<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=ImVeryAngryItsNotButter</id>
		<title>explain xkcd - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=ImVeryAngryItsNotButter"/>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php/Special:Contributions/ImVeryAngryItsNotButter"/>
		<updated>2026-04-10T11:36:33Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.30.0</generator>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2319:_Large_Number_Formats&amp;diff=193349</id>
		<title>2319: Large Number Formats</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2319:_Large_Number_Formats&amp;diff=193349"/>
				<updated>2020-06-13T03:40:12Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2319&lt;br /&gt;
| date      = June 12, 2020&lt;br /&gt;
| title     = Large Number Formats&lt;br /&gt;
| image     = large number formats-2.png&lt;br /&gt;
| titletext = 10^13.4024: A person who has come back to numbers after a journey deep into some random theoretical field&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by ABRAHAM LINCOLN. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic shows how different people express large numbers. This number in question is approximately the distance to the planet Jupiter in inches (1 inch = 2.54 cm).&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Number&lt;br /&gt;
! Type of person&lt;br /&gt;
! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 25,259,974,097,204&lt;br /&gt;
| Normal Person&lt;br /&gt;
| This is the full number, written out in the normal fashion, with commas to indicate powers of 1000. Note that this convention is only considered normal in the western world; conventions for writing large numbers in full vary considerably across cultures. For example, under the {{w|Indian numbering system}}, this number would be written as 25,25,997,40,97,204.&lt;br /&gt;
|-&lt;br /&gt;
| 25 Trillion&lt;br /&gt;
| Normal Person&lt;br /&gt;
| This is the number, rounded to trillions in the normal fashion.&lt;br /&gt;
|-&lt;br /&gt;
| 25 Billion&lt;br /&gt;
| Old British Person&lt;br /&gt;
| In current English usage, across the anglophonic world with some hold-outs, an n-illion means 10^(3n+3) as per the {{w|short scale}} system popularised by American influence in international trade, so a trillion means 10^12, as above. However, older British English use had an n-illion meaning 10^(6n) (i.e. the simpler calculation of ''million^n''), so a billion meant 10^12. The change stems from a 1974 commitment by Harold Wilson, the Prime Minister of the UK at the time, to change from the {{w|long scale}} (previously often described as the British system) to the short one for all official purposes.&lt;br /&gt;
&lt;br /&gt;
Though not instantly widely adopted for common usage, the mid-'70s could therefore be considered the key turning point between when an older or younger British person learns (as the change filters through the system at various stages of education) what their &amp;quot;Billion&amp;quot;s and &amp;quot;Trillion&amp;quot;s are supposed to represent.&lt;br /&gt;
&lt;br /&gt;
(The 1971 transition to decimalised currency may also date a person's experiences, but was a more comprehensive and immediate change for everyone who handled any money at all, in the UK, and thus was a more definite point of change apart from the extended survival of the &amp;quot;12 times table&amp;quot; being taught by rote in primary education, rather than ending at the 10s.)&lt;br /&gt;
&lt;br /&gt;
As well as 'traditionalist' British use, the Long Scale is widely used in the non-anglophone world, in local language versions, though while the British system tended to infill n-and-a-half powers of the million with the term &amp;quot;thousand n-illion&amp;quot;, the suffix &amp;quot;-illi''ard''&amp;quot;, or equivalent, is often used for the thousands multiple directly atop the respective &amp;quot;-illion&amp;quot; point.&lt;br /&gt;
|-&lt;br /&gt;
|2.526x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
|Scientist&lt;br /&gt;
|This number is formatted in {{w|scientific notation}}, using the exponent 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;.&lt;br /&gt;
|-&lt;br /&gt;
| 2.525997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
| Scientist trying to avoid rounding up&lt;br /&gt;
| Using as many decimal places as necessary until hitting a digit (0-4) that results in rounding down, even if it goes against the common scientific practice of reporting the correct amount of &amp;quot;significant figures&amp;quot;. A previous version of the comic had a typo (the number was ''2.5997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;''), but Randall updated the comic.&lt;br /&gt;
|-&lt;br /&gt;
| 2.526e13 or&lt;br /&gt;
2.526*10^13&lt;br /&gt;
| Software developer &lt;br /&gt;
| Software code cannot use the 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt; format, so the exponent is represented as &amp;quot;e13&amp;quot; or &amp;quot;*10^13&amp;quot;.&lt;br /&gt;
|-&lt;br /&gt;
| 25,259,973,541,888&lt;br /&gt;
| Software developer who forgot about floats&lt;br /&gt;
| This is the number after being converted to the limited precision of a {{w|32-bit floating point|32-bit float}}.&lt;br /&gt;
|-&lt;br /&gt;
| 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
| Astronomer&lt;br /&gt;
| For extremely large distances, astronomers typically only care about orders of magnitude, i.e. 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;, not 10&amp;lt;sup&amp;gt;12&amp;lt;/sup&amp;gt; or 10&amp;lt;sup&amp;gt;14&amp;lt;/sup&amp;gt;. Randall often jokes about the lack of precision needed by astronomers, such as in that one xkcd (#[[2205]]) where the astronomer-cosmologist is equally willing to make pi equal to one, or ten. The original number is rounded to the nearest power of ten.&lt;br /&gt;
|-&lt;br /&gt;
|{0,{0},{0,{0}},{0,{0},{...&lt;br /&gt;
|Set theorist&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
| 1,262,998,704,860 score and four&lt;br /&gt;
| Abraham Lincoln&lt;br /&gt;
| In the {{W|Gettysburg Address}}, Lincoln speaks the number &amp;quot;87&amp;quot; as &amp;quot;four score and seven&amp;quot; (&amp;quot;score&amp;quot; meaning &amp;quot;20&amp;quot;). The original number is rewritten in &amp;quot;score&amp;quot; (multiples of 20) plus a remainder (four).&lt;br /&gt;
|-&lt;br /&gt;
| 10^13.4024 ''(title text)''&lt;br /&gt;
| A person who has come back to numbers after a journey deep into some random theoretical field&lt;br /&gt;
| In some fields of mathematics, especially those dealing with very {{w|large numbers}}, numbers are sometimes represented by raising ten (or some other convenient base) to an oddly precise power, to facilitate comparison of their magnitudes without filling up pages upon pages of digits.  An example of this is {{w|Skewes's number}}, which is formally calculated to be ''e''&amp;lt;sup&amp;gt;''e''&amp;lt;sup&amp;gt;''e''&amp;lt;sup&amp;gt;79&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;, but is more commonly approximated as 10&amp;lt;sup&amp;gt;10&amp;lt;sup&amp;gt;10&amp;lt;sup&amp;gt;34&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;. 13.4024 is the {{w|common logarithm}} of 25,259,974,097,204 (log&amp;lt;sub&amp;gt;10&amp;lt;/sub&amp;gt; 25,259,974,097,204 = 13.4024329009), thus this &amp;quot;format&amp;quot; is mathematically correctly, but not commonly, used.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[A panel only with text. At the top there is four lines of explanatory text. Below that there are 5 rows of number formats. There are 2 columns in each row. Each numerical format is in red, with black text explaining the format below it.]&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;big&amp;gt;What the way you write large&amp;lt;/big&amp;gt;&lt;br /&gt;
:&amp;lt;big&amp;gt;numbers says about you&amp;lt;/big&amp;gt;&lt;br /&gt;
:(Using the approximate current distance&lt;br /&gt;
:to Jupiter in inches as an example)&lt;br /&gt;
&lt;br /&gt;
:[First row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25,259,974,097,204&amp;lt;/span&amp;gt;&lt;br /&gt;
:Normal person&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25 trillion&amp;lt;/span&amp;gt;&lt;br /&gt;
:Normal person&lt;br /&gt;
&lt;br /&gt;
:[Second row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25 billion&amp;lt;/span&amp;gt;&lt;br /&gt;
:Old British person&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;2.526x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Scientist&lt;br /&gt;
&lt;br /&gt;
:[Third row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;2.525997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Scientist trying to avoid rounding up&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;2.526e13 or&amp;lt;br&amp;gt;2.526*10^13&amp;lt;/span&amp;gt;&lt;br /&gt;
:Software developer&lt;br /&gt;
&lt;br /&gt;
:[Fourth row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25,259,973,541,888&amp;lt;/span&amp;gt;&lt;br /&gt;
:Software developer who forgot about floats&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Astronomer&lt;br /&gt;
&lt;br /&gt;
:[Fifth row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;{0,{0},{0,{0}},{0,{0},{...&amp;lt;/span&amp;gt;&lt;br /&gt;
:Set theorist&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;1,262,998,704,860&amp;lt;br&amp;gt;score and four&amp;lt;/span&amp;gt;&lt;br /&gt;
:Abraham Lincoln&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category: Programming]]&lt;br /&gt;
[[Category: Math]]&lt;br /&gt;
[[Category: Astronomy]]&lt;br /&gt;
[[Category: Science]]&lt;br /&gt;
[[Category:Comics featuring politicians]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2298:_Coronavirus_Genome&amp;diff=191226</id>
		<title>2298: Coronavirus Genome</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2298:_Coronavirus_Genome&amp;diff=191226"/>
				<updated>2020-04-25T14:46:32Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2298&lt;br /&gt;
| date      = April 24, 2020&lt;br /&gt;
| title     = Coronavirus Genome&lt;br /&gt;
| image     = coronavirus_genome.png&lt;br /&gt;
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abreveated as G, A, C, T, and U).&lt;br /&gt;
&lt;br /&gt;
The nucleotide sequence displayed currently finds an 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from USA East Coast. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Cueball]] is surprised that she and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology.  She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this &amp;quot;{{w|epigenetics}}&amp;quot;.  In the real world, epigenetics is the study of changes that are not caused by changeing of nucleotides, but other chemical modifications to DNA and chromosomes that cause changes in patterns of gene expression and activation, often many generations down.  This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or placed in bold and made large to attract attention and emphasize key points.  Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.&lt;br /&gt;
&lt;br /&gt;
The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item.  The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude, and may exceed the capabilities of any available spell-checking program.&lt;br /&gt;
&lt;br /&gt;
The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences to see their differences and similarities that is bread and butter of bioinformatics nowadays. Grammar checking would be analogous to being able to understand the chemical and biological function of a sequence straight from its nucleotides, something were unable to do at the moment except in very limited way and in a few and simple cases.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]&lt;br /&gt;
:Cueball (off-screen): So that's the coronavirus genome, huh?&lt;br /&gt;
:Megan: It is!&lt;br /&gt;
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA&lt;br /&gt;
&lt;br /&gt;
:[Cueball walks up and stands behind Megan, still working on the laptop.]&lt;br /&gt;
:Cueball: It's weird that you can just look at it in a text editor.&lt;br /&gt;
:Megan: It's essential!&lt;br /&gt;
:Megan: We geneticists do most of our work in Notepad.&lt;br /&gt;
&lt;br /&gt;
:[A frameless panel, Cueball still standing behind Megan.]&lt;br /&gt;
:Cueball: Notepad?&lt;br /&gt;
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.&lt;br /&gt;
:Cueball: Ah, okay.&lt;br /&gt;
:Megan: That extra formatting is called &amp;quot;epigenetics&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
:[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.]&lt;br /&gt;
:Cueball: Hey, why does that one have a red underline?&lt;br /&gt;
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.&lt;br /&gt;
:Cueball: ''Clever!''&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category: Comics featuring Cueball]]&lt;br /&gt;
[[Category: Comics featuring Megan]]&lt;br /&gt;
[[Category: Biology]]&lt;br /&gt;
[[Category:COVID-19]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2281:_Coronavirus_Research&amp;diff=188758</id>
		<title>2281: Coronavirus Research</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2281:_Coronavirus_Research&amp;diff=188758"/>
				<updated>2020-03-16T21:14:04Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2281&lt;br /&gt;
| date      = March 16, 2020&lt;br /&gt;
| title     = Coronavirus Research&lt;br /&gt;
| image     = coronavirus_research.png&lt;br /&gt;
| titletext = &amp;quot;Also, reading 500 coronavirus papers in a row and not sleeping? Probably not great for you either, but I haven't found any studies confirming that yet. I'll keep looking.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a TRAP! Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
This comic is the seventh comic in a [[:Category:COVID-19|series of comics]] (with at least seven in a row) about the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} - {{w|SARS-CoV-2}}.  &lt;br /&gt;
&lt;br /&gt;
[[Megan]], disheveled and exhausted, has been researching COVID-19 nonstop and is now reporting her findings to [[Cueball]]. She claims to have read all available literature on the subject, but the best she can come up with is an extremely basic fact about {{w|virus}}es—namely that they infect cells and this is bad and should be prevented, which Cueball and just about everybody else already knew. She enthusiastically replies that she knows this with {{w|error bars}}, which are graphical representations of the variability of data and are used on graphs to indicate the error or uncertainty in a reported measurement. Perhaps because of her sleep deprivation, she is unable to process the information that she has read, or is unable to properly phrase it in words. [[1708:_Dehydration|This is not the first time that Megan has exhaustively researched a topic to the detriment of her own health.]]&lt;br /&gt;
&lt;br /&gt;
In the title text, she has a hunch that staying awake long enough to read 500 scientific papers is probably not a good idea, but she hasn't found a study that specifically confirms that. She intends to further compound her exhaustion by continuing to do research rather than just getting some much needed sleep. Assuming that Megan averages half an hour to find and read each paper, she has been continuously reading for 10.4 days, which is approaching the world record for not sleeping. In 1964, {{w|Randy Gardner (record holder)|Randy Gardner}}, a student in San Diego, California set the then-world record of 11 days and 25 minutes (264.4 hours) without sleeping.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[A very disheveled Megan walks up to Cueball from the left of the panel]&lt;br /&gt;
:Megan: &amp;lt;span style=&amp;quot;font-size:large&amp;quot;&amp;gt;''Hi.''&amp;lt;/span&amp;gt;&lt;br /&gt;
:Cueball: Hello. You look...fine.&lt;br /&gt;
&lt;br /&gt;
:[Megan and Cueball are standing next to each other, in a frameless panel.]&lt;br /&gt;
