: additionally after reverse engineering many strange things have been found laying around in the functionality of hardware that do unexpected special things.&lt;br /&gt;
| 16&lt;br /&gt;
| SDA (I²C serial data for DDC)&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| GND typically refers to &amp;quot;ground&amp;quot; on pinout diagrams. Remarkably, this is correct.&lt;br /&gt;
| 17&lt;br /&gt;
| DDC/CEC Ground&lt;br /&gt;
|-&lt;br /&gt;
| Decorative&lt;br /&gt;
| Decorative elements are pieces of an assembly that serve only an aesthetic purpose without any technical function. This would not be particularly useful inside a connector, as almost no one will ever see it--however, in HDMI, pin 14 was reserved for future use in versions 1.0–1.3a (and was only assigned an official use in 1.4). A decorative pin is also a popular piece of jewelry.&lt;br /&gt;
| 18&lt;br /&gt;
| +5V&lt;br /&gt;
|-&lt;br /&gt;
| Ground&lt;br /&gt;
| Compared to Pin 17 (&amp;quot;GND&amp;quot;), this appears to be the same ground pin. However, the presence of both GND and Ground seems to imply that GND represents something other than the standard &amp;quot;ground&amp;quot; pin. Alternatively, this pin could supply &amp;quot;Ground&amp;quot; as in soil (like the &amp;quot;soup&amp;quot; electrical outlet from [[1293: Job Interview|1293]]). Some systems have different grounds for analog and digital sections, but they would typically be disambiguated by terms like AGND. Many pinouts have multiple grounds or DC supplies with no apparent explanation, seen more prominently on Randall's USB connector.&lt;br /&gt;
| 19&lt;br /&gt;
| Hot Plug Detect&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
The {{w|HDMI}} interface uses four pairs of shielded twisted-pair connectors, along with seven other connectors. ({{w|Twisted pair}} means a wire is wrapped with the other wire that returns the current to the original device, thus minimizing electromagnetic noise. Shielding refers to wrapping a cable with a conductor to absorb the energy of noise.) Three of these pairs are for data (TMDS Data0, Data1, and Data2) and the other is a clock. These pairs take up three pins as one of them is a ground pin for the shielding wrapped around each pair. TMDS stands for &amp;quot;{{w|Transition-minimized differential signaling}}&amp;quot; and is also used in the DVI standard.&lt;br /&gt;
&lt;br /&gt;
DDC stands for &amp;quot;Display Data Channel&amp;quot; and is based on the {{w|I²C}} serial standard. It is used to allow the transmitting device to learn what formats of data the receiving device can accept.&lt;br /&gt;
&lt;br /&gt;
CEC stands for &amp;quot;Consumer Electronics Control&amp;quot; and is supposed to allow a single remote control to control multiple devices.&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Hot Plug Detect&amp;quot; refers to hot-plugging, where a cable is connected to a device already turned on. The device should then ideally detect that the cable has been plugged in and respond appropriately.&lt;br /&gt;
&lt;br /&gt;
=== Micro USB ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Label !! Explanation !! Pin No. !! Actual Purpose&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| A ground pin&lt;br /&gt;
| 1&lt;br /&gt;
| +5 V&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| A second ground pin&lt;br /&gt;
| 2&lt;br /&gt;
| Data- (Differential signalling)&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| A third ground pin&lt;br /&gt;
| 3&lt;br /&gt;
| Data+&lt;br /&gt;
|-&lt;br /&gt;
| USB&lt;br /&gt;
| Apparently the only data pin in this connector. This could be a play on how the USB specification tries to squeeze all data onto a single channel as if it is a software protocol rather than specializing the structure of a physical cable to provide for rapidly carrying the information likely to flow over it. USB is an external packet network similar to Ethernet, but uses a totally new design without any reuse of prior similar specification. Ironically, in the real Micro- and Mini-USB standards, this pin is not connected to a wire in the cable.&lt;br /&gt;
| 4&lt;br /&gt;
| On-The-Go ID, does not have a wire in the cable.&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| A fourth ground pin. A real micro USB only has one ground pin, in addition to the metal plug housing. This is the location of the actual ground pin.&lt;br /&gt;
| 5&lt;br /&gt;
| Ground.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
A ground pin is commonly found on USB and other pin connectors. At least one ground is necessary to complete the circuit, and some cables use multiple ground lines to distribute current or to support {{w|twisted pair}}s. However, there is no purpose served by having many more ground pins than data pins. Therefore, it seems rather silly for the micro USB to have 4 ground pins and only 1 functional &amp;quot;USB&amp;quot; pin. It also does not give much information about what the &amp;quot;USB&amp;quot; pin would do, as opposed to a standard pinout diagram. This diagram also leaves out the +5V power pin that is present in the real micro USB connector, which would render most USB peripherals unable to function.&lt;br /&gt;
&lt;br /&gt;
The ordering and count of the pins may be an allusion to {{w|Monty Python}}'s {{w|Spam (Monty Python)|&amp;quot;Spam&amp;quot;}} sketch, in which one of the many Spam-related menu items is &amp;quot;Spam, Spam, Spam, egg, and Spam&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== USB-C ===&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Label !! Explanation !! Pin No. !! Actual Purpose&lt;br /&gt;
|-&lt;br /&gt;
| +5V DC&lt;br /&gt;
| A common electronics supply voltage.&lt;br /&gt;
| A12&lt;br /&gt;
| Ground&lt;br /&gt;
|-&lt;br /&gt;
| +3.3V DC&lt;br /&gt;
| Another common electronics supply voltage. This pin is not present on USB type C, mostly because the voltage is too low to supply useful levels of power at the current limit of the pins.&lt;br /&gt;
| A11&lt;br /&gt;
| Rx2+ (Differential Signalling for Superspeed or alternate modes)&lt;br /&gt;
|-&lt;br /&gt;
| +120V AC&lt;br /&gt;
| Residential supply voltage in the United States; its use on an electronics connector would be very unusual, as it would burn out any unguarded transistor-logic electronics, producing smoke and melting the metal together such that the cable likely couldn't be removed. But this high a voltage might be an allusion to the high voltages USB-C screens and similar devices can request in order to get enough energy without exceeding the cable's current limit.&lt;br /&gt;
| A10&lt;br /&gt;
| Rx2-&lt;br /&gt;
|-&lt;br /&gt;
| Boobytrap Pin (Pure solder)&lt;br /&gt;
| {{w|Solder}} is a metal alloy with a low melting temperature (typically around 360°C, but in special cases melting points between 90°C and 450°C or above are available), used to bond electronic components together permanently. Most solder materials are quite ductile so it might be too easy for the forces a connector is subject to to permanently change their shape. Along with the fact that the resistance of solder is typically way higher than that for copper the pin under heavy electrical stress could overheat and melt, thus bonding the connector to its receptacle, and thereby &amp;quot;trapping&amp;quot; the receptacle. Additionally putting a pin that might slightly change their shape directly next to a high voltage pin means risking accidentally connecting two power rails with entirely different voltages together (causing an overvoltage in the lower-voltage rail that is likely to break the circuit, as has happened with some Apple devices). In this case the +120V AC pin might be able to deliver enough power to actually fuse the solder-only pin. This could also be a reference to increasing publicity around the fields of electronics security: hobby reverse engineers have been finding ways for some time now to evade the blown fuses in microcircuitry preventing them from being reprogrammed, using glitching techniques.&lt;br /&gt;
| A9&lt;br /&gt;
| VBUS (+5V)&lt;br /&gt;
|-&lt;br /&gt;
| Mechanical&lt;br /&gt;
| All connectors include portions whose job is to ensure a solid connection between the cable and the port. This is typically not the job of the pins, however. In real USB type C connectors, this task is performed by the center tongue of the female connector. It could also imply transmission of energy or signal through a mechanical principle, such as torque or reciprocating motion.&lt;br /&gt;
| A8&lt;br /&gt;
| SBU1 (Sideband Use)&lt;br /&gt;
|-&lt;br /&gt;
| +3.3eV/C&lt;br /&gt;
| {{w|Electron-volts}} per {{w|coulomb}} would be a very unusual unit to see in a pinout. These units are used in particle physics, but the appearance is very similar to the common 3.3V supply. It would be a unit of electric potential equivalent to approximately 1.60217662 * 10&amp;lt;sup&amp;gt;-19&amp;lt;/sup&amp;gt; volts. Thus 3.3eV/C would be 5.287183 * 10&amp;lt;sup&amp;gt;-19&amp;lt;/sup&amp;gt; volts, or slightly more than 1/2 attovolts. It could also be read as +3.3 eV/c (per {{w|speed of light}}), in which case it is equivalent to a momentum of 5.3E-28 kg m/s, In high-energy physics, the momentum of particles is sometimes expressed in MeV/c or GeV/c units.&lt;br /&gt;
| A7&lt;br /&gt;
| D- (USB 2.0 Data)&lt;br /&gt;
|-&lt;br /&gt;
| Candlepin&lt;br /&gt;
| Randall is making a pun on the word ''pin'', which refers to a electrical connector pin as well as a thing to knock down in bowling. {{w|Candlepin bowling}} is a form of bowling.&lt;br /&gt;
| A6&lt;br /&gt;
| D+&lt;br /&gt;
|-&lt;br /&gt;
| Facebook use&lt;br /&gt;
| This would imply that Facebook had a hand in specifying USB type C, and had a pin dedicated to their use. This could be seen as strange given Facebook's primary business is web technology and would have little need for a dedicated pin in the USB standard, but a lot of back doors have been found in electronics.&lt;br /&gt;
| A5&lt;br /&gt;
| CC1 (Configuration Channel)&lt;br /&gt;
|-&lt;br /&gt;
| +5V (Positrons)&lt;br /&gt;