:Megan: I have now read virtually every available scientific paper on COVID-19.&lt;br /&gt;
:Cueball: Cool, what'd you learn?&lt;br /&gt;
&lt;br /&gt;
:[Megan and Cueball are standing next to each other. Megan has her palms raised.]&lt;br /&gt;
:Megan: Well it seems this virus wants to get inside your cells.&lt;br /&gt;
:Cueball: Mhmm...&lt;br /&gt;
&lt;br /&gt;
:[Megan and Cueball are standing next to each other. Megan raises her left arm, with her index finger in the air.]&lt;br /&gt;
:Megan: But it's a '''''trap!''''' You shouldn't let it.&lt;br /&gt;
:Cueball: I think we knew that.&lt;br /&gt;
:Megan: But now I know it with '''''error bars!'''''&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Research Papers]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2256:_Bad_Map_Projection:_South_America&amp;diff=186148</id>
		<title>2256: Bad Map Projection: South America</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2256:_Bad_Map_Projection:_South_America&amp;diff=186148"/>
				<updated>2020-01-17T14:59:40Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2256&lt;br /&gt;
| date      = January 17, 2020&lt;br /&gt;
| title     = Bad Map Projection: South America&lt;br /&gt;
| image     = bad_map_projection_south_america.png&lt;br /&gt;
| titletext = The projection does a good job preserving both distance and azimuth, at the cost of really exaggerating how many South Americas there are.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a OOPS! ALL SOUTHAMERICABERRIES CEREAL BOX. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic shows a {{w|Map projection|map projection}} in which every continent and larger islands has just been replaced with a differently scaled and rotated version of the continent of {{w|South America}}. This is thus the third comic in the series of [[:Category:Bad Map Projections|Bad Map Projections]], although it is almost exactly three years since the first, and as the second followed just a month later, it has been a long wait for this one. Since this is Bad projection #358, and the last two was #79 and #107 is seems [[Randall]] has thought of more than 250 bad projections since then (averaging 7 a month for three years).&lt;br /&gt;
&lt;br /&gt;
The comic is likely in reference to the bad map designs in which continents like Africa and South America have been swapped, or where someone will jokingly replace Greenland with South America. &lt;br /&gt;
&lt;br /&gt;
The caption of the comic is a reference to the {{w|Cap'n Crunch}} cereal type that became a meme, ''Oops! All Berries''.&lt;br /&gt;
&lt;br /&gt;
Interestingly on the original South America, the archipelago or main island (hard to tell) of {{w|Tierra del Fuego}} is replaced with a small South America, while all other South Americas, including the one replacing the Tierra del Fuego, include it in their shape.&lt;br /&gt;
&lt;br /&gt;
The title text claims that the map projection does a good job preserving distance and azimuth, the joke being that the distance and azimuth being preserved for the non-South America continents are those of South America and not the original continent. Note that while this is true for most of the larger landmasses, many of the smaller South Americas are distorted more significantly (such as the South Americas that replace New Zealand).&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[A map of the world, but every landmass has been replaced with South America, rotated and resized to roughly match the real landmasses they represent. South America is correct, except that the small island a the bottom of the continent also has been switch to a small South America.]&lt;br /&gt;
&lt;br /&gt;
:[Caption below the panel:]&lt;br /&gt;
:Bad Map Projection #358: Oops, all South Americas!&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Maps]]&lt;br /&gt;
[[Category:Bad Map Projections]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2255:_Tattoo_Ideas&amp;diff=186049</id>
		<title>2255: Tattoo Ideas</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2255:_Tattoo_Ideas&amp;diff=186049"/>
				<updated>2020-01-15T15:01:03Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Table of entries */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2255&lt;br /&gt;
| date      = January 15, 2020&lt;br /&gt;
| title     = Tattoo Ideas&lt;br /&gt;
| image     = tattoo_ideas.png&lt;br /&gt;
| titletext = The text ALL YOUR BASE ARE BELONG TO US with a lengthy footnote explaining that I got this tattoo in 2020 and not, as you may assume, 2001, but offering no further clarification.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a TATTOO CONTAINING ALL TATTOOS THAT DO NOT CONTAIN THEMSELVES. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is a list of potential tattoo ideas. Many of them play on the trope of regretting a tattoo by being tattoos of things that would not be useful outside of the immediate future, while others are simply ludicrous ideas with little functionality.&lt;br /&gt;
&lt;br /&gt;
===Table of entries===&lt;br /&gt;
{|class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Randall's text&lt;br /&gt;
! Explanation&lt;br /&gt;
|-&lt;br /&gt;
| Lorem Ipsum text&lt;br /&gt;
| {{w|Lorem ipsum}} is the beginning of and shorthand for a long section of shuffled-up Latin text. It is often used by both print and web designers as placeholder text until final content is available. Having a Lorem ipsum tattoo would possibly suggest that the tattoo's text is a placeholder for a &amp;quot;final&amp;quot; tattoo.&lt;br /&gt;
|-&lt;br /&gt;
| Email password&lt;br /&gt;
| Getting a tattoo of your password could compromise the security provided by your password. Additionally, it is recommended and, in some cases, required to update your password regularly; which would result in your tattoo either becoming out of date or updated (which is difficult)&lt;br /&gt;
|-&lt;br /&gt;
| Graph of the popularity of tattoos over time, with the date I got the tattoo marked (Update regularly)&lt;br /&gt;
| This would likely take the form of a {{w|run chart}}, showing the continual rise and fall of tattoo popularity over time. [[Randall]]'s love of charts and graphs is [https://www.explainxkcd.com/wiki/index.php/Category:Charts a regular theme] in the strip. On the surface, getting a tattoo of a tattoo-themed chart would seem appealing. But a chart that tracks over time would become outdated within a few years, making it problematic for a (presumably permanent) tattoo. The solution to this appears to be a note to update the tattoo regularly, presumably as new data becomes available. This would require having the tattoo altered repeatedly, possibly every year; the artist would need to add on to the existing tattoo by extending the x-axis and the data. Depending on the scale of the x- and y- axes, as well as the position and orientation of the graph on Randall's body, this might actually be feasible for Randall's entire lifetime. However, it would involve additional pain, expense and time commitment. Maintaining this novelty tattoo for the rest of his life would seem excessive, but giving it up would once again mean he'd eventually be left with an outdated tattoo. &lt;br /&gt;
|-&lt;br /&gt;
| &amp;quot;CHANGEME&amp;quot;&lt;br /&gt;
| In programming, some text fields are initialized with &amp;quot;CHANGEME&amp;quot; to allow the programmer to get the program running for development purposes, while making it obvious that the actual text needs to be written and inserted.  This would be a very difficult operation to perform with a tattoo.&lt;br /&gt;
|-&lt;br /&gt;
| Slide rule markings on forearms&lt;br /&gt;
| A {{w|slide rule}} is a set of logarithmic scales that are used to perform mathematical calculations.  Having a set of slide rule markings on his forearms could be convenient, but if he grows, or gains or loses weight, the scales might become distorted.&lt;br /&gt;
|-&lt;br /&gt;
| EURion constellation, so no one can photocopy pictures of me&lt;br /&gt;
| The {{w|EURion constellation}} is a set of five circles in a roughly X-shaped pattern that is put onto lots of currencies. When this design is detected, many photocopiers will refuse to make a copy.&lt;br /&gt;
|-&lt;br /&gt;
| The sentence &amp;quot;It's what my tattoo says&amp;quot; written in another language&lt;br /&gt;
| Intended to provoke the question &amp;quot;What does your tattoo say?&amp;quot; from people not fluent in that language, thus resulting in an interesting / confused exchange.&lt;br /&gt;
|-&lt;br /&gt;
| Tissot's indicatrix&lt;br /&gt;
| {{w|Tissot's indicatrix}} is a matrix of circles placed on a map that change size and proportions (possibly turning into ellipses) based on map distortion. As a tattoo, that would be useful in tracking any distortion of the skin since you had the tattoo.&lt;br /&gt;
|-&lt;br /&gt;
| Summary of the [https://www.snopes.com/fact-check/suffer-to-be-beautiful Snopes page on the tattoo epidural thing] (Lower back)&lt;br /&gt;
| The &amp;quot;tattoo epidural thing&amp;quot; is a mostly debunked medical concern that anesthesiologists attending women in labor would refuse to administer spinal anesthetic by needle through skin with tattoo ink, out of fear of introducing the ink into the spinal column.&lt;br /&gt;
|-&lt;br /&gt;
| Pre-surgical checklist&lt;br /&gt;
| Might come in handy if/when going in for surgery.&lt;br /&gt;
|-&lt;br /&gt;
| Tattoo artist's Social Security number&lt;br /&gt;
| In the US, a {{w|Social Security Number}} is a unique, nine-digit number assigned by the federal government to citizens and other legal residents. The original purpose of these numbers was to track social security accounts, for the payment of federal benefits. In practice, it has also become a ''de facto'' national identification number, and is widely for other forms of identification, including applications for loans, employment, and identification papers. As a result, learning someone's social security number is often a critical step in {{w|Identity Theft}}. People are often warned to safeguard their numbers and be very cautious about revealing them. Tattooing one's Social Security Number on a customer would mean that both the customer and anyone who happened to see his tattoo in the future would have access to it. That would be a wildly reckless move which very few tattoo artists would be willing to make. &lt;br /&gt;
|-&lt;br /&gt;
| Boarding pass for an upcoming flight&lt;br /&gt;
| Useful only once, therefore not a normal design to have tattooed.&lt;br /&gt;
|-&lt;br /&gt;
| Recap of the plot of ''Memento''&lt;br /&gt;
| {{w|Memento (film)|Memento}} is a 2000 film in which the protagonist suffers from {{w|Anterograde amnesia|anterograde amnesia}}, a condition that prevents him from creating any new long-term memories.  One of the tools he uses to mitigate the issue is tattooing important things on his body.&lt;br /&gt;
|-&lt;br /&gt;
| This list, in its entirety&lt;br /&gt;
| Instead of getting a tattoo of anything listed here, the actual list itself would be the tattoo.&lt;br /&gt;
|-&lt;br /&gt;
| The text ALL YOUR BASE ARE BELONG TO US with a lengthy footnote explaining that I got this tattoo in 2020 and not, as you may assume, 2001, but offering no further clarification. (title text)&lt;br /&gt;
| {{w|All Your Base Are Belong to Us}} was a popular internet meme from the early 2000s based on a broken English phrase found in the opening cutscene of the 1992 Mega Drive/Genesis port of the 1989 arcade video game Zero Wing. The lengthy footnote denotes that the decision to get the tattoo was deliberate and not a spur-of-the-moment decision while the meme was popular.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:(In larger font and underlined, apparently the start of a list)&lt;br /&gt;
:Tattoo Ideas&lt;br /&gt;
:(A list, with all points but the last crossed out in red)&lt;br /&gt;
:Lorem Ipsum Text&lt;br /&gt;
:Email Password&lt;br /&gt;
:Graph of the popularity of tattoos over time, with the date I got the tattoo marked (update regularly)&lt;br /&gt;
:&amp;quot;Changeme&amp;quot;&lt;br /&gt;
:Slide Rule markings on forearms&lt;br /&gt;
:Eurion Constellation, so no one can photocopy pictures of me&lt;br /&gt;
:The sentence &amp;quot;it's what my tattoo says&amp;quot; written in another language&lt;br /&gt;
:Tissot's Indicatrix&lt;br /&gt;
:Summary of the Snopes page on the tattoo epidural thing (lower back)&lt;br /&gt;
:Pre-surgical checklist&lt;br /&gt;
:Tattoo Artist's Social Security Number&lt;br /&gt;
:Boarding pass for an upcoming flight&lt;br /&gt;
:Recap of the plot of ''Memento''&lt;br /&gt;
:(Last point in list, circled in red)&lt;br /&gt;
:This list, in its entirety&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2255:_Tattoo_Ideas&amp;diff=186048</id>
		<title>2255: Tattoo Ideas</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2255:_Tattoo_Ideas&amp;diff=186048"/>
				<updated>2020-01-15T15:00:37Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Table of entries */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2255&lt;br /&gt;
| date      = January 15, 2020&lt;br /&gt;
| title     = Tattoo Ideas&lt;br /&gt;
| image     = tattoo_ideas.png&lt;br /&gt;
| titletext = The text ALL YOUR BASE ARE BELONG TO US with a lengthy footnote explaining that I got this tattoo in 2020 and not, as you may assume, 2001, but offering no further clarification.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a TATTOO CONTAINING ALL TATTOOS THAT DO NOT CONTAIN THEMSELVES. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is a list of potential tattoo ideas. Many of them play on the trope of regretting a tattoo by being tattoos of things that would not be useful outside of the immediate future, while others are simply ludicrous ideas with little functionality.&lt;br /&gt;
&lt;br /&gt;
===Table of entries===&lt;br /&gt;
{|class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Randall's text&lt;br /&gt;
! Explanation&lt;br /&gt;
|-&lt;br /&gt;
| Lorem Ipsum text&lt;br /&gt;
| {{w|Lorem ipsum}} is the beginning of and shorthand for a long section of shuffled-up Latin text. It is often used by both print and web designers as placeholder text until final content is available. Having a Lorem ipsum tattoo would possibly suggest that the tattoo's text is a placeholder for a &amp;quot;final&amp;quot; tattoo.&lt;br /&gt;
|-&lt;br /&gt;
| Email password&lt;br /&gt;
| Getting a tattoo of your password could compromise the security provided by your password. Additionally, it is recommended and, in some cases, required to update your password regularly; which would result in your tattoo either becoming out of date or updated (which is difficult)&lt;br /&gt;
|-&lt;br /&gt;
| Graph of the popularity of tattoos over time, with the date I got the tattoo marked (Update regularly)&lt;br /&gt;
| This would likely take the form of a [[run chart]], showing the continual rise and fall of tattoo popularity over time. [[Randall]]'s love of charts and graphs is [https://www.explainxkcd.com/wiki/index.php/Category:Charts a regular theme] in the strip. On the surface, getting a tattoo of a tattoo-themed chart would seem appealing. But a chart that tracks over time would become outdated within a few years, making it problematic for a (presumably permanent) tattoo. The solution to this appears to be a note to update the tattoo regularly, presumably as new data becomes available. This would require having the tattoo altered repeatedly, possibly every year; the artist would need to add on to the existing tattoo by extending the x-axis and the data. Depending on the scale of the x- and y- axes, as well as the position and orientation of the graph on Randall's body, this might actually be feasible for Randall's entire lifetime. However, it would involve additional pain, expense and time commitment. Maintaining this novelty tattoo for the rest of his life would seem excessive, but giving it up would once again mean he'd eventually be left with an outdated tattoo. &lt;br /&gt;
|-&lt;br /&gt;
| &amp;quot;CHANGEME&amp;quot;&lt;br /&gt;
| In programming, some text fields are initialized with &amp;quot;CHANGEME&amp;quot; to allow the programmer to get the program running for development purposes, while making it obvious that the actual text needs to be written and inserted.  This would be a very difficult operation to perform with a tattoo.&lt;br /&gt;
|-&lt;br /&gt;
| Slide rule markings on forearms&lt;br /&gt;
| A {{w|slide rule}} is a set of logarithmic scales that are used to perform mathematical calculations.  Having a set of slide rule markings on his forearms could be convenient, but if he grows, or gains or loses weight, the scales might become distorted.&lt;br /&gt;
|-&lt;br /&gt;
| EURion constellation, so no one can photocopy pictures of me&lt;br /&gt;
| The {{w|EURion constellation}} is a set of five circles in a roughly X-shaped pattern that is put onto lots of currencies. When this design is detected, many photocopiers will refuse to make a copy.&lt;br /&gt;
|-&lt;br /&gt;
| The sentence &amp;quot;It's what my tattoo says&amp;quot; written in another language&lt;br /&gt;
| Intended to provoke the question &amp;quot;What does your tattoo say?&amp;quot; from people not fluent in that language, thus resulting in an interesting / confused exchange.&lt;br /&gt;
|-&lt;br /&gt;
| Tissot's indicatrix&lt;br /&gt;
| {{w|Tissot's indicatrix}} is a matrix of circles placed on a map that change size and proportions (possibly turning into ellipses) based on map distortion. As a tattoo, that would be useful in tracking any distortion of the skin since you had the tattoo.&lt;br /&gt;
|-&lt;br /&gt;
| Summary of the [https://www.snopes.com/fact-check/suffer-to-be-beautiful Snopes page on the tattoo epidural thing] (Lower back)&lt;br /&gt;
| The &amp;quot;tattoo epidural thing&amp;quot; is a mostly debunked medical concern that anesthesiologists attending women in labor would refuse to administer spinal anesthetic by needle through skin with tattoo ink, out of fear of introducing the ink into the spinal column.&lt;br /&gt;
|-&lt;br /&gt;
| Pre-surgical checklist&lt;br /&gt;
| Might come in handy if/when going in for surgery.&lt;br /&gt;
|-&lt;br /&gt;
| Tattoo artist's Social Security number&lt;br /&gt;
| In the US, a {{w|Social Security Number}} is a unique, nine-digit number assigned by the federal government to citizens and other legal residents. The original purpose of these numbers was to track social security accounts, for the payment of federal benefits. In practice, it has also become a ''de facto'' national identification number, and is widely for other forms of identification, including applications for loans, employment, and identification papers. As a result, learning someone's social security number is often a critical step in {{w|Identity Theft}}. People are often warned to safeguard their numbers and be very cautious about revealing them. Tattooing one's Social Security Number on a customer would mean that both the customer and anyone who happened to see his tattoo in the future would have access to it. That would be a wildly reckless move which very few tattoo artists would be willing to make. &lt;br /&gt;
|-&lt;br /&gt;
| Boarding pass for an upcoming flight&lt;br /&gt;
| Useful only once, therefore not a normal design to have tattooed.&lt;br /&gt;
|-&lt;br /&gt;
| Recap of the plot of ''Memento''&lt;br /&gt;
| {{w|Memento (film)|Memento}} is a 2000 film in which the protagonist suffers from {{w|Anterograde amnesia|anterograde amnesia}}, a condition that prevents him from creating any new long-term memories.  One of the tools he uses to mitigate the issue is tattooing important things on his body.&lt;br /&gt;
|-&lt;br /&gt;
| This list, in its entirety&lt;br /&gt;
| Instead of getting a tattoo of anything listed here, the actual list itself would be the tattoo.&lt;br /&gt;
|-&lt;br /&gt;
| The text ALL YOUR BASE ARE BELONG TO US with a lengthy footnote explaining that I got this tattoo in 2020 and not, as you may assume, 2001, but offering no further clarification. (title text)&lt;br /&gt;
| {{w|All Your Base Are Belong to Us}} was a popular internet meme from the early 2000s based on a broken English phrase found in the opening cutscene of the 1992 Mega Drive/Genesis port of the 1989 arcade video game Zero Wing. The lengthy footnote denotes that the decision to get the tattoo was deliberate and not a spur-of-the-moment decision while the meme was popular.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:(In larger font and underlined, apparently the start of a list)&lt;br /&gt;
:Tattoo Ideas&lt;br /&gt;
:(A list, with all points but the last crossed out in red)&lt;br /&gt;
:Lorem Ipsum Text&lt;br /&gt;
:Email Password&lt;br /&gt;
:Graph of the popularity of tattoos over time, with the date I got the tattoo marked (update regularly)&lt;br /&gt;
:&amp;quot;Changeme&amp;quot;&lt;br /&gt;
:Slide Rule markings on forearms&lt;br /&gt;
:Eurion Constellation, so no one can photocopy pictures of me&lt;br /&gt;
:The sentence &amp;quot;it's what my tattoo says&amp;quot; written in another language&lt;br /&gt;
:Tissot's Indicatrix&lt;br /&gt;
:Summary of the Snopes page on the tattoo epidural thing (lower back)&lt;br /&gt;
:Pre-surgical checklist&lt;br /&gt;
:Tattoo Artist's Social Security Number&lt;br /&gt;
:Boarding pass for an upcoming flight&lt;br /&gt;
:Recap of the plot of ''Memento''&lt;br /&gt;
:(Last point in list, circled in red)&lt;br /&gt;
:This list, in its entirety&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2247:_Weird_Hill&amp;diff=185191</id>
		<title>2247: Weird Hill</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2247:_Weird_Hill&amp;diff=185191"/>
				<updated>2019-12-27T13:24:19Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2247&lt;br /&gt;
| date      = 27 December, 2019&lt;br /&gt;
| title     = Weird Hill&lt;br /&gt;
| image     = weird hill.png&lt;br /&gt;
| titletext = I'm compromising by picking a weird hill to lie on.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Soft hill}}&lt;br /&gt;
This comic is a joke about the expression [[wikt:hill to die on|&amp;quot;A weird hill to die on&amp;quot;]]: an opinion on an issue that you'll fight to the death for despite it being pointless or a waste of time. [[Beret Guy]] interrupts [[Cueball]] arguing over something online, and, pulling him away from the argument, asks why he should pick a weird hill to die on (fight over an opinion online) when he could pick a soft hill to lie on, going out into nature and relaxing. This comic has a similar message to [[Bad Opinions]],and [[Wrong]], which is that sometimes we feel to strongly over our opinions, and we should let that go.&lt;br /&gt;
&lt;br /&gt;
The title text is an absurd juxtaposition: that Cueball will pick a weird hill to lie on. In this case, he may be referring to a physical hill, in which case the meaning of &amp;quot;weird&amp;quot; is unclear due to lack of context.&lt;br /&gt;
&lt;br /&gt;
The phrase &amp;quot;a weird hill to die on&amp;quot; was also featured in [[1717: Pyramid Honey]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball sitting on a chair in front of a computer and Beret Guy pulling the chair back]&lt;br /&gt;
[Cueball is frustrated]&lt;br /&gt;
:Beret Guy: Why pick a weird hill to die on...&lt;br /&gt;
[Cueball gets up, still frustrated]&lt;br /&gt;
:[Cueball and Beret Guy leaving the room]&lt;br /&gt;
&lt;br /&gt;
:[Cueball and Beret Guy climbing a hill]&lt;br /&gt;
&lt;br /&gt;
:[Cueball and Beret Guy lying down at the top of a hill]&lt;br /&gt;
:Beret Guy: ... when you could pick a soft hill to lie on?&lt;br /&gt;
:Cueball: This ''is'' nice. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&amp;lt;!-- Include any categories below this line. --&amp;gt;&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Beret Guy]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2245:_Edible_Arrangements&amp;diff=185120</id>
		<title>2245: Edible Arrangements</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2245:_Edible_Arrangements&amp;diff=185120"/>
				<updated>2019-12-25T16:10:37Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2245&lt;br /&gt;
| date      = December 23, 2019&lt;br /&gt;
| title     = Edible Arrangements&lt;br /&gt;
| image     = edible_arrangements.png&lt;br /&gt;
| titletext = Any arrangement is an edible arrangement if you're hungry enough.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Needs expansion, Requires an analysis of the rhyming used to come up with the alternatives to &amp;quot;Edible Arrangements&amp;quot;}}&lt;br /&gt;
&lt;br /&gt;
{{w|Edible Arrangements}} is a company that sells fruit, and other edible items that have been cut and arranged to look like flower bouquets. They can be ordered and sent to a given recipient for a variety of purposes. Flower arrangements are typically not eaten.{{Citation needed}} &lt;br /&gt;
&lt;br /&gt;
In the first panel, [[Cueball]] seems to find the concept incongruous, and wonders how it came about. [[Megan]] points out the easy answer: picking out a gift for someone (this comic was released two days before Christmas) can be difficult, but a tasteful meal is always welcome so long as it's something the recipient can eat safely, and the visual appearance of an edible arrangement offers further appeal.&lt;br /&gt;
&lt;br /&gt;
Shortly afterwards, Megan uses the same incongruity of eating a floral arrangement to make puns. '''Vore of the Roses''' is a play on the '''War of the Roses''', either the {{w|Wars of the Roses|English civil war}} or the 1989 [[imdb:tt0098621|movie]] of the same name. 'Vore' is a word part referring to eating, as in carnivore (meat eater), herbivore (plant eater), voracious (hungry or eating a lot), etc. The pun is particularly disturbing to Cueball because of the connection to {{w|Vorarephilia}}, which uses the term vore to refer to the sexual ingestion of another human.&lt;br /&gt;
&lt;br /&gt;
Cueball is disturbed by the thought (or perhaps disturbed that Megan would anthropomorphize her food so) and probably in pain because of the bad pun and says he will cancel the edible arrangement that he had bought for Megan. She tries to convince him otherwise by providing alternative names, which are evidently not any more to his liking. Mouth Blossoms, Juicy Bouquet, and Oral Floral are all combinations referencing the eating of a floral arrangement. In theory, these combinations could be good names for a band, [[1025: Tumblr|or possibly a tumblr blog.]]&lt;br /&gt;
&lt;br /&gt;
The title text also makes reference to the fact that many flowers that are often found in floral arrangements, such as roses, violets, tulips, daisies, lavender and many more, are items that a human can eat. Such flowers are safe to consume but usually unappetizing; Randall makes the point that if a person is sufficiently hungry and thus doesn't care how appetizing their meal is, any floral arrangement can be eaten.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball and Megan are sitting on opposite sides of a leafless tree. They are silhouetted.]&lt;br /&gt;
:Cueball: I don't get how Edible Arrangements is a thing.&lt;br /&gt;
&lt;br /&gt;
:[Zoomed in on Cueball and Megan leaning against the tree]&lt;br /&gt;
:Megan: That's easy &amp;amp;mdash; picking out presents is hard and fruit is delicious.&lt;br /&gt;
:Cueball: Yeah, true.&lt;br /&gt;
&lt;br /&gt;
:[Megan gestures with an open hand]&lt;br /&gt;
:Megan: But my question is, why did they call it &amp;quot;Edible Arrangements&amp;quot; and not &amp;quot;Vore of the Roses&amp;quot;?&lt;br /&gt;
&lt;br /&gt;
:[Pan to just Megan. Megan turns to face Cueball]&lt;br /&gt;
:Cueball: Just for that, I'm going to cancel the one I got you.&lt;br /&gt;
:Megan: Nooo! I want my Mouth Blossoms! &lt;br /&gt;
:Megan: My Juicy Bouquet! My Oral Floral! &lt;br /&gt;
:Megan: Hey, come back!&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category: Comics featuring Cueball]]&lt;br /&gt;
[[Category: Comics featuring Megan]]&lt;br /&gt;
[[Category: Food]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2241:_Brussels_Sprouts_Mandela_Effect&amp;diff=184649</id>
		<title>2241: Brussels Sprouts Mandela Effect</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2241:_Brussels_Sprouts_Mandela_Effect&amp;diff=184649"/>
				<updated>2019-12-15T15:47:54Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2241&lt;br /&gt;
| date      = December 13, 2019&lt;br /&gt;
| title     = Brussels Sprouts Mandela Effect&lt;br /&gt;
| image     = brussels_sprouts_mandela_effect.png&lt;br /&gt;
| titletext = I love Brussels Sprouts Mandela Effect; I saw them open for Correct Horse Battery Staple.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a TASTY BRUSSELS SPROUT. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
False memories may arise via suggestibility, activation of associated information, the incorporation of misinformation, and source misattribution, and they can be shared, sometimes widely, when one of these triggers happens to many people in a population.  The {{w|False_memory#Mandela_Effect|Mandela Effect}} is a pseudoscience explanation for a {{w|false memory}} shared by multiple people.  It states that the false memory is actually a real memory of people who had lived in a parallel world where the memory was true.  &lt;br /&gt;
&lt;br /&gt;
{{w|Brussels sprouts}} are a leafy vegetable from the cabbage family which were cultivated in Brussels, Belgium in the 13th century, giving them their name.  Many adults and children [https://www.camdenliving.com/blog/why-do-we-hate-brussel-sprout dislike Brussels sprouts], perhaps because of their bitterness.&lt;br /&gt;
&lt;br /&gt;
Cueball was one of these people who had a dislike for Brussels sprouts, but after trying them recently he had a change of heart and likes them now.  He feels &amp;quot;misled&amp;quot; by the public dislike for Brussels sprouts.  Megan chimes in and also notes that there is a newer cultivar of Brussels sprouts ([https://npr.org/773457637 source provided]) from around 15 years ago which taste less bitter than the &amp;quot;original&amp;quot; cultivar of Brussels sprouts that Cueball grew up eating.&lt;br /&gt;
&lt;br /&gt;
It seems that others have also started to like Brussels sprouts, which Megan calls a Brussels Sprouts Mandela Effect - that they now have a &amp;quot;false&amp;quot; shared memory of Brussels sprouts tasting bad caused by having lived in a past reality where Brussel sprouts really were bitter.&lt;br /&gt;
&lt;br /&gt;
In the last panel, Ponytail tricks Cueball into thinking that licorice, [https://www.nbcnews.com/healthmain/why-do-so-many-us-hate-black-licorice-few-theories-963738 another widely disliked food], is good tasting. Additionally, she claims that {{w|Silica_gel#Desiccant|silica gel packets}} are actually edible and taste delicious.  This is very false.  Silica gel packets are typically used as a desiccant, to keep electronics and other moisture sensitive items dry.  They are typically marked &amp;quot;[https://www.123rf.com/photo_72752039_single-silica-gel-packet-isolated-on-white-background-.html Do Not Eat]&amp;quot; to warn people that they are not edible. Although not toxic, silica gel has a sand-like texture and no flavor or nutritional value.&lt;br /&gt;
&lt;br /&gt;
The title text suggests that &amp;quot;Brussels Sprouts Mandela Effect&amp;quot; is a music band, who once were the support act for the presumably better known band &amp;quot;Correct Horse Battery Staple&amp;quot;. This latter group is a reference to [[936: Password Strength]]. It hints at the &amp;quot;{{tvtropes|AGoodNameForARockBand|good name for a musical band}}&amp;quot; trope.&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