| {{w|Positron}}s are the antimatter counterparts to electrons. So this pin is supplying +5V, but does so by sourcing positrons into the device rather than sinking electrons out. Positrons cannot be conducted through normal matter conductors as they would annihilate the electrons.&lt;br /&gt;
| A4&lt;br /&gt;
| VBUS (+5V)&lt;br /&gt;
|-&lt;br /&gt;
| Pin Roulette&lt;br /&gt;
| Presumably in the same vein as &amp;quot;{{w|Chatroulette}}&amp;quot;, this pin's purpose is not rigidly defined and is instead left to chance. According to the title text, this pin's counterpart on the other side of the connector is the &amp;quot;FireWire Tribute Pin&amp;quot;, so this cable would only be truly rotationally symmetric (which is the whole point of the USB-C connector) when the pin roulette ball lands on that same function.&lt;br /&gt;
| A3&lt;br /&gt;
| Tx1- (Differential Signalling for Superspeed or alternate modes)&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| Ground pin. Typically denoted as &amp;quot;GND&amp;quot;.&lt;br /&gt;
| A2&lt;br /&gt;
| Tx1+&lt;br /&gt;
|-&lt;br /&gt;
| SKY&lt;br /&gt;
| Reference to the ground pin, which refers to the common grounding on the larger metal body. There is no corresponding &amp;quot;sky&amp;quot; pin, although sky is often thought as the opposite of ground.&lt;br /&gt;
| A1&lt;br /&gt;
| GND&lt;br /&gt;
|-&lt;br /&gt;
| FireWire Tribute Pin&lt;br /&gt;
| ''In title text:'' {{w|FireWire}} is Apple's version of IEEE 1394 which is a 6 pin connector that has a ground pin, a power pin and two pairs of data pins. It was something of a competitor to USB, and had faster data rates than USB 2.0, but is much less popular now, and has essentially been replaced by {{w|Thunderbolt (interface)|Thunderbolt}}. Presumably the writers of the USB-C standard (which far outpaces its data rates) wished to memorialize it somehow, although it's not clear how the pin actually works for that purpose.&lt;br /&gt;
| B3&lt;br /&gt;
| Tx2-&lt;br /&gt;
|}&lt;br /&gt;
The two sides of a USB C connector are labeled &amp;quot;A&amp;quot; and &amp;quot;B&amp;quot;. These are rotationally symmetric, mostly. For example, B10 and B11 are Rx1, a separate twisted-pair for receiving information in Superspeed mode compared to A10 and A11's Rx2. This gives two Rx/Tx pairs for Superspeed use. CC1 and SBU1 are mirrored to CC2 and SBU2. However, the D, VBUS, and GND pins are perfectly mirrored.&lt;br /&gt;
&lt;br /&gt;
The fact that only half of the USB-C pins are documented might hint to an alternative way to manufacture connectors that can be inserted rotated by 180°: Make the receiver use only the right side of the pins and make the sender connect both the left and the right side so all Pins that might match a function are connected correctly no matter if the cable is rotated by 180°. However, doing this would result in only having one Rx/Tx pair for Superspeed use.&lt;br /&gt;
&lt;br /&gt;
=== Coax ===&lt;br /&gt;
&lt;br /&gt;
An {{w|RF connector|coaxial RF connector}} has two contacts - one pin, and the shield; typically the whole connector is labeled with whatever function/signal is carried by the pair.  The joke here is that the label is ''technically'' correct (the best kind of correct), but not very useful to the end user, as it does not specify the voltage rating, impedance, connector size, or other useful information about the cable.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
:[Caption at top]&lt;br /&gt;
:Pinouts&lt;br /&gt;
:Quick Reference Guide&lt;br /&gt;
&lt;br /&gt;
:[Four common connectors are depicted - vertically, rather than the usual horizontal orientation.]&lt;br /&gt;
&lt;br /&gt;
:[The first connector is a 19-pin HDMI connector.]&lt;br /&gt;
:[The nine pins on the left are labeled:]&lt;br /&gt;
:*Data&lt;br /&gt;
:*+5V&lt;br /&gt;
:*+6VI&lt;br /&gt;
:*+7VII&lt;br /&gt;
:*Antidata&lt;br /&gt;
:*Water&lt;br /&gt;
:*Vacuum&lt;br /&gt;
:*Amazon Copyright Pin&lt;br /&gt;
:*Decorative&lt;br /&gt;
:[The ten pins on the right are labeled:]&lt;br /&gt;
:*+3.3V DC&lt;br /&gt;
:*-3.3V DC&lt;br /&gt;
:*Tx&lt;br /&gt;
:*Wx&lt;br /&gt;
:*Rx Only&lt;br /&gt;
:*Unknown&lt;br /&gt;
:*+240V DC&lt;br /&gt;
:*5V AC&lt;br /&gt;
:*GND&lt;br /&gt;
:*Ground&lt;br /&gt;
&lt;br /&gt;
:[The second connector is a 5-pin Micro USB connector.]&lt;br /&gt;
:[The five pins are labeled:]&lt;br /&gt;
:*GND&lt;br /&gt;
:*GND&lt;br /&gt;
:*GND&lt;br /&gt;
:*USB&lt;br /&gt;
:*GND&lt;br /&gt;
&lt;br /&gt;
:[The third connector is a 24-pin USB-C connector, with only the right side labeled.]&lt;br /&gt;
:[The twelve pins on the right are labeled:]&lt;br /&gt;
:*+5V DC&lt;br /&gt;
:*+3.3V DC&lt;br /&gt;
:*+120V AC&lt;br /&gt;
:*Boobytrap Pin (Pure Solder)&lt;br /&gt;
:*Mechanical&lt;br /&gt;
:*+3.3eV/C&lt;br /&gt;
:*Candlepin&lt;br /&gt;
:*Facebook Use&lt;br /&gt;
:*+5V (Positrons)&lt;br /&gt;
:*Pin Roulette&lt;br /&gt;
:*GND&lt;br /&gt;
:*SKY&lt;br /&gt;
&lt;br /&gt;
:[The fourth and final connector is a 1-pin COAX connector.]&lt;br /&gt;
:[The one pin in the center is labeled:]&lt;br /&gt;