The URL given is [https://npr.org/773457633 npr.org/773457633] but this seems to be an error; the actual URL is number 77345763'''7''' ([https://text.npr.org/s.php?sId=773457637 plain HTML version] or [https://npr.org/773457637 full site]).&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
:[Ponytail, Cueball, and Megan standing in a line]&lt;br /&gt;
:Cueball: I always thought of Brussels sprouts as terrible, but they're actually really good! I can't believe I let everyone mislead me!&lt;br /&gt;
&lt;br /&gt;
:[Frameless panel just showing Megan]&lt;br /&gt;
:Megan: It's not just you! Farmers developed a less-bitter cultivar like 15 years ago.*&lt;br /&gt;
:&amp;lt;nowiki&amp;gt;*&amp;lt;/nowiki&amp;gt;npr.org/773457633&lt;br /&gt;
&lt;br /&gt;
:[Ponytail, Cueball, and Megan standing in a line. Megan is holding her arm away from her.]&lt;br /&gt;
:Megan: Now the whole world is having this revelation, one person at a time. It's like a real Mandela effect. We secretly switched to the parallel universe where Brussels sprouts taste good.&lt;br /&gt;
:Cueball: ''Cool.''&lt;br /&gt;
&lt;br /&gt;
:[Ponytail, Cueball, and Megan standing in a line. Ponytail is holding up one finger.]&lt;br /&gt;
:Ponytail: Also, licorice is good now.&lt;br /&gt;
:Cueball: Whoa, really?&lt;br /&gt;
:Megan: This is a trap.&lt;br /&gt;
:Ponytail: And those silica gel packets that say &amp;quot;Do not eat&amp;quot;? '''''Delicious.'''''&lt;br /&gt;
:Cueball: ''I knew it.''&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category: Comics featuring Cueball]]&lt;br /&gt;
[[Category: Comics featuring Ponytail]]&lt;br /&gt;
[[Category: Comics featuring Megan]]&lt;br /&gt;
[[Category: Food]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=936:_Password_Strength&amp;diff=184636</id>
		<title>936: Password Strength</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=936:_Password_Strength&amp;diff=184636"/>
				<updated>2019-12-14T16:09:29Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 936&lt;br /&gt;
| date      = August 10, 2011&lt;br /&gt;
| title     = Password Strength&lt;br /&gt;
| image     = password strength.png&lt;br /&gt;
| titletext = To anyone who understands information theory and security and is in an infuriating argument with someone who does not (possibly involving mixed case), I sincerely apologize.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
This comic says that a password such as &amp;quot;Tr0ub4dor&amp;amp;3&amp;quot; is bad because it is easy for password cracking software and hard for humans to remember, leading to insecure practices like writing the password down on a post-it attached to the monitor. On the other hand, a password such as &amp;quot;correcthorsebatterystaple&amp;quot; is hard for computers to guess due to having more entropy but quite easy for humans to remember.&lt;br /&gt;
&lt;br /&gt;
In simple cases the {{w|Entropy (information theory)|entropy}} of a password is calculated as ''a^b'' where ''a'' is the number of allowed symbols and ''b'' is its length. A dictionary word (however long) has a password space of around 65000, i.e. 16 bits. A truly random string of length 11 (not like &amp;quot;Tr0ub4dor&amp;amp;3&amp;quot;, but more like &amp;quot;J4I/tyJ&amp;amp;Acy&amp;quot;) has 94^11 = 72.1 bits. However the comic shows that &amp;quot;Tr0ub4dor&amp;amp;3&amp;quot; has only 28 bits of entropy. Another way of selecting a password is to have 2048 &amp;quot;symbols&amp;quot; (common words) and select only 4 of those symbols. 2048^4 = 44 bits, much better than 28. Using such symbols was again visited in one of the tips in [[1820: Security Advice]].&lt;br /&gt;
&lt;br /&gt;
It is absolutely true that people make passwords hard to remember because they think they are &amp;quot;safer&amp;quot;, and it is certainly true that length, all other things being equal, tends to make for very strong passwords and this can confirmed by using [http://rumkin.com/tools/password/passchk.php rumkin.com's password strength checker]. Even if the individual characters are all limited to [a-z], the exponent implied in &amp;quot;we added another lowercase character, so multiply by 26 again&amp;quot; tends to dominate the results.&lt;br /&gt;
&lt;br /&gt;
In addition to being easier to remember, long strings of lowercase characters are also easier to type on smartphones and {{w|Virtual keyboard|soft keyboards}}.&lt;br /&gt;
&lt;br /&gt;
xkcd's password generation scheme requires the user to have a list of 2048 common words (log&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;(2048) = 11). For any attack we must assume that the attacker knows our password generation algorithm, but not the exact password. In this case the attacker knows the 2048 words, and knows that we selected 4 words, but not which words. The number of combinations of 4 words from this list of words is (2&amp;lt;sup&amp;gt;11&amp;lt;/sup&amp;gt;)&amp;lt;sup&amp;gt;4&amp;lt;/sup&amp;gt; = 2&amp;lt;sup&amp;gt;44&amp;lt;/sup&amp;gt;, i.e. 44 bits. For comparison, the [http://world.std.com/~reinhold/dicewarefaq.html#calculatingentropy entropy offered by Diceware's 7776 word list is 13 bits per word]. If the attacker doesn't know the algorithm used, and only knows that lowercase letters are selected, the &amp;quot;common words&amp;quot; password would take even longer to crack than depicted. 25 ''random'' lowercase characters would have [http://www.wolframalpha.com/input/?i=log2%2826^25%29 117 bits of entropy], vs 44 bits for the common words list.&lt;br /&gt;
&lt;br /&gt;
;Example&lt;br /&gt;
Below there is a detailed example which shows how different rules of complexity work to generate a password with supposed 44 bits of entropy. The examples of expected passwords were generated in random.org.(*)&lt;br /&gt;
&lt;br /&gt;
If ''n'' is the number of symbols and ''L'' is the length of the password, then ''L'' = 44 / log&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;(n).&lt;br /&gt;
&lt;br /&gt;
{|class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
!Symbols&lt;br /&gt;
!Number of symbols&lt;br /&gt;
!Minimum length&lt;br /&gt;
!colspan=&amp;quot;2&amp;quot;|Examples of expected passwords&lt;br /&gt;
!Example of an actual password&lt;br /&gt;
!Actual bits of entropy&lt;br /&gt;
!Comment&lt;br /&gt;
|-&lt;br /&gt;
|a||26||9.3||mdniclapwz||jxtvesveiv||troubadorx||16+4.7 = 20.7||Extra letter to meet length requirement; log&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;(26) = 4.7&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|a 9&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|36&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|8.5&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|qih7cbrmd&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|ewpltiayq&lt;br /&gt;
|tr0ub4d0r||16+3=19||3 = common substitutions in the comic&lt;br /&gt;
|-&lt;br /&gt;
|troubador1||16+3.3=19.3||log&amp;lt;sub&amp;gt;2&amp;lt;/sub&amp;gt;(10) = 3.3&lt;br /&gt;
|-&lt;br /&gt;
|a A||52||7.7||jAwwBYne||NeTvgcrq||Troubador||16+1=17||1 = caps? in the comic&lt;br /&gt;
|-&lt;br /&gt;
|a &amp;amp;amp;||58||7.5||j.h?nv),||c/~/fg\:||troubador&amp;amp;amp;||16+4=20||4 = punctuation in the comic&lt;br /&gt;
|-&lt;br /&gt;
|a A 9||62||7.3||cDe8CgAf||RONygLMi||Tr0ub4d0r||16+1+3=20||1 = caps?; 3 = common substitutions&lt;br /&gt;
|-&lt;br /&gt;
|a 9 &amp;amp;amp;||68||7.2||_@~&amp;quot;#^.2||un$l&amp;amp;#x7c;!f]||tr0ub4d0r&amp;amp;amp;||16+3+4=23||3 = common substitutions; 4 = punctuation&lt;br /&gt;
|-&lt;br /&gt;
|a A 9 &amp;amp;amp;||94||6.7||Re-:aRo||^$rV{3?||Tr0ub4d0r&amp;amp;||16+1+3+4=24||1 = caps?; 3 = common substitutions; 4 = punctuation&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|common words&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|2048&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|4&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|reasonable&amp;amp;#8203;retail&amp;amp;#8203;sometimes&amp;amp;#8203;possibly&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|constant&amp;amp;#8203;yield&amp;amp;#8203;specify&amp;amp;#8203;priority||reasonable&amp;amp;#8203;retail&amp;amp;#8203;sometimes&amp;amp;#8203;possibly||11&amp;amp;times;4=44||Go to random.org and select 4 random integers between 1 and 2048; then go to your list of common words &lt;br /&gt;
|-&lt;br /&gt;
|correct&amp;amp;#8203;horse&amp;amp;#8203;battery&amp;amp;#8203;staple&lt;br /&gt;
|1&lt;br /&gt;
|Thanks to this comic, this is now one of the first passwords a hacker will try. The only entropy left is a boolean statement: &amp;quot;Is this password correct&amp;amp;#8203;horse&amp;amp;#8203;battery&amp;amp;#8203;staple, yes or no?&amp;quot;&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
:a = lowercase letters&lt;br /&gt;
:A = uppercase letters&lt;br /&gt;
:9 = digits&lt;br /&gt;
:&amp;amp;amp; = the 32 special characters in an American keyboard; Randall assumes only the 16 most common characters are used in practice (4 bits)&lt;br /&gt;
&lt;br /&gt;
:(*)&amp;amp;nbsp;The use of random.org explains why &amp;lt;code&amp;gt;jAwwBYne&amp;lt;/code&amp;gt; has two consecutive w's, why &amp;lt;code&amp;gt;Re-:aRo&amp;lt;/code&amp;gt; has two R's, why &amp;lt;code&amp;gt;_@~&amp;quot;#^.2&amp;lt;/code&amp;gt; has no letters, why &amp;lt;code&amp;gt;ewpltiayq&amp;lt;/code&amp;gt; has no numbers, why &amp;quot;constant yield&amp;quot; is part of a password, etc. A human would have attempted at passwords that looked random.&lt;br /&gt;
&lt;br /&gt;
==People who don't understand information theory and security==&lt;br /&gt;
&lt;br /&gt;
The title text likely refers to the fact that this comic could cause people who understand information theory and agree with the message of the comic to get into an infuriating argument with people who do not — and disagree with the comic.&lt;br /&gt;
&lt;br /&gt;
If you're confused, don't worry; you're in good company; even security &amp;quot;experts&amp;quot; don't understand the comic:&lt;br /&gt;
&lt;br /&gt;
*  Bruce Schneier thinks that dictionary attacks make this method &amp;quot;obsolete&amp;quot;, despite the comic ''assuming'' perfect knowledge of the user's dictionary from the get-go.  He advocates his own low-entropy &amp;quot;first letters of common plain English phrases&amp;quot; method instead:  [https://www.schneier.com/blog/archives/2014/03/choosing_secure_1.html#!s!xkcd Schneier original article] and rebuttals: [http://robinmessage.com/2014/03/why-bruce-schneier-is-wrong-about-passwords/ 1] [http://security.stackexchange.com/a/62881/10616 2] [http://www.reddit.com/r/technology/comments/1yxgqo/bruce_schneier_on_choosing_a_secure_password/cfp2z9k 3] [http://www.reddit.com/r/YouShouldKnow/comments/232uch/ysk_how_to_properly_choose_a_secure_password_the/cgte7lp 4] [http://www.reddit.com/r/YouShouldKnow/comments/232uch/ysk_how_to_properly_choose_a_secure_password_the/cgszp62 5] [http://www.reddit.com/r/YouShouldKnow/comments/232uch/ysk_how_to_properly_choose_a_secure_password_the/cgt6ohq 6]&lt;br /&gt;
* Steve Gibson basically gets it, but calculates entropy incorrectly in order to promote his own method and upper-bound password-checking tool: [https://www.grc.com/sn/sn-313.htm#!s!math%20is%20wrong Steve Gibson Security Now transcript] and [https://subrabbit.wordpress.com/2011/08/26/how-much-entropy-in-that-password/ rebuttal]&lt;br /&gt;
* Computer security consultant Mark Burnett ''almost'' understands the comic, but then advocates adding numerals and other crud to make passphrases less memorable, which completely defeats the point (that it is human-friendly) in the first place: [https://web.archive.org/web/20150319220514/https://xato.net/passwords/analyzing-the-xkcd-comic/ Analyzing the XKCD Passphrase Comic]&lt;br /&gt;
* Ken Grady incorrectly thinks that user-selected sentences like &amp;quot;I have really bright children&amp;quot; have the same entropy as randomly-selected words: [https://www.hellersearch.com/blog/bid/141527/is-your-password-policy-stupid Is Your Password Policy Stupid?]&lt;br /&gt;
* Diogo Mónica is correct that a truly random 8-character string is still stronger than a truly random 4-word string (52.4 vs 44), but doesn't understand that the words have to be truly random, not user-selected phrases like &amp;quot;let me in facebook&amp;quot;:  [https://diogomonica.com/posts/password-security-why-the-horse-battery-staple-is-not-correct/ Password Security: Why the horse battery staple is not correct]&lt;br /&gt;
* Ken Munro confuses entropy with permutations and undermines his own argument that &amp;quot;correct horse battery staple&amp;quot; is weak due to dictionary attacks by giving an example &amp;quot;strong&amp;quot; password that still consists of English words. He also doesn't realize that using capital letters in predictable places (first letter of every word) does not increase password strength: [https://www.pentestpartners.com/security-blog/correcthorsebatterystaple-isnt-a-good-password-heres-why/ CorrectHorseBatteryStaple isn’t a good password. Here’s why.]&lt;br /&gt;
&lt;br /&gt;
Sigh.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:The comic illustrates the relative strength of passwords assuming basic knowledge of the system used to generate them.&lt;br /&gt;
:A set of boxes is used to indicate how many bits of entropy a section of the password provides.&lt;br /&gt;
:The comic is laid out with 6 panels arranged in a 3x2 grid.&lt;br /&gt;
:On each row, the first panel explains the breakdown of a password, the second panel shows how long it would take for a computer to guess, and the third panel provides an example scene showing someone trying to remember the password.&lt;br /&gt;
&lt;br /&gt;
:[The password &amp;quot;Tr0ub4dor&amp;amp;3&amp;quot; is shown in the center of the panel. A line from each annotation indicates the word section the comment applies to.]&lt;br /&gt;
&lt;br /&gt;
:Uncommon (non-gibberish) base word&lt;br /&gt;
:[Highlighting the base word - 16 bits of entropy.]&lt;br /&gt;
:Caps?&lt;br /&gt;
:[Highlighting the first letter - 1 bit of entropy.]&lt;br /&gt;
:Common Substitutions&lt;br /&gt;
:[Highlighting the letters 'a' (substituted by '4') and both 'o's (the first of which is substituted by '0') - 3 bits of entropy.]&lt;br /&gt;
:Punctuation&lt;br /&gt;
:[Highlighting the symbol appended to the word - 4 bits of entropy.]&lt;br /&gt;
:Numeral&lt;br /&gt;
:[Highlighting the number appended to the word - 3 bits of entropy.]&lt;br /&gt;
:Order unknown&lt;br /&gt;
:[Highlighting the appended characters - 1 bit of entropy.]&lt;br /&gt;
:(You can add a few more bits to account for the fact that this is only one of a few common formats.)&lt;br /&gt;
&lt;br /&gt;
:~28 bits of entropy &lt;br /&gt;
:2&amp;lt;sup&amp;gt;28&amp;lt;/sup&amp;gt; = 3 days at 1000 guesses/sec&lt;br /&gt;
:(Plausible attack on a weak remote web service. Yes, cracking a stolen hash is faster, but it's not what the average user should worry about.)&lt;br /&gt;
:Difficulty to guess: Easy&lt;br /&gt;
&lt;br /&gt;
:[Cueball stands scratching his head trying to remember the password.]&lt;br /&gt;
:Cueball: Was it trombone? No, Troubador. And one of the O's was a zero?&lt;br /&gt;
:Cueball: And there was some symbol...&lt;br /&gt;
:Difficulty to remember: Hard&lt;br /&gt;
&lt;br /&gt;
:[The passphrase &amp;quot;correct horse battery staple&amp;quot; is shown in the center of the panel.]&lt;br /&gt;
:Four random common words {Each word has 11 bits of entropy.}&lt;br /&gt;
&lt;br /&gt;
:~44 bits of entropy&lt;br /&gt;
:2&amp;lt;sup&amp;gt;44&amp;lt;/sup&amp;gt; = 550 years at 1000 guesses/sec&lt;br /&gt;
:Difficulty to guess: Hard&lt;br /&gt;
&lt;br /&gt;
:[Cueball is thinking, in his thought bubble a horse is standing to one side talking to an off-screen observer. An arrow points to a staple attached to the side of a battery.]&lt;br /&gt;
:Horse: That's a battery staple.&lt;br /&gt;
:Observer: Correct!&lt;br /&gt;
:Difficulty to remember: You've already memorized it&lt;br /&gt;
&lt;br /&gt;
:Through 20 years of effort, we've successfully trained everyone to use passwords that are hard for humans to remember, but easy for computers to guess.&lt;br /&gt;
&lt;br /&gt;
==External links==&lt;br /&gt;
*Some info was used from the highest voted answer given to the question of &amp;quot;how accurate is this XKCD comic&amp;quot; at StackExchange [http://security.stackexchange.com/questions/6095/xkcd-936-short-complex-password-or-long-dictionary-passphrase].&lt;br /&gt;
*Similarly, a question of &amp;quot;how right this comic is&amp;quot; was made at AskMetaFilter [http://ask.metafilter.com/193052/Oh-Randall-you-do-confound-me-so] and [[Randall]] responded [http://ask.metafilter.com/193052/Oh-Randall-you-do-confound-me-so#2779020 there].&lt;br /&gt;
*Also the Wikipedia article on '{{w|Passphrase}}' is useful.&lt;br /&gt;
*In case you missed it in the explanation, GRC's Steve Gibson has a fantastic page [https://www.grc.com/haystack.htm] about this (and may have prompted this comic, as his podcast [http://www.grc.com/sn/sn-303.htm] about this was posted the month before this comic).&lt;br /&gt;
* This comic inspired [http://blog.acolyer.org/2015/10/29/how-to-memorize-a-random-60-bit-string/ How to memorize a random 60-bit string] scientific paper (link is to the article about paper, wth paper itself linked)&lt;br /&gt;
* [https://github.com/dropbox/zxcvbn zxcvbn password strength estimator] thanks this comic for the inspiration in acknowledgements.&lt;br /&gt;
* CMU paper: [http://cups.cs.cmu.edu/soups/2012/proceedings/a7_Shay.pdf Correct horse battery staple: Exploring the usability of system-assigned passphrases]&lt;br /&gt;
* [http://research.microsoft.com/pubs/265143/Microsoft_Password_Guidance.pdf Microsoft Password Guidance] (page 8)&lt;br /&gt;
* [http://gizmodo.com/the-guy-who-invented-those-annoying-password-rules-now-1797643987 The Guy Who Invented Those Annoying Password Rules Now Regrets Wasting Your Time], August 8, 2017 (this comic is reproduced in the article).&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Math]]&lt;br /&gt;
[[Category:Computers]]&lt;br /&gt;
[[Category:Psychology]]&lt;br /&gt;
[[Category:Computer security]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2227:_Transit_of_Mercury&amp;diff=182700</id>
		<title>2227: Transit of Mercury</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2227:_Transit_of_Mercury&amp;diff=182700"/>
				<updated>2019-11-11T22:08:21Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2227&lt;br /&gt;
| date      = November 11, 2019&lt;br /&gt;
| title     = Transit of Mercury&lt;br /&gt;
| image     = transit_of_mercury.png&lt;br /&gt;
| titletext = For some reason the water in my pool is green and there's a weird film on the surface #nofilter&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a BOT. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
The hashtag #nofilter is used to punctuate posts containing strong, often unpopular, opinions.&lt;br /&gt;
&lt;br /&gt;
In this comic, the hashtag is used to cap off posts about situations where failure to use proper filtering equipment has led to damage or decay of personal property.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=989:_Cryogenics&amp;diff=181818</id>
		<title>989: Cryogenics</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=989:_Cryogenics&amp;diff=181818"/>
				<updated>2019-10-27T23:10:24Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 989&lt;br /&gt;
| date      = December 12, 2011&lt;br /&gt;
| title     = Cryogenics&lt;br /&gt;
| image     = cryogenics.png&lt;br /&gt;
| titletext = 'Welcome to the future! Nothing's changed.' was the slogan of my astonishingly short-lived tech startup.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
[[Megan]], holding a {{w|smartphone}}, tells [[White Hat]] that everyone now carries a computer in their pocket, and refers to how it is always on-line (connected) and is full of sensors (like orientation, vibration and GPS etc.). This is actually amazing and White Hat assumes she is overwhelmed and ask her if the development is changing too fast for her.&lt;br /&gt;
&lt;br /&gt;
But it turns out that Megan is actually disappointed about the pace of technology's improvement, that it goes ''too slowly''. (Who isn't disappointed? From old sci-fi movies' predictions, we should by this point have {{w|flying cars}} and the {{w|Hoverboard|flying skateboard}} like in {{w|Back to the Future 2}} or a hyper technological future like in {{w|Blade Runner}}). She tells White Hat that she has decided to {{w|Cryopreservation|cryogenically freeze}} herself now that she has developed '''{{w|cryogenics}}''' (hence the title) far enough for humans to survive such a deep freeze, and then she climbs into her homemade chamber and plans to skip 30 years ahead in time. &lt;br /&gt;
&lt;br /&gt;
Cryogenic freezing is the ability to freeze oneself, so that one does not age and doesn't experience the passage of time. It is common in fiction as a useful technology for long space flights or other necessary preservation (like in the film {{w|2001: A Space Odyssey (film)|2001}}).&lt;br /&gt;
&lt;br /&gt;
However, to Megan's chagrin, when she wakes up, she is told by [[Cueball]] ([[#Trivia|who is not Terry]]!) that all the other scientists and engineers that were fascinated about the future had also frozen themselves using her technology, even building their freezing chambers in a line to either side of her chamber, so nothing had been invented while she was frozen.&lt;br /&gt;
&lt;br /&gt;
But as Cueball tells her in the final panel, they are all waking up now, implying that finally something new can be invented! But Megan then immediately decides to try again to see what happens next, hoping the situation 30 years later will be different. But then the guy in one of the nearby chambers gets the same idea as she did (again). However, if everyone does the same thing again, the situation will repeat itself and nothing will ever change again, as they can continue this process in 30 year steps. (Note that this is not {{w|time travel}}, but still related to this [[:Category:Time travel|recurring theme]] in xkcd, and similar methods have been called time travel in xkcd before, like in [[630: Time Travel]] and especially [[1617: Time Capsule]].)&lt;br /&gt;
&lt;br /&gt;
It seems, however, that the engineer in the nearest chamber, to Megan's right, spots this problem and tries to stop all the other engineers from freezing down again, as he says ''Wait, guys''. &lt;br /&gt;
&lt;br /&gt;
The moral of the comic is: &lt;br /&gt;
'''Don't freeze yourself, engineers and scientists! We need your help!'''&lt;br /&gt;
&lt;br /&gt;
The title text refers to ''tech startups,'' (and existing tech companies) who often use bold marketing techniques, proclaiming that they are going to &amp;quot;revolutionize&amp;quot; not only a particular product or service, but every facet of a user's life. One of the cliché phrases used in presentations is &amp;quot;Welcome to the future&amp;quot;, implying that their product is the only way forwards, and all others are rendered obsolete. &lt;br /&gt;
&lt;br /&gt;
In the title text this cliché is turned on its head, when [[Randall]] tells about a very short lived tech startup he tried to get going. The reason for the short life of the company was that it admitted that nothing changed with its slogan: &amp;quot;Welcome to the future! Nothing's changed.&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Technology by its nature tends to evolve and improve, and thus a tech company which doesn't change will fall further and further behind their competitors, likely ending up going bust. Which was the case with Randall's (fake) tech startup.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan staring down at a smartphone in her hand while talking to White Hat.]&lt;br /&gt;
:Megan: Everyone's carrying sensor-packed, always-connected computers everywhere. That wasn't true ten years ago.&lt;br /&gt;
:White Hat: It's all changing too fast, huh?&lt;br /&gt;
:Megan: No, too ''slowly.''&lt;br /&gt;
&lt;br /&gt;
:[Zoom in on Megan's upper part as she holds up the smartphone showing its screen.]&lt;br /&gt;
:Megan: There's so much potential here. These clumsy, poorly-designed toys are ''nothing'' compared to what lies ahead.&lt;br /&gt;
&lt;br /&gt;
:[Megan climbs into a cryogenic chamber which stands on a base where a small box at the end of the chamber is connected to it through a bend tube. She leaves the smartphone on the floor in front of White Hat.]&lt;br /&gt;
:Megan: That's why I've worked to develop cryogenic freezing. &lt;br /&gt;
:Megan: I'm gonna skip forward 30 years and use this stuff when it's ''good''.&lt;br /&gt;
&lt;br /&gt;
:[Cueball is greeting Megan holding a fist up in front of him, as Megan with morning hair rises up from the open cryogenic chamber.]&lt;br /&gt;
:30 years later...&lt;br /&gt;
:Cueball: Welcome to the future! Nothing's changed.&lt;br /&gt;
:Megan: What?&lt;br /&gt;
:Megan: Why??&lt;br /&gt;
&lt;br /&gt;
:[Cueball still stands in front of Megan in the chamber, but the scene has rotated revealing a row of other cryogenic chambers behind. The chamber after Megan's is still closed, but the others are open and people emerging.]&lt;br /&gt;
:Cueball: When cryogenic freezing was invented, all the engineers who were excited about the future froze themselves. So there's been no one building anything new.&lt;br /&gt;
&lt;br /&gt;
:[The scene has rotated to look straight in on the long side of Megan's chamber, Cueball is left. She holds the cover ready to close it again. Two voices comes from off-panel to the right.]&lt;br /&gt;
:Cueball: But they're all waking up now!&lt;br /&gt;
:Megan: Sweet! I'm gonna jump forward to see what they do!&lt;br /&gt;
:Engineer 1 (off-panel): Me too!&lt;br /&gt;
:Engineer 2 (off-panel): Wait, uh, guys?&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*This version of Cueball was called either ''Someone who isn't Terry'' or just plainly ''not Terry'' in the [http://xkcd.com/989/info.0.json actual transcript] by [[Randall]].&lt;br /&gt;
**It is a {{w|Futurama}} reference  as [http://futurama.wikia.com/wiki/Terry Terry] is a recurring Futurama character, and he is the &amp;quot;employee at Applied Cryogenics whose job is to greet the newly defrosted&amp;quot;.&lt;br /&gt;
**In the transcript, Randall is thus pointing out that the character in his Cryogenic lab is not the same as Terry the Futurama character.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring White Hat]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Multiple Cueballs]]&lt;br /&gt;
[[Category:Time travel]]&lt;br /&gt;
[[Category:Smartphones]]&lt;br /&gt;
[[Category:Science]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=702:_Snow_Tracking&amp;diff=181817</id>
		<title>702: Snow Tracking</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=702:_Snow_Tracking&amp;diff=181817"/>
				<updated>2019-10-27T23:06:56Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 702&lt;br /&gt;
| date      = February 15, 2010&lt;br /&gt;
| title     = Snow Tracking&lt;br /&gt;
| image     = snow_tracking.png&lt;br /&gt;
| titletext = I suppose that's more accurately a hare dryer.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
This comic is a guide to recognizing various animals by their footprints. However, the comic typically detours into strange, ridiculous or pop-culture-referencing footprints. In order:&lt;br /&gt;
&lt;br /&gt;
*The first panel is nothing special. Just a regular cat.&lt;br /&gt;
*&amp;quot;Moose and squirrel&amp;quot; is a reference to the cartoon ''{{w|Rocky and Bullwinkle}}''. Rocky and Bullwinkle were a flying squirrel and a moose, respectively, and were frequently referred to as &amp;quot;moose and squirrel&amp;quot; by the show's antagonist Boris Badenov.&lt;br /&gt;
*[http://knowyourmeme.com/memes/longcat Longcat] is an internet {{w|meme}} from pictures of cats all stretched out that make them look very tall (or long).&lt;br /&gt;
*&amp;quot;Mouse riding Bicycle&amp;quot; is a reference to ''{{w|Ralph S. Mouse}}'', a series of novels by {{w|Beverly Cleary}}.&lt;br /&gt;
*The hair dryer has melted an irregular region around the rabbit. The title text is a pun on the Rabbit with a hair dryer frame, possibly an homage to {{w|Looney Tunes}}, where shows with {{w|Bugs Bunny}} would often contain a pun on &amp;quot;hare&amp;quot;.&lt;br /&gt;
*{{w|Legolas}} is a reference to the character by the same name in the ''{{w|Lord of the Rings}}'' trilogy of books and movies. Legolas, as an elf, was able to walk on top of snow, while the other races in his party were forced to trudge through it.&lt;br /&gt;
*The &amp;quot;Bobcat on pogo stick&amp;quot; panel is a possible reference to the character Bonkers D. Bobcat from {{w|Bonkers (TV series)}}&lt;br /&gt;
*The &amp;quot;Knight&amp;quot; panel is a {{w|chess}} reference, as the tracks move just like the knight piece in chess.&lt;br /&gt;
*The &amp;quot;kid with...&amp;quot; panels are a reference to ''{{w|Calvin and Hobbes}}'', a comic strip written by Bill Watterson. In it, Calvin has a pet tiger named Hobbes, and sometimes, a cardboard box that &amp;quot;transmogrifies&amp;quot; him to something else. In this panel we see tiger prints, meaning that Calvin became a tiger like Hobbes.&lt;br /&gt;
*The same cardboard box is now tipped on its side instead of upside down in the last panel. Now it functions as a duplicator, making multiple copies of whatever is in it. Calvin goes into it, duplicates himself, and they walk and duplicate again, and the cycle repeats.&lt;br /&gt;
*{{w|Prius}} is a reference to current events in which Toyota Prius's pedals have allegedly malfunctioned causing accidents. [http://www.nytimes.com/2010/02/04/business/global/04prius.html]&lt;br /&gt;
*The {{w|Higgs Boson}} is an {{w|elementary particle}} which, at the time this strip was posted, had not yet been officially discovered (there had been detections at the Tevatron with 4 sigma certainty since the early 2000s). It was tentatively detected in March 2013 in the {{w|Large Hadron Collider}}.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:BACKYARD SNOW TRACKING GUIDE&lt;br /&gt;
&lt;br /&gt;
:[Each panel contains an overhead view of tracks through the snow, with a caption indicating the apparent source.]&lt;br /&gt;
&lt;br /&gt;
:[Standard paw prints through the snow.]&lt;br /&gt;
:CAT&lt;br /&gt;
&lt;br /&gt;
:[Large split-toe tracks and smaller rodent tracks.]&lt;br /&gt;
:MOOSE AND SQUIRREL&lt;br /&gt;
&lt;br /&gt;
:[Cat prints, but with more space between the pairs of prints.]&lt;br /&gt;
:LONGCAT&lt;br /&gt;
&lt;br /&gt;
:[Two similar careening tire tracks.]&lt;br /&gt;
:MOUSE RIDING BICYCLE&lt;br /&gt;
&lt;br /&gt;
:[Longer rodent tracks, with a large melted ring surrounding a point in the middle of the frame.]&lt;br /&gt;
:RABBIT STOPPING TO USE HAIR DRYER&lt;br /&gt;
&lt;br /&gt;
:[No visible tracks.]&lt;br /&gt;
:LEGOLAS&lt;br /&gt;
&lt;br /&gt;
:[Single deep holes with cratering.]&lt;br /&gt;
:BOBCAT ON POGO STICK&lt;br /&gt;
&lt;br /&gt;
:[Round prints that suddenly turn to the right halfway into frame.]&lt;br /&gt;
:KNIGHT&lt;br /&gt;
&lt;br /&gt;
:[Human footprints up to a square melting pattern, turning into animal prints.]&lt;br /&gt;
:KID WITH TRANSMOGRIFIER&lt;br /&gt;
&lt;br /&gt;
:[Human footprints up to a rectangular melted area, which are then doubled to another rectangular area, which are then doubled again up to another rectangular area, which are then doubled.]&lt;br /&gt;
:KID WITH DUPLICATOR&lt;br /&gt;
&lt;br /&gt;
:[Right curve on a road, with tire tracks careening out of frame.]&lt;br /&gt;
:Out of Frame Garden Owner: MY VEGETABLE GARDEN!&lt;br /&gt;
:PRIUS&lt;br /&gt;
&lt;br /&gt;