:*Pin&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Computers]]&lt;/div&gt;</summary>
		<author><name>Ericprud</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2317:_Pinouts&amp;diff=193160</id>
		<title>2317: Pinouts</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2317:_Pinouts&amp;diff=193160"/>
				<updated>2020-06-10T14:52:14Z</updated>
		
		<summary type="html">&lt;p&gt;Ericprud: + ref to Serial_communication&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2317&lt;br /&gt;
| date      = June 8, 2020&lt;br /&gt;
| title     = Pinouts&lt;br /&gt;
| image     = pinouts.png&lt;br /&gt;
| titletext = The other side of USB-C is rotationally symmetric except that the 3rd pin from the top is designated FIREWIRE TRIBUTE PIN.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a FIREWIRE TRIBUTE PIN. Should include a column for the actual purpose of the pin. Do NOT delete this tag too soon.}}&lt;br /&gt;
Electronics connectors are designed to transport both information and power. A {{w|pinout}} diagram describes the function of each pin such as to communicate data, transport power, physical function (keying), etc. In this comic there is an absurd alternative to the actual pins used in connectors. The pin labels are references to many tech issues and attributes, and not all may be documented correctly here.&lt;br /&gt;
&lt;br /&gt;
Hardware hobbyists might feel excitement at seeing a unified specification for these common connectors, but the comic is of course humorous. The real life diagrams are as follows: [http://unitedtechnologies.com.pk/Nti/image/10ci.png HDMI], [https://www.arrow.com/en/research-and-events/articles/micro-connector-usb-pinout Micro USB], [https://www.allaboutcircuits.com/technical-articles/introduction-to-usb-type-c-which-pins-power-delivery-data-transfer/ USB-C].&lt;br /&gt;
&lt;br /&gt;
=== HDMI ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Label !! Explanation !! Pin No. !! Actual purpose&lt;br /&gt;
|-&lt;br /&gt;
| +3.3V DC&lt;br /&gt;
| 3.3V is a typical voltage in digital electronics. The &amp;quot;+&amp;quot; Indicates a voltage positive with respect to ground.&lt;br /&gt;
| 1&lt;br /&gt;
| TMDS Data2+&lt;br /&gt;
|-&lt;br /&gt;
| Data&lt;br /&gt;
| Most digital communications cables contain at least one wire that carries data. {{w|Serial communication}} protocols have one data line. Typically there will be a more descriptive name if there are multiple data pins. &amp;quot;Data&amp;quot; and &amp;quot;3.3V&amp;quot; set up the appearance of a normal pinout diagram to experienced readers.&lt;br /&gt;
| 2&lt;br /&gt;
| TMDS Data2 Shield&lt;br /&gt;
|-&lt;br /&gt;
| -3.3V DC&lt;br /&gt;
| Negative voltages were used more frequently in the past; however, modern systems typically generate any negative voltages they might require internally from the given positive voltages. This could be a reference to frustration specification implementers have to go through when handling hardware quirks: negative voltages are very abnormal, and would require design alteration to meet, but the designers of a ubiquitous plug can do whatever they want.&lt;br /&gt;
| 3&lt;br /&gt;
| TMDS Data2-&lt;br /&gt;
|-&lt;br /&gt;
| +5V&lt;br /&gt;
| 5V is a typical voltage in digital electronics. The &amp;quot;+&amp;quot; Indicates a voltage positive with respect to Ground. Typically this is assumed to be DC. V is also the Roman numeral for 5.&lt;br /&gt;
| 4&lt;br /&gt;
| TMDS Data1+&lt;br /&gt;
|-&lt;br /&gt;
| Tx&lt;br /&gt;
| &amp;quot;Tx&amp;quot; typically refers to pins used to transmit as opposed to &amp;quot;Rx&amp;quot; (receive).&lt;br /&gt;
| 5&lt;br /&gt;
| TMDS Data1 Shield&lt;br /&gt;
|-&lt;br /&gt;
| +6VI&lt;br /&gt;
| V is usually used to represent volts, but here, VI represents the Roman numeral 6. (See Pin 4)&amp;lt;br&amp;gt;Voltages above 5 are not usually used in micro-circuitry cables.&amp;lt;br&amp;gt;The product VI (Voltage * Current) is equal to Power.&lt;br /&gt;
| 6&lt;br /&gt;
| TMDS Data1-&lt;br /&gt;
|-&lt;br /&gt;
| Wx&lt;br /&gt;
| &amp;quot;Wx&amp;quot; does not typically exist in the &amp;quot;Tx&amp;quot;/&amp;quot;Rx&amp;quot; scheme. In the weather forecasting community, Wx means &amp;quot;weather&amp;quot;.&lt;br /&gt;
| 7&lt;br /&gt;
| TMDS Data0+&lt;br /&gt;
|-&lt;br /&gt;
| +7VII&lt;br /&gt;
| V is usually used to represent volts, but here, VII represents the Roman numeral 7, continuing the pattern from above.&lt;br /&gt;
| 8&lt;br /&gt;
| TMDS Data0 Shield&lt;br /&gt;
|-&lt;br /&gt;
| Rx Only&lt;br /&gt;
| &amp;quot;Rx&amp;quot; typically refers to pins used to receive as opposed to &amp;quot;Tx&amp;quot; (transmit). This description might also be related to the fact that most Ethernet devices can exchange the Rx and Tx port automatically, if needed, in order to eliminate the need for crossover cables and the fact that it is possible to insert the USB-C connector rotated by 180°.&amp;lt;br&amp;gt;Additionally, &amp;quot;Rx&amp;quot;, standing for the Latin &amp;quot;recipe&amp;quot; is a common abbreviation for {{w|medical prescription}}s. Some medicines are prescription only or, in other words, &amp;quot;Rx Only&amp;quot;. &lt;br /&gt;