:[A series of spiraling and outwardly traveling lines extend from a point in the middle of the frame.]&lt;br /&gt;
:HIGGS BOSON&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Calvin and Hobbes]]&lt;br /&gt;
[[Category:Bobcats]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1984:_Misinterpretation&amp;diff=181503</id>
		<title>1984: Misinterpretation</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1984:_Misinterpretation&amp;diff=181503"/>
				<updated>2019-10-21T12:55:13Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1984&lt;br /&gt;
| date      = April 23, 2018&lt;br /&gt;
| title     = Misinterpretation&lt;br /&gt;
| image     = misinterpretation.png&lt;br /&gt;
| titletext = &amp;quot;But there are seven billion people in the world! I can't possibly stop to consider how ALL of them might interpret something!&amp;quot; &amp;quot;Ah, yes, there's no middle ground between 'taking personal responsibility for the thoughts and feelings of every single person on Earth' and 'covering your eyes and ears and yelling logically correct statements into the void.' That's a very insightful point and not at all inane.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
[[Cueball]] is complaining that people are mad at him ''again'' because of a misinterpretation of his statements. This is referenced by the comic's title. He complains that since (he believes) he is being perfectly clear, it cannot be his fault that everyone misinterprets him. The off-screen voice sarcastically agrees that communication is an activity that only involves one person; in fact, of course, it {{w|Communication#Models|famously involves at least two}}.&lt;br /&gt;
&lt;br /&gt;
Cueball speaks as though his communications are complete and perfect once he has finished making them. The reality is that communication can't be considered complete until the message has also been received and understood. Cueball is failing to take into account the need for partnership between sender and receiver, and doesn't realise that the problem may well be in the way he carries out his side of the transaction rather than in the way ''everybody'' else is carrying out theirs. &lt;br /&gt;
&lt;br /&gt;
In the title text, Cueball then answers that he cannot possibly account for the many possible interpretations which the message, potentially reaching the whole world, could acquire. This is an example of the {{w|Nirvana fallacy}}. Cueball's idealized solution is to consider how every person on Earth would interpret the message, so Cueball rejects doing anything less as insufficient; however, actually figuring out how every person on Earth would interpret the message is unfeasible, so Cueball doesn't do that either. The reply comes once again sarcastically, deriding his point and saying that a middle ground between taking up such an effort and entirely avoiding it must be reached.&lt;br /&gt;
&lt;br /&gt;
This avoidance is phrased using a [[762: Analogies|simile]] as “covering your eyes and ears and yelling logically correct statements into the void”, implying that no one would understand the logical sentences (thus the void), and would instead read them more naturally – and also that ignoring the appalled reaction of listeners to their own interpretation of the sentences is similar to covering your eyes and ears. This action makes communication more difficult through the popular{{Citation needed}} means of speech, text and sign language. If the hands are occupied with covering either part, then Braille communication is also impossible. Therefore, the action of “covering your eyes and ears” is a metaphor for deliberately making it more difficult to communicate with oneself. The simile might also mean that Cueball subconsciously rejects criticism as it would hurt his ego.&lt;br /&gt;
&lt;br /&gt;
It is clear that Cueball is acting as a straw man to further Randall's point, and the off-panel character is portrayed as the (sarcastic) voice of reason.&lt;br /&gt;
&lt;br /&gt;
Randall returns to a recurring theme in his comics, regarding, in contexts of communication, the responsibility of the speaker for how they are interpreted. Having gradually gotten less subtle, this theme is now laid bare, there being no joke other than the sarcasm. What follows is a chronological history of this theme.&lt;br /&gt;
&lt;br /&gt;
*Much earlier than the other comics below, but related, [[169: Words that End in GRY]] is a surreal reprimand upon people who act smug when their bad communication is misunderstood.&lt;br /&gt;
*The title text of [[1028: Communication]] notes that “Anyone who says that they're great at communicating but 'people are bad at listening' is confused about how communication works.”&lt;br /&gt;
*The title text of [[1860: Communicating]] also asserts that the responsibility of a misunderstanding lies with the speaker, not the listener — a theme explored in the comic via the character Humpty Dumpty.&lt;br /&gt;
*The comic [[1911: Defensive Profile]] implies that a person who boasts of having “no filter” in their (social media) speech is actually merely insecure about making people mad with their statements.&lt;br /&gt;
&lt;br /&gt;
This theme is part of the larger category of comics about [[:Category:Social interactions|social interactions]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball is sitting in an office chair at a desk in front of a laptop with his hands raised above the keyboard. An off-panel person replies to his remarks.]&lt;br /&gt;
:Cueball: Ugh, people are mad at me again because they don't read carefully.&lt;br /&gt;
:Cueball: I'm being perfectly clear. It's not '''''my''''' fault if everyone misinterprets what I say.&lt;br /&gt;
:Off-panel person: Wow, sounds like you're great at communicating, an activity that famously involves just one person.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Social interactions]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1984:_Misinterpretation&amp;diff=181502</id>
		<title>1984: Misinterpretation</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1984:_Misinterpretation&amp;diff=181502"/>
				<updated>2019-10-21T12:54:37Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1984&lt;br /&gt;
| date      = April 23, 2018&lt;br /&gt;
| title     = Misinterpretation&lt;br /&gt;
| image     = misinterpretation.png&lt;br /&gt;
| titletext = &amp;quot;But there are seven billion people in the world! I can't possibly stop to consider how ALL of them might interpret something!&amp;quot; &amp;quot;Ah, yes, there's no middle ground between 'taking personal responsibility for the thoughts and feelings of every single person on Earth' and 'covering your eyes and ears and yelling logically correct statements into the void.' That's a very insightful point and not at all inane.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
[[Cueball]] is complaining that people are mad at him ''again'' because of a misinterpretation of his statements. This is referenced by the comic's title. He complains that since he (believes he) is being perfectly clear, it cannot be his fault that everyone misinterprets him. The off-screen voice sarcastically agrees that communication is an activity that only involves one person; in fact, of course, it {{w|Communication#Models|famously involves at least two}}.&lt;br /&gt;
&lt;br /&gt;
Cueball speaks as though his communications are complete and perfect once he has finished making them. The reality is that communication can't be considered complete until the message has also been received and understood. Cueball is failing to take into account the need for partnership between sender and receiver, and doesn't realise that the problem may well be in the way he carries out his side of the transaction rather than in the way ''everybody'' else is carrying out theirs. &lt;br /&gt;
&lt;br /&gt;
In the title text, Cueball then answers that he cannot possibly account for the many possible interpretations which the message, potentially reaching the whole world, could acquire. This is an example of the {{w|Nirvana fallacy}}. Cueball's idealized solution is to consider how every person on Earth would interpret the message, so Cueball rejects doing anything less as insufficient; however, actually figuring out how every person on Earth would interpret the message is unfeasible, so Cueball doesn't do that either. The reply comes once again sarcastically, deriding his point and saying that a middle ground between taking up such an effort and entirely avoiding it must be reached.&lt;br /&gt;
&lt;br /&gt;
This avoidance is phrased using a [[762: Analogies|simile]] as “covering your eyes and ears and yelling logically correct statements into the void”, implying that no one would understand the logical sentences (thus the void), and would instead read them more naturally – and also that ignoring the appalled reaction of listeners to their own interpretation of the sentences is similar to covering your eyes and ears. This action makes communication more difficult through the popular{{Citation needed}} means of speech, text and sign language. If the hands are occupied with covering either part, then Braille communication is also impossible. Therefore, the action of “covering your eyes and ears” is a metaphor for deliberately making it more difficult to communicate with oneself. The simile might also mean that Cueball subconsciously rejects criticism as it would hurt his ego.&lt;br /&gt;
&lt;br /&gt;
It is clear that Cueball is acting as a straw man to further Randall's point, and the off-panel character is portrayed as the (sarcastic) voice of reason.&lt;br /&gt;
&lt;br /&gt;
Randall returns to a recurring theme in his comics, regarding, in contexts of communication, the responsibility of the speaker for how they are interpreted. Having gradually gotten less subtle, this theme is now laid bare, there being no joke other than the sarcasm. What follows is a chronological history of this theme.&lt;br /&gt;
&lt;br /&gt;
*Much earlier than the other comics below, but related, [[169: Words that End in GRY]] is a surreal reprimand upon people who act smug when their bad communication is misunderstood.&lt;br /&gt;
*The title text of [[1028: Communication]] notes that “Anyone who says that they're great at communicating but 'people are bad at listening' is confused about how communication works.”&lt;br /&gt;
*The title text of [[1860: Communicating]] also asserts that the responsibility of a misunderstanding lies with the speaker, not the listener — a theme explored in the comic via the character Humpty Dumpty.&lt;br /&gt;
*The comic [[1911: Defensive Profile]] implies that a person who boasts of having “no filter” in their (social media) speech is actually merely insecure about making people mad with their statements.&lt;br /&gt;
&lt;br /&gt;
This theme is part of the larger category of comics about [[:Category:Social interactions|social interactions]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball is sitting in an office chair at a desk in front of a laptop with his hands raised above the keyboard. An off-panel person replies to his remarks.]&lt;br /&gt;
:Cueball: Ugh, people are mad at me again because they don't read carefully.&lt;br /&gt;
:Cueball: I'm being perfectly clear. It's not '''''my''''' fault if everyone misinterprets what I say.&lt;br /&gt;
:Off-panel person: Wow, sounds like you're great at communicating, an activity that famously involves just one person.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Social interactions]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1724:_Proofs&amp;diff=181481</id>
		<title>1724: Proofs</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1724:_Proofs&amp;diff=181481"/>
				<updated>2019-10-21T02:37:36Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1724&lt;br /&gt;
| date      = August 24, 2016&lt;br /&gt;
| title     = Proofs&lt;br /&gt;
| image     = proofs.png&lt;br /&gt;
| titletext = Next, let's assume the decision of whether to take the Axiom of Choice is made by a deterministic process ...&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
[[Miss Lenhart]] is teaching a math class. She begins a proof when one of her students ([[Cueball]]) interrupts her asking if this is one of those dark-magic (unclear, incomprehensible) proofs. She claims no, but in a matter of seconds Cueball is calling out that he was right.&lt;br /&gt;
&lt;br /&gt;
The proof she starts setting up resembles a {{w|proof by contradiction}}. However, after Cueball's interruption Miss Lenhart's proof takes a turn for the absurd: rather than assuming there will be a point in the function that correlates to co-ordinates (x, y), Miss Lenhart assumes that the ''act of writing numbers on the board'' will correlate to co-ordinates (x, y).&lt;br /&gt;
&lt;br /&gt;
A ''normal'' proof by contradiction begins by assuming that a particular condition is true; by demonstrating the implications of this assumption, a logical contradiction is reached, thus disproving the initial assumption. One example of a proof by contradiction is the proof that √2 is an irrational number:&lt;br /&gt;
&lt;br /&gt;
# Assume that √2 is a rational number, meaning that there exists a pair of integers whose ratio is √2.&lt;br /&gt;
# If the two integers have a common factor, it can be eliminated using the Euclidean algorithm.&lt;br /&gt;
# Then √2 can be written as an irreducible fraction ''a''/''b'' such that ''a'' and ''b'' are coprime integers (having no common factor).&lt;br /&gt;
# The equation ''a''/''b'' {{=}} √2, when multiplied by itself, gives ''a²''/''b²'' {{=}} 2, which can be rearranged as ''a²'' {{=}} 2''b²''.&lt;br /&gt;
# Therefore, ''a²'' is even because it is equal to 2''b²''. (2''b²'' is necessarily even because it is 2 times another whole number, and multiples of 2 are even.)&lt;br /&gt;
# It follows that ''a'' must be even (as squares of odd integers are never even).&lt;br /&gt;
# Because ''a'' is even, there exists an integer ''k'' that fulfills: ''a'' {{=}} 2''k''.&lt;br /&gt;
# Substituting 2''k'' from step 7 for ''a'' in the second equation of step 4: 2''b²'' {{=}} (2''k'')''²'' is equivalent to 2''b²'' {{=}} 4''k²'', which is equivalent to ''b²'' {{=}} 2''k²''.&lt;br /&gt;
# Because 2''k²'' is divisible by two and therefore even, and because 2''k²'' {{=}} ''b²'', it follows that ''b²'' is also even, which means that ''b'' is even.&lt;br /&gt;
# By steps 6 and 9, ''a'' and ''b'' are both even, which contradicts that ''a''/''b'' is irreducible as stated in step 3.&lt;br /&gt;
::'''''Q.E.D.'''''&lt;br /&gt;
&lt;br /&gt;
Alternatively, instead of a proof by contradiction the setup could be for a one way function. For example, it is relatively easy to test that a solution to a differential equation is valid but choosing the correct solution to test can seem like black magic to students.&lt;br /&gt;
&lt;br /&gt;
The way that Ms Lenhart's proof refers to the act of doing math itself, is characteristic of metamathematical proofs, for example {{w|Gödel's incompleteness theorems}}, which, at first sight, may indeed look like black magic, even if in the end they must be a &amp;quot;perfectly sensible chain of reasoning&amp;quot; like the rest of good mathematics. While typical mathematical theorems and their proofs deal with such mathematical objects as numbers, functions, points or lines, the metamathematical theorems treat other theorems as objects of interest. In this way you can propose and prove theorems about possibility of proving other theorems. For example, in 1931 {{w|Kurt Gödel}} was able to prove that any mathematical system based on arithmetics (that is using numbers) has statements that are true, but can be neither proved nor disproved. This kind of metamathematical reasoning is especially useful in {{w|set theory}}, where many statements become impossible to prove and disprove if the {{w|axiom of choice}} is not taken as a part of the axiomatic system.&lt;br /&gt;
&lt;br /&gt;
Using a position on the blackboard as a part of the proof is a joke, but it bears a resemblance to {{w|Cantor's diagonal argument}} where a position in a sequence of digits of a real number was a tool in a proof that not all infinite sets have the same {{w|cardinality}} (rough equivalent of the number of elements). This &amp;quot;diagonal method&amp;quot; is also often used in metamathematical proofs.&lt;br /&gt;
&lt;br /&gt;
The axiom of choice itself states that for every collection of nonempty sets, you can have a function that draws one element from each set of the collection. This axiom, once considered controversial, was added relatively late to the axiomatic set theory, and even contemporary mathematicians still study which theorems really require its inclusion. In the title text the decision of whether to take the axiom of choice is made by a deterministic process, that is a process which future states can be developed with no randomness involved. {{w|Determinacy}} of infinite games is used as a tool in the set theory, however the deterministic process is rather a term of the {{w|stochastic process|stochastic processes theory}}, and the {{w|dynamical systems theory}}, branches of mathematics far from the abstract set theory, which makes the proof even more exotic. The axiom of choice was mentioned earlier in [[804: Pumpkin Carving]] and later in [[982: Set Theory]], another comic about a math class with a similar theme on how teachers teach their student mathematical proofs.&lt;br /&gt;
&lt;br /&gt;
Although Miss Lenhart did retire a year ago after [[1519: Venus]], she seems to have returned here for a math course at university level, but continues the trend she finished with in her prior class. A very similar Miss Lenhart comic was later released with [[2028: Complex Numbers]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Miss Lenhart is standing facing left in front of a whiteboard writing on it. Eleven left aligned lines of writing is shown as unreadable scribbles. A voice interrupts her from off-panel right.]&lt;br /&gt;
:Miss Lenhart: ... Let's assume there exists some function ''F''(''a,b,c''...) which produces the correct answer-&lt;br /&gt;
:Cueball (off-panel): Hang on.&lt;br /&gt;
&lt;br /&gt;
:[In a frame-less panel Cueball is sitting on a chair at a desk with a pen in his hand taking notes.]&lt;br /&gt;
:Cueball: This is going to be one of those weird, dark magic proofs, isn't it? I can tell.&lt;br /&gt;
&lt;br /&gt;
:[Miss Lenhart has turned right towards Cueball, who is again speaking off-panel. The white board is also off-panel.]&lt;br /&gt;
:Miss Lenhart: What? No, no, it's a perfectly sensible chain of reasoning.&lt;br /&gt;
:Cueball (off-panel): All right...&lt;br /&gt;
&lt;br /&gt;
:[Miss Lenhart is facing the whiteboard again writing more scribbles behind some of the lines from before (the first line has disappeared). The lines that have more text added are now number three and five (four and six before). Cueball again speaks off-panel.]&lt;br /&gt;
:Miss Lenhart: Now, let's assume that the correct answer will eventually be written on the board at the coordinates (''x, y''). If we—&lt;br /&gt;
:Cueball (off-panel): I ''knew'' it!&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Miss Lenhart]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Math]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1925:_Self-Driving_Car_Milestones&amp;diff=181478</id>
		<title>1925: Self-Driving Car Milestones</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1925:_Self-Driving_Car_Milestones&amp;diff=181478"/>
				<updated>2019-10-20T23:05:12Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1925&lt;br /&gt;
| date      = December 6, 2017&lt;br /&gt;
| title     = Self-Driving Car Milestones&lt;br /&gt;
| image     = self_driving_car_milestones.png&lt;br /&gt;
| titletext = I'm working on a car capable of evaluating arbitrarily complex boolean expressions on &amp;quot;honk if [...]&amp;quot; bumper stickers and responding accordingly.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
With the creation of self driving cars, many new milestones are being found and / or solved thanks to them. Some are good, and some are downright weird. This comic lists some that have already been achieved, some that that are being worked on, and some that are facetious &amp;quot;milestones&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
===Milestones that have been fully or partially achieved===&lt;br /&gt;
&lt;br /&gt;
;Automatic emergency brakes&lt;br /&gt;
:This is another reference to how hard it can be to program human-obvious stuff (as in [[1425: Tasks]]). A self driving car has to be able to distinguish a danger (cliff, person on foot/cycle/etc., other cars coming the wrong way/doing weird stuff) from the side of the road, the background, the other cars or even a light pole safely standing on the side of the road. Then the car also has to decide the optimal response, taking into account weather conditions, road type and traffic - whether to turn aside, just slow down (as danger is not imminent), or actually do the strong brake. There are big potential advantages for self-driving cars, if this problem can be solved: computers don't tend to panic as much as humans, would have faster reaction times, and would have {{w|Autonomous_car#Safety|more reliable judgment}}.&lt;br /&gt;
&lt;br /&gt;
;Highway lane-keeping&lt;br /&gt;
:Sometimes, especially on highways where road delimitations might be [https://upload.wikimedia.org/wikipedia/commons/thumb/1/11/Route_66_2073773569_7b3fae3b91_b.jpg/220px-Route_66_2073773569_7b3fae3b91_b.jpg faint or absent], or when lane markings could have faded away, a self-driving car programmed to pilot based on road markings would have issues holding to the correct side of the road. This is a bigger problem on highways than in cities, as cars move faster on highways, so the danger detection mentioned above might not manage to detect danger in time, while braking or avoiding the obstacle needs to be anticipated much more.&lt;br /&gt;
&lt;br /&gt;
;Self-parking&lt;br /&gt;
:Already implemented in recent normal cars, this feature is important to remove the car from the road while not in use, and is sometimes considered a difficult maneuver for drivers to master, as it requires a good &amp;quot;feeling&amp;quot; of the car dimensions, as well as of distances and maneuverability of the car, and information about surrounding barriers. The latter parameters, being easy to sense with radar and back-camera aide, are made more reliable with computers.&lt;br /&gt;
&lt;br /&gt;
;Full highway autonomy&lt;br /&gt;
:The ability for a car to drive itself on a highway. As of 2017, there are [http://www.popularmechanics.com/technology/infrastructure/a13615577/self-driving-cars-lane-wisconsin/ plans] under consideration to set highway lanes aside for self-driving cars, but this milestone would require a car to be able to operate on a highway that also has human-driven cars, as well as wildlife, pedestrians, debris, and other obstacles, should they enter the highway.&lt;br /&gt;
&lt;br /&gt;
;First sex in a self-driving car&lt;br /&gt;
:This is not a milestone for the cars themselves, but just the age-old practice of having sex in cars, performed in a car that happens to be self-driving. Given the nature of human sexuality, it is probable that this had already happened at the time of this comic. The first public documentation of this milestone was published in May of 2019, as a video featuring coitus occurring in a Tesla Model X on autopilot went viral on PornHub.&lt;br /&gt;
&lt;br /&gt;
;Full trips with no input from driver&lt;br /&gt;
:The main point of self-driving cars, allowing all humans within to act as passengers. As of 2017, self-driving cars require a human to be able to take over just in case, but any such trip where the human never actually took control would qualify for this milestone. However, there could be an additional joke here that the car is driving without human input ''including the destination.'' In this case, the car itself is choosing where to go, leaving the humans helpless.&lt;br /&gt;
&lt;br /&gt;
===Milestones not yet reached===&lt;br /&gt;
;Full trips by empty cars&lt;br /&gt;
:A more complete version of the above, since with no humans present, no human can take control. This could be considered fulfilled by the {{w|DARPA Grand Challenge}} entrants, as the challenges are racing competitions of autonomous cars with no humans on board.&lt;br /&gt;
&lt;br /&gt;
;Self-refueling of empty cars&lt;br /&gt;
:This would require either: a robotic fuel station, able to refuel cars with humans inside as well; an ordinary full-service fuel station (that is, one where the station's employee performs the refueling of the car) that happens to service a self-driving car with no humans aboard (which could be arranged as a publicity stunt); a specially designed fuel station that would allow self-driving cars to refuel by docking to it (likely to require fine control of the docking procedure that would render it unsuitable for more fallible human-driven cars); or, perhaps least likely, a robotic arm attachment on the car that would allow it to use a normal self-service fuel station. Currently [https://www.theverge.com/2015/8/6/9109027/tesla-model-s-snake-charger-elon-musk Tesla's robotic charging station] is the closest thing to this accomplishment.&lt;br /&gt;
&lt;br /&gt;
===Facetious milestones===&lt;br /&gt;
;An empty car wandering the highways for months or years until someone notices the credit card fuel charges&lt;br /&gt;
:Cars are expensive enough that, were one to drive itself off and wander, some effort would be made to track it down. As this would require the self-refueling milestone, local fuel stations could be alerted to look for the &amp;quot;rogue&amp;quot; car—and in any case, whatever payment method is used to pay for the fuel would be traced.&lt;br /&gt;
&lt;br /&gt;
;Cars that read other cars' bumper stickers before deciding whether to cut them off&lt;br /&gt;
:Another facetious milestone, implying self-driving cars might obtain the capacity to hold and act upon opinions that might override safety and efficiency of transit. This would be generally considered undesirable{{Citation needed}}, so this seems unlikely to actually happen, except perhaps as an unintended consequence of runaway self-learning.&lt;br /&gt;
&lt;br /&gt;
;Autonomous engine revving at red lights&lt;br /&gt;
:Mimicking the human practice. This is often done by human drivers who wish to draw attention to their car and then speed off as quickly as possible once the light turns green, but is regarded by most as being a nuisance. As such, this is an unlikely goal for self-driving cars to achieve.&lt;br /&gt;
&lt;br /&gt;
;Self-loathing cars&lt;br /&gt;
:This would require cars to become sentient enough to understand, and have negative opinions about, themselves. Depending on one's definition, though, self-diagnostic software might qualify, as they would be running on a car's computer and could express a negative opinion about the car (albeit normally limited to the context of the car needing maintenance).&lt;br /&gt;
&lt;br /&gt;
;Autonomous canyon jumping&lt;br /&gt;
:Although it seems unlikely that a navigation routine would ever decide that jumping a canyon is part of an optimal route, a car could be programmed to jump a canyon as part of a stunt or show, with no human driver (or any other human aboard) at the time of the jump. It is questionable how &amp;quot;autonomous&amp;quot; such a car would be, though. Could also be a reference to the next point, with another popular setting in below mentioned discussions: &amp;quot;should a self-driving car leave the road and drive into a canyon, which will kill the driver (and passengers), or stay on the road and kill others?&amp;quot;. Possibly a reference to [https://electrek.co/2017/04/19/tesla-model-s-crash-cliff-save-life/ when a Tesla was driven off a cliff] and the driver and his passenger survived without injury. The car was not on autopilot at the time. Could also be a reference to the previous point where the car develops enough self-loathing to want to commit suicide. Or it may be a reference to [http://www.imdb.com/title/tt0620882/ certain Knight Rider episodes.]&lt;br /&gt;
&lt;br /&gt;
;Cars capable of arguing about the trolley problem on {{w|Facebook}}&lt;br /&gt;
:The {{w|Trolley problem}} is a well-known thought experiment in ethics, in which a person must choose between passively allowing several people to die, or actively causing a single person to die. With the increasing likelihood of fully autonomous vehicles, there's been a flurry of interest in this problem, centered around what a vehicle should be programmed to do in such a case (for example, if avoiding a high-speed collision required running over a pedestrian). Munroe seems to mock this debate by arguing that the true milestone would not be when the vehicle can make such a decision, but when it can argue about it on Facebook. This may refer to the idea that humans aren't capable of agreeing on a resolution to the problem, so expecting a vehicle to resolve it would be less reasonable than expecting it to be able to debate. On the day this comic was released the Youtube channel Vsauce posted a video, [https://youtu.be/1sl5KJ69qiA The Greater Good - Mind Field S2 (Ep 1)], where they tested people's reactions to the trolley problem in a fake situation where the subjects genuinely believed they were in a situation where they where choosing between saving five from an oncoming train by killing one on another track. Given such a coincidence, it is extremely likely that this milestone was added after Munroe saw the episode.&lt;br /&gt;
&lt;br /&gt;
;Evaluating arbitrarily complex Boolean expressions on &amp;quot;honk if [...]&amp;quot; bumper stickers and responding accordingly (title text)&lt;br /&gt;
:As with the cut-off milestone, this implies development of artificial intelligence unrelated to the basic functions of a car, though still imitating human drivers' behavior. This joke is a reference to [[1033| a previous comic about honking and formal logic]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
:Upcoming and recently-achieved&lt;br /&gt;
:'''Self-driving car milestones'''&lt;br /&gt;
&lt;br /&gt;
:* Automatic emergency braking&lt;br /&gt;
:* Highway lane-keeping&lt;br /&gt;
:* Self-parking&lt;br /&gt;
:* Full highway autonomy&lt;br /&gt;
:* First sex in a self-driving car&lt;br /&gt;
:* Full trips with no input from driver&lt;br /&gt;
:* Full trips by empty cars&lt;br /&gt;
:* An empty car wandering the highways for months or years until someone notices the credit card fuel charges&lt;br /&gt;
:* Cars that read other cars' bumper stickers before deciding whether to cut them off&lt;br /&gt;
:* Autonomous engine revving at red lights&lt;br /&gt;
:* Self-loathing cars&lt;br /&gt;
:* Autonomous canyon jumping&lt;br /&gt;
:* Cars capable of arguing about the trolley problem on Facebook&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*The Trolley problem became part of the joke a month after this comic in [[1938: Meltdown and Spectre]]. And earlier, in [[1455: Trolley Problem]], it is even the entire subject.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Self-driving cars]]&lt;br /&gt;
[[Category:Sex]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1925:_Self-Driving_Car_Milestones&amp;diff=181477</id>
		<title>1925: Self-Driving Car Milestones</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1925:_Self-Driving_Car_Milestones&amp;diff=181477"/>
				<updated>2019-10-20T22:58:58Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1925&lt;br /&gt;
| date      = December 6, 2017&lt;br /&gt;
| title     = Self-Driving Car Milestones&lt;br /&gt;