| 9&lt;br /&gt;
| TMDS Data0-&lt;br /&gt;
|-&lt;br /&gt;
| Antidata&lt;br /&gt;
| Some ports use differential signaling, where a signal and its inverse are sent over a pair of pins (e.g. D+ and D-). The combined signal is more robust to interference. This mixes that practice with a humorous reference to the notion of matter versus antimatter. Currently there is no such thing as antidata. Antidata pins could be needed in the future as low-entropy or high-entropy source in quantum communication connectors to securely dispose of data.&lt;br /&gt;
| 10&lt;br /&gt;
| TMDS Clock+&lt;br /&gt;
|-&lt;br /&gt;
| Unknown&lt;br /&gt;
| Occasionally extra pins will be included for future use; however they will typically be labeled &amp;quot;reserved&amp;quot; to point out that their usage is not yet defined. The use of &amp;quot;unknown&amp;quot; suggests that this pinout is based on an incomplete reverse-engineering of the HDMI format, instead of on the official documentation, or maybe the official documentation doesn't explain it and this pin's function is being kept as a secret by the ones who designed it.&lt;br /&gt;
| 11&lt;br /&gt;
| TMDS Clock Shield&lt;br /&gt;
|-&lt;br /&gt;
| Water&lt;br /&gt;
| Labs often have ports connecting to common sources of various supplies (oxygen, water, fuel, vacuum).&lt;br /&gt;
| 12&lt;br /&gt;
| TMDS Clock-&lt;br /&gt;
|-&lt;br /&gt;
| +240V DC&lt;br /&gt;
| This is a reference to heavy-duty home and commercial appliances, which use 240V AC for power. Additionally, many cable specifications try to provide a way to power devices over them (PS/2, USB, Power over Ethernet,) but these small communication cables usually carry only DC and not AC electricity.&lt;br /&gt;
High voltage power is only sometimes used in small communications connectors. It might help to keep the current of power lines low to avoid generating excess heat. With +240V DC inside the HDMI cable, monitors would not need any longer a separate power plug. This is similar to Power-over-Ethernet, which does not exceed 60V, or ISDN, which goes up to 110V depending on country, and helps surveillance cameras or telephones to work with one connecting cable only. But with this much voltage on such a small cable, a short could lead more likely to melting the insulation and wiring in a sudden burst of toxic smoke. The produced thermal power through a short with resistance R_short that is building up is U²/R_short, increasing with the square of the voltage (also the breakdown voltage of the isolation is more easily reached). However, a high voltage reduces the chance of a peripheral drawing too much current, which could cause a fire on thin wires otherwise: The current through the cable for a device, needing a given power of P, is I = P_dev/U, the thermal power of the cables with resistance R is P_cables = R_cables*I² = R_cables*P_dev²/U², so it is reduced by the square of the voltage.&lt;br /&gt;
| 13&lt;br /&gt;
| CEC&lt;br /&gt;
|-&lt;br /&gt;
| Vacuum&lt;br /&gt;
| Labs often have ports connecting to common sources of various supplies (oxygen, water, fuel, vacuum).&lt;br /&gt;
| 14&lt;br /&gt;
| Reserved (1.0-1.3a), Utility (1.4+, optional)&lt;br /&gt;
|-&lt;br /&gt;
| 5V AC&lt;br /&gt;
| Pins often supply low voltage direct current to devices. This pin supplies 5V {{w|alternating current}}, which is not typically supplied. AC is used in {{w|Electric power transmission|electrical transmission}} because it can be stepped up to high voltage to minimize transmission losses, then stepped down to more useful voltages right before loads. DC power is required for logic circuitry like in computers. Conversion between the the two kinds of power everywhere would make for transformers being embedded in most modern devices, taking extra materials to manufacture and losing a significant percentage of all electricity in the conversion. Having both is not entirely unheard of: the Commodore 64 power supply provides both DC, for the logic of the motherboard; and AC, for powering the tape drive.&lt;br /&gt;
| 15&lt;br /&gt;
| SCL (I²C serial clock for DDC)&lt;br /&gt;
|-&lt;br /&gt;
| Amazon Copyright Pin&lt;br /&gt;
| HDMI can optionally be protected by a {{w|digital rights management}} (DRM) scheme, known as {{w|High-bandwidth Digital Content Protection|HDCP}}. This pin humorously implies the presence of a different DRM scheme specific to {{w|Amazon (company)|Amazon}} the company, as well as poking fun at the fact that copyright is an explicit part of the HDMI protocol (although it is not assigned to a specific pin). This is likely a reference to how chips and cables and specifications often have specific strange additions or functionality in them to meet the requests of various bodies invested in the design process: additionally after reverse engineering many strange things have been found laying around in the functionality of hardware that do unexpected special things.&lt;br /&gt;
| 16&lt;br /&gt;
| SDA (I²C serial data for DDC)&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| GND typically refers to &amp;quot;ground&amp;quot; on pinout diagrams. Remarkably, this is correct.&lt;br /&gt;
| 17&lt;br /&gt;
| DDC/CEC Ground&lt;br /&gt;
|-&lt;br /&gt;
| Decorative&lt;br /&gt;
| Decorative elements are pieces of an assembly that serve only an aesthetic purpose without any technical function. This would not be particularly useful inside a connector, as almost no one will ever see it--however, in HDMI, pin 14 was reserved for future use in versions 1.0–1.3a (and was only assigned an official use in 1.4). A decorative pin is also a popular piece of jewelry.&lt;br /&gt;
| 18&lt;br /&gt;
| +5V&lt;br /&gt;
|-&lt;br /&gt;
| Ground&lt;br /&gt;
| Compared to Pin 17 (&amp;quot;GND&amp;quot;), this appears to be the same ground pin. However, the presence of both GND and Ground seems to imply that GND represents something other than the standard &amp;quot;ground&amp;quot; pin. Alternatively, this pin could supply &amp;quot;Ground&amp;quot; as in soil (like the &amp;quot;soup&amp;quot; electrical outlet from [[1293: Job Interview|1293]]). Some systems have different grounds for analog and digital sections, but they would typically be disambiguated by terms like AGND. Many pinouts have multiple grounds or DC supplies with no apparent explanation, seen more prominently on Randall's USB connector.&lt;br /&gt;
| 19&lt;br /&gt;
| Hot Plug Detect&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
The {{w|HDMI}} interface uses four pairs of shielded twisted-pair connectors, along with seven other connectors. ({{w|Twisted pair}} means a wire is wrapped with the other wire that returns the current to the original device, thus minimizing electromagnetic noise. Shielding refers to wrapping a cable with a conductor to absorb the energy of noise.) Three of these pairs are for data (TMDS Data0, Data1, and Data2) and the other is a clock. These pairs take up three pins as one of them is a ground pin for the shielding wrapped around each pair. TMDS stands for &amp;quot;{{w|Transition-minimized differential signaling}}&amp;quot; and is also used in the DVI standard.&lt;br /&gt;
&lt;br /&gt;
DDC stands for &amp;quot;Display Data Channel&amp;quot; and is based on the {{w|I²C}} serial standard. It is used to allow the transmitting device to learn what formats of data the receiving device can accept.&lt;br /&gt;
&lt;br /&gt;
CEC stands for &amp;quot;Consumer Electronics Control&amp;quot; and is supposed to allow a single remote control to control multiple devices.&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Hot Plug Detect&amp;quot; refers to hot-plugging, where a cable is connected to a device already turned on. The device should then ideally detect that the cable has been plugged in and respond appropriately.&lt;br /&gt;
&lt;br /&gt;
=== Micro USB ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Label !! Explanation !! Pin No. !! Actual Purpose&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| A ground pin&lt;br /&gt;
| 1&lt;br /&gt;
| +5 V&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| A second ground pin&lt;br /&gt;
| 2&lt;br /&gt;
| Data- (Differential signalling)&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| A third ground pin&lt;br /&gt;
| 3&lt;br /&gt;
| Data+&lt;br /&gt;
|-&lt;br /&gt;
| USB&lt;br /&gt;
| Apparently the only data pin in this connector. This could be a play on how the USB specification tries to squeeze all data onto a single channel as if it is a software protocol rather than specializing the structure of a physical cable to provide for rapidly carrying the information likely to flow over it. USB is an external packet network similar to Ethernet, but uses a totally new design without any reuse of prior similar specification. Ironically, in the real Micro- and Mini-USB standards, this pin is not connected to a wire in the cable.&lt;br /&gt;
| 4&lt;br /&gt;
| On-The-Go ID, does not have a wire in the cable.&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| A fourth ground pin. A real micro USB only has one ground pin, in addition to the metal plug housing. This is the location of the actual ground pin.&lt;br /&gt;
| 5&lt;br /&gt;
| Ground.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
A ground pin is commonly found on USB and other pin connectors. At least one ground is necessary to complete the circuit, and some cables use multiple ground lines to distribute current or to support {{w|twisted pair}}s. However, there is no purpose served by having many more ground pins than data pins. Therefore, it seems rather silly for the micro USB to have 4 ground pins and only 1 functional &amp;quot;USB&amp;quot; pin. It also does not give much information about what the &amp;quot;USB&amp;quot; pin would do, as opposed to a standard pinout diagram. This diagram also leaves out the +5V power pin that is present in the real micro USB connector, which would render most USB peripherals unable to function.&lt;br /&gt;