| image     = self_driving_car_milestones.png&lt;br /&gt;
| titletext = I'm working on a car capable of evaluating arbitrarily complex boolean expressions on &amp;quot;honk if [...]&amp;quot; bumper stickers and responding accordingly.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
With the creation of self driving cars, many new milestones are being found and / or solved thanks to them. Some are good, and some are downright weird. This comic lists some that have already been achieved, some that that are being worked on, and some that are facetious &amp;quot;milestones&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
===Milestones===&lt;br /&gt;
&lt;br /&gt;
;Automatic emergency brakes&lt;br /&gt;
:This is another reference to how hard it can be to program human-obvious stuff (as in [[1425: Tasks]]). A self driving car has to be able to distinguish a danger (cliff, person on foot/cycle/etc., other cars coming the wrong way/doing weird stuff) from the side of the road, the background, the other cars or even a light pole safely standing on the side of the road. Then the car also has to decide the optimal response, taking into account weather conditions, road type and traffic - whether to turn aside, just slow down (as danger is not imminent), or actually do the strong brake. There are big potential advantages for self-driving cars, if this problem can be solved: computers don't tend to panic as much as humans, would have faster reaction times, and would have {{w|Autonomous_car#Safety|more reliable judgment}}. (Done)&lt;br /&gt;
&lt;br /&gt;
;Highway lane-keeping&lt;br /&gt;
:Sometimes, especially on highways where road delimitations might be [https://upload.wikimedia.org/wikipedia/commons/thumb/1/11/Route_66_2073773569_7b3fae3b91_b.jpg/220px-Route_66_2073773569_7b3fae3b91_b.jpg faint or absent], or when lane markings could have faded away, a self-driving car programmed to pilot based on road markings would have issues holding to the correct side of the road. This is a bigger problem on highways than in cities, as cars move faster on highways, so the danger detection mentioned above might not manage to detect danger in time, while braking or avoiding the obstacle needs to be anticipated much more.(Done)&lt;br /&gt;
&lt;br /&gt;
;Self-parking&lt;br /&gt;
:Already implemented in recent normal cars, this feature is important to remove the car from the road while not in use, and is sometimes considered a difficult maneuver for drivers to master, as it requires a good &amp;quot;feeling&amp;quot; of the car dimensions, as well as of distances and maneuverability of the car, and information about surrounding barriers. The latter parameters, being easy to sense with radar and back-camera aide, are made more reliable with computers.(Done)&lt;br /&gt;
&lt;br /&gt;
;Full highway autonomy&lt;br /&gt;
:The ability for a car to drive itself on a highway. As of 2017, there are [http://www.popularmechanics.com/technology/infrastructure/a13615577/self-driving-cars-lane-wisconsin/ plans] under consideration to set highway lanes aside for self-driving cars, but this milestone would require a car to be able to operate on a highway that also has human-driven cars, as well as wildlife, pedestrians, debris, and other obstacles, should they enter the highway.(Done with restrictions)&lt;br /&gt;
&lt;br /&gt;
;First sex in a self-driving car&lt;br /&gt;
:This is not a milestone for the cars themselves, but just the age-old practice of having sex in cars, performed in a car that happens to be self-driving. Given the nature of human sexuality, it is probable that this had already happened at the time of this comic. The first public documentation of this milestone was published in May of 2019, as a video featuring coitus occurring in a Tesla Model X on autopilot went viral on PornHub. (Done)&lt;br /&gt;
&lt;br /&gt;
;Full trips with no input from driver&lt;br /&gt;
:The main point of self-driving cars, allowing all humans within to act as passengers. As of 2017, self-driving cars require a human to be able to take over just in case, but any such trip where the human never actually took control would qualify for this milestone. However, there could be an additional joke here that the car is driving without human input ''including the destination.'' In this case, the car itself is choosing where to go, leaving the humans helpless.&lt;br /&gt;
&lt;br /&gt;
;Full trips by empty cars&lt;br /&gt;
:A more complete version of the above, since with no humans present, no human can take control. This could be considered fulfilled by the {{w|DARPA Grand Challenge}} entrants, as the challenges are racing competitions of autonomous cars with no humans on board.&lt;br /&gt;
&lt;br /&gt;
;Self-refueling of empty cars&lt;br /&gt;
:This would require either: a robotic fuel station, able to refuel cars with humans inside as well; an ordinary full-service fuel station (that is, one where the station's employee performs the refueling of the car) that happens to service a self-driving car with no humans aboard (which could be arranged as a publicity stunt); a specially designed fuel station that would allow self-driving cars to refuel by docking to it (likely to require fine control of the docking procedure that would render it unsuitable for more fallible human-driven cars); or, perhaps least likely, a robotic arm attachment on the car that would allow it to use a normal self-service fuel station. Currently [https://www.theverge.com/2015/8/6/9109027/tesla-model-s-snake-charger-elon-musk Tesla's robotic charging station] is the closest thing to this accomplishment.&lt;br /&gt;
&lt;br /&gt;
;An empty car wandering the highways for months or years until someone notices the credit card fuel charges&lt;br /&gt;
:The first completely facetious milestone of the list (since &amp;quot;first sex&amp;quot;, despite having little to do with self-driving cars, has probably happened). Cars are expensive enough that, were one to drive itself off and wander, some effort would be made to track it down. As this would require the self-refueling milestone, local fuel stations could be alerted to look for the &amp;quot;rogue&amp;quot; car—and in any case, whatever payment method is used to pay for the fuel would be traced.&lt;br /&gt;
&lt;br /&gt;
;Cars that read other cars' bumper stickers before deciding whether to cut them off&lt;br /&gt;
:Another facetious milestone, implying self-driving cars might obtain the capacity to hold and act upon opinions that might override safety and efficiency of transit. This would be generally considered undesirable{{Citation needed}}, so this seems unlikely to actually happen, except perhaps as an unintended consequence of runaway self-learning.&lt;br /&gt;
&lt;br /&gt;
;Autonomous engine revving at red lights&lt;br /&gt;
:Mimicking the human practice. This is often done by human drivers who wish to draw attention to their car and then speed off as quickly as possible once the light turns green, but is regarded by most as being a nuisance. As such, this is an unlikely goal for self-driving cars to achieve.&lt;br /&gt;
&lt;br /&gt;
;Self-loathing cars&lt;br /&gt;
:This would require cars to become sentient enough to understand, and have negative opinions about, themselves. Depending on one's definition, though, self-diagnostic software might qualify, as they would be running on a car's computer and could express a negative opinion about the car (albeit normally limited to the context of the car needing maintenance).&lt;br /&gt;
&lt;br /&gt;
;Autonomous canyon jumping&lt;br /&gt;
:Although it seems unlikely that a navigation routine would ever decide that jumping a canyon is part of an optimal route, a car could be programmed to jump a canyon as part of a stunt or show, with no human driver (or any other human aboard) at the time of the jump. It is questionable how &amp;quot;autonomous&amp;quot; such a car would be, though. Could also be a reference to the next point, with another popular setting in below mentioned discussions: &amp;quot;should a self-driving car leave the road and drive into a canyon, which will kill the driver (and passengers), or stay on the road and kill others?&amp;quot;. Possibly a reference to [https://electrek.co/2017/04/19/tesla-model-s-crash-cliff-save-life/ when a Tesla was driven off a cliff] and the driver and his passenger survived without injury. The car was not on autopilot at the time. Could also be a reference to the previous point where the car develops enough self-loathing to want to commit suicide. Or it may be a reference to [http://www.imdb.com/title/tt0620882/ certain Knight Rider episodes.]&lt;br /&gt;
&lt;br /&gt;
;Cars capable of arguing about the trolley problem on {{w|Facebook}}&lt;br /&gt;
:The {{w|Trolley problem}} is a well-known thought experiment in ethics, in which a person must choose between passively allowing several people to die, or actively causing a single person to die. With the increasing likelihood of fully autonomous vehicles, there's been a flurry of interest in this problem, centered around what a vehicle should be programmed to do in such a case (for example, if avoiding a high-speed collision required running over a pedestrian). Munroe seems to mock this debate by arguing that the true milestone would not be when the vehicle can make such a decision, but when it can argue about it on Facebook. This may refer to the idea that humans aren't capable of agreeing on a resolution to the problem, so expecting a vehicle to resolve it would be less reasonable than expecting it to be able to debate. On the day this comic was released the Youtube channel Vsauce posted a video, [https://youtu.be/1sl5KJ69qiA The Greater Good - Mind Field S2 (Ep 1)], where they tested people's reactions to the trolley problem in a fake situation where the subjects genuinely believed they were in a situation where they where choosing between saving five from an oncoming train by killing one on another track. Given such a coincidence, it is extremely likely that this milestone was added after Munroe saw the episode.&lt;br /&gt;
&lt;br /&gt;
;Evaluating arbitrarily complex Boolean expressions on &amp;quot;honk if [...]&amp;quot; bumper stickers and responding accordingly (title text)&lt;br /&gt;
:As with the cut-off milestone, this implies development of artificial intelligence unrelated to the basic functions of a car, though still imitating human drivers' behavior. This joke is a reference to [[1033| a previous comic about honking and formal logic]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
:Upcoming and recently-achieved&lt;br /&gt;
:'''Self-driving car milestones'''&lt;br /&gt;
&lt;br /&gt;
:* Automatic emergency braking&lt;br /&gt;
:* Highway lane-keeping&lt;br /&gt;
:* Self-parking&lt;br /&gt;
:* Full highway autonomy&lt;br /&gt;
:* First sex in a self-driving car&lt;br /&gt;
:* Full trips with no input from driver&lt;br /&gt;
:* Full trips by empty cars&lt;br /&gt;
:* An empty car wandering the highways for months or years until someone notices the credit card fuel charges&lt;br /&gt;
:* Cars that read other cars' bumper stickers before deciding whether to cut them off&lt;br /&gt;
:* Autonomous engine revving at red lights&lt;br /&gt;
:* Self-loathing cars&lt;br /&gt;
:* Autonomous canyon jumping&lt;br /&gt;
:* Cars capable of arguing about the trolley problem on Facebook&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*The Trolley problem became part of the joke a month after this comic in [[1938: Meltdown and Spectre]]. And earlier, in [[1455: Trolley Problem]], it is even the entire subject.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Self-driving cars]]&lt;br /&gt;
[[Category:Sex]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1925:_Self-Driving_Car_Milestones&amp;diff=181476</id>
		<title>1925: Self-Driving Car Milestones</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1925:_Self-Driving_Car_Milestones&amp;diff=181476"/>
				<updated>2019-10-20T22:58:02Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1925&lt;br /&gt;
| date      = December 6, 2017&lt;br /&gt;
| title     = Self-Driving Car Milestones&lt;br /&gt;
| image     = self_driving_car_milestones.png&lt;br /&gt;
| titletext = I'm working on a car capable of evaluating arbitrarily complex boolean expressions on &amp;quot;honk if [...]&amp;quot; bumper stickers and responding accordingly.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
With the creation of self driving cars, many new milestones are being found and / or solved thanks to them. Some are good, and some are downright weird. This comic lists some that have already been achieved, some that that are being worked on, and some that are facetious &amp;quot;milestones&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
===Milestones===&lt;br /&gt;
&lt;br /&gt;
;Automatic emergency brakes&lt;br /&gt;
:This is another reference to how hard it can be to program human-obvious stuff (as in [[1425: Tasks]]). A self driving car has to be able to distinguish a danger (cliff, person on foot/cycle/etc., other cars coming the wrong way/doing weird stuff) from the side of the road, the background, the other cars or even a light pole safely standing on the side of the road. Then the car also has to decide the optimal response, taking into account weather conditions, road type and traffic - whether to turn aside, just slow down (as danger is not imminent), or actually do the strong brake. There are big potential advantages for self-driving cars, if this problem can be solved: computers don't tend to panic as much as humans, would have faster reaction times, and would have {{w|Autonomous_car#Safety|more reliable judgment}}. (Done)&lt;br /&gt;
&lt;br /&gt;
;Highway lane-keeping&lt;br /&gt;
:Sometimes, especially on highways where road delimitations might be [https://upload.wikimedia.org/wikipedia/commons/thumb/1/11/Route_66_2073773569_7b3fae3b91_b.jpg/220px-Route_66_2073773569_7b3fae3b91_b.jpg faint or absent], or when lane markings could have faded away, a self-driving car programmed to pilot based on road markings would have issues holding to the correct side of the road. This is a bigger problem on highways than in cities, as cars move faster on highways, so the danger detection mentioned above might not manage to detect danger in time, while braking or avoiding the obstacle needs to be anticipated much more.(Done)&lt;br /&gt;
&lt;br /&gt;
;Self-parking&lt;br /&gt;
:Already implemented in recent normal cars, this feature is important to remove the car from the road while not in use, and is sometimes considered a difficult maneuver for drivers to master, as it requires a good &amp;quot;feeling&amp;quot; of the car dimensions, as well as of distances and maneuverability of the car, and information about surrounding barriers. The latter parameters, being easy to sense with radar and back-camera aide, are made more reliable with computers.(Done)&lt;br /&gt;
&lt;br /&gt;
;Full highway autonomy&lt;br /&gt;
:The ability for a car to drive itself on a highway. As of 2017, there are [http://www.popularmechanics.com/technology/infrastructure/a13615577/self-driving-cars-lane-wisconsin/ plans] under consideration to set highway lanes aside for self-driving cars, but this milestone would require a car to be able to operate on a highway that also has human-driven cars, as well as wildlife, pedestrians, debris, and other obstacles, should they enter the highway.(Done with restrictions)&lt;br /&gt;
&lt;br /&gt;
;First sex in a self-driving car&lt;br /&gt;
:This is not a milestone for the cars themselves, but just the age-old practice of having sex in cars, performed in a car that happens to be self-driving. Given the nature of human sexuality, it is probable that this had already happened at the time of this comic. The first public documentation of this milestone was published in May of 2019, as a video featuring coitus occurring in a Tesla Model