&lt;br /&gt;
The ordering and count of the pins may be an allusion to {{w|Monty Python}}'s {{w|Spam (Monty Python)|&amp;quot;Spam&amp;quot;}} sketch, in which one of the many Spam-related menu items is &amp;quot;Spam, Spam, Spam, egg, and Spam&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== USB-C ===&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Label !! Explanation !! Pin No. !! Actual Purpose&lt;br /&gt;
|-&lt;br /&gt;
| +5V DC&lt;br /&gt;
| A common electronics supply voltage.&lt;br /&gt;
| A12&lt;br /&gt;
| Ground&lt;br /&gt;
|-&lt;br /&gt;
| +3.3V DC&lt;br /&gt;
| Another common electronics supply voltage. This pin is not present on USB type C, mostly because the voltage is too low to supply useful levels of power at the current limit of the pins.&lt;br /&gt;
| A11&lt;br /&gt;
| Rx2+ (Differential Signalling for Superspeed or alternate modes)&lt;br /&gt;
|-&lt;br /&gt;
| +120V AC&lt;br /&gt;
| Residential supply voltage in the United States; its use on an electronics connector would be very unusual, as it would burn out any unguarded transistor-logic electronics, producing smoke and melting the metal together such that the cable likely couldn't be removed. But this high a voltage might be an allusion to the high voltages USB-C screens and similar devices can request in order to get enough energy without exceeding the cable's current limit.&lt;br /&gt;
| A10&lt;br /&gt;
| Rx2-&lt;br /&gt;
|-&lt;br /&gt;
| Boobytrap Pin (Pure solder)&lt;br /&gt;
| {{w|Solder}} is a metal alloy with a low melting temperature (typically around 360°C, but in special cases melting points between 90°C and 450°C or above are available), used to bond electronic components together permanently. Most solder materials are quite ductile so it might be too easy for the forces a connector is subject to to permanently change their shape. Along with the fact that the resistance of solder is typically way higher than that for copper the pin under heavy electrical stress could overheat and melt, thus bonding the connector to its receptacle, and thereby &amp;quot;trapping&amp;quot; the receptacle. Additionally putting a pin that might slightly change their shape directly next to a high voltage pin means risking accidentally connecting two power rails with entirely different voltages together (causing an overvoltage in the lower-voltage rail that is likely to break the circuit, as has happened with some Apple devices). In this case the +120V AC pin might be able to deliver enough power to actually fuse the solder-only pin. This could also be a reference to increasing publicity around the fields of electronics security: hobby reverse engineers have been finding ways for some time now to evade the blown fuses in microcircuitry preventing them from being reprogrammed, using glitching techniques.&lt;br /&gt;
| A9&lt;br /&gt;
| VBUS (+5V)&lt;br /&gt;
|-&lt;br /&gt;
| Mechanical&lt;br /&gt;
| All connectors include portions whose job is to ensure a solid connection between the cable and the port. This is typically not the job of the pins, however. In real USB type C connectors, this task is performed by the center tongue of the female connector. It could also imply transmission of energy or signal through a mechanical principle, such as torque or reciprocating motion.&lt;br /&gt;
| A8&lt;br /&gt;
| SBU1 (Sideband Use)&lt;br /&gt;
|-&lt;br /&gt;
| +3.3eV/C&lt;br /&gt;
| {{w|Electron-volts}} per {{w|coulomb}} would be a very unusual unit to see in a pinout. These units are used in particle physics, but the appearance is very similar to the common 3.3V supply. It would be a unit of electric potential equivalent to approximately 1.60217662 * 10&amp;lt;sup&amp;gt;-19&amp;lt;/sup&amp;gt; volts. Thus 3.3eV/C would be 5.287183 * 10&amp;lt;sup&amp;gt;-19&amp;lt;/sup&amp;gt; volts, or slightly more than 1/2 attovolts. It could also be read as +3.3 eV/c (per {{w|speed of light}}), in which case it is equivalent to a momentum of 5.3E-28 kg m/s, In high-energy physics, the momentum of particles is sometimes expressed in MeV/c or GeV/c units.&lt;br /&gt;
| A7&lt;br /&gt;
| D- (USB 2.0 Data)&lt;br /&gt;
|-&lt;br /&gt;
| Candlepin&lt;br /&gt;
| Randall is making a pun on the word ''pin'', which refers to a electrical connector pin as well as a thing to knock down in bowling. {{w|Candlepin bowling}} is a form of bowling.&lt;br /&gt;
| A6&lt;br /&gt;
| D+&lt;br /&gt;
|-&lt;br /&gt;
| Facebook use&lt;br /&gt;
| This would imply that Facebook had a hand in specifying USB type C, and had a pin dedicated to their use. This could be seen as strange given Facebook's primary business is web technology and would have little need for a dedicated pin in the USB standard, but a lot of back doors have been found in electronics.&lt;br /&gt;
| A5&lt;br /&gt;
| CC1 (Configuration Channel)&lt;br /&gt;
|-&lt;br /&gt;
| +5V (Positrons)&lt;br /&gt;
| {{w|Positron}}s are the antimatter counterparts to electrons. So this pin is supplying +5V, but does so by sourcing positrons into the device rather than sinking electrons out. Positrons cannot be conducted through normal matter conductors as they would annihilate the electrons.&lt;br /&gt;
| A4&lt;br /&gt;
| VBUS (+5V)&lt;br /&gt;
|-&lt;br /&gt;
| Pin Roulette&lt;br /&gt;
| Presumably in the same vein as &amp;quot;{{w|Chatroulette}}&amp;quot;, this pin's purpose is not rigidly defined and is instead left to chance. According to the title text, this pin's counterpart on the other side of the connector is the &amp;quot;FireWire Tribute Pin&amp;quot;, so this cable would only be truly rotationally symmetric (which is the whole point of the USB-C connector) when the pin roulette ball lands on that same function.&lt;br /&gt;
| A3&lt;br /&gt;
| Tx1- (Differential Signalling for Superspeed or alternate modes)&lt;br /&gt;
|-&lt;br /&gt;
| GND&lt;br /&gt;
| Ground pin. Typically denoted as &amp;quot;GND&amp;quot;.&lt;br /&gt;
| A2&lt;br /&gt;
| Tx1+&lt;br /&gt;
|-&lt;br /&gt;
| SKY&lt;br /&gt;
| Reference to the ground pin, which refers to the common grounding on the larger metal body. There is no corresponding &amp;quot;sky&amp;quot; pin, although sky is often thought as the opposite of ground.&lt;br /&gt;
| A1&lt;br /&gt;
| GND&lt;br /&gt;
|-&lt;br /&gt;
| FireWire Tribute Pin&lt;br /&gt;
| ''In title text:'' {{w|FireWire}} is Apple's version of IEEE 1394 which is a 6 pin connector that has a ground pin, a power pin and two pairs of data pins. It was something of a competitor to USB, and had faster data rates than USB 2.0, but is much less popular now, and has essentially been replaced by {{w|Thunderbolt (interface)|Thunderbolt}}. Presumably the writers of the USB-C standard (which far outpaces its data rates) wished to memorialize it somehow, although it's not clear how the pin actually works for that purpose.&lt;br /&gt;
| B3&lt;br /&gt;
| Tx2-&lt;br /&gt;
|}&lt;br /&gt;
The two sides of a USB C connector are labeled &amp;quot;A&amp;quot; and &amp;quot;B&amp;quot;. These are rotationally symmetric, mostly. For example, B10 and B11 are Rx1, a separate twisted-pair for receiving information in Superspeed mode compared to A10 and A11's Rx2. This gives two Rx/Tx pairs for Superspeed use. CC1 and SBU1 are mirrored to CC2 and SBU2. However, the D, VBUS, and GND pins are perfectly mirrored.&lt;br /&gt;
&lt;br /&gt;
The fact that only half of the USB-C pins are documented might hint to an alternative way to manufacture connectors that can be inserted rotated by 180°: Make the receiver use only the right side of the pins and make the sender connect both the left and the right side so all Pins that might match a function are connected correctly no matter if the cable is rotated by 180°. However, doing this would result in only having one Rx/Tx pair for Superspeed use.&lt;br /&gt;
&lt;br /&gt;
=== Coax ===&lt;br /&gt;
&lt;br /&gt;
An {{w|RF connector|coaxial RF connector}} has two contacts - one pin, and the shield; typically the whole connector is labeled with whatever function/signal is carried by the pair.  The joke here is that the label is ''technically'' correct (the best kind of correct), but not very useful to the end user, as it does not specify the voltage rating, impedance, connector size, or other useful information about the cable.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
:[Caption at top]&lt;br /&gt;
:Pinouts&lt;br /&gt;
:Quick Reference Guide&lt;br /&gt;
&lt;br /&gt;
:[Four common connectors are depicted - vertically, rather than the usual horizontal orientation.]&lt;br /&gt;
&lt;br /&gt;
:[The first connector is a 19-pin HDMI connector.]&lt;br /&gt;
:[The nine pins on the left are labeled:]&lt;br /&gt;
:*Data&lt;br /&gt;
:*+5V&lt;br /&gt;
:*+6VI&lt;br /&gt;
:*+7VII&lt;br /&gt;
:*Antidata&lt;br /&gt;
:*Water&lt;br /&gt;
:*Vacuum&lt;br /&gt;
:*Amazon Copyright Pin&lt;br /&gt;
:*Decorative&lt;br /&gt;
:[The ten pins on the right are labeled:]&lt;br /&gt;
:*+3.3V DC&lt;br /&gt;
:*-3.3V DC&lt;br /&gt;
:*Tx&lt;br /&gt;
:*Wx&lt;br /&gt;
:*Rx Only&lt;br /&gt;
:*Unknown&lt;br /&gt;
:*+240V DC&lt;br /&gt;
:*5V AC&lt;br /&gt;
:*GND&lt;br /&gt;
:*Ground&lt;br /&gt;
&lt;br /&gt;
:[The second connector is a 5-pin Micro USB connector.]&lt;br /&gt;
:[The five pins are labeled:]&lt;br /&gt;
:*GND&lt;br /&gt;
:*GND&lt;br /&gt;
:*GND&lt;br /&gt;
:*USB&lt;br /&gt;
:*GND&lt;br /&gt;
&lt;br /&gt;
:[The third connector is a 24-pin USB-C connector, with only the right side labeled.]&lt;br /&gt;
:[The twelve pins on the right are labeled:]&lt;br /&gt;
:*+5V DC&lt;br /&gt;
:*+3.3V DC&lt;br /&gt;
:*+120V AC&lt;br /&gt;
:*Boobytrap Pin (Pure Solder)&lt;br /&gt;
:*Mechanical&lt;br /&gt;
:*+3.3eV/C&lt;br /&gt;
:*Candlepin&lt;br /&gt;
:*Facebook Use&lt;br /&gt;
:*+5V (Positrons)&lt;br /&gt;
:*Pin Roulette&lt;br /&gt;
:*GND&lt;br /&gt;
:*SKY&lt;br /&gt;
&lt;br /&gt;
:[The fourth and final connector is a 1-pin COAX connector.]&lt;br /&gt;
:[The one pin in the center is labeled:]&lt;br /&gt;
:*Pin&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Computers]]&lt;/div&gt;</summary>
		<author><name>Ericprud</name></author>	</entry>

	</feed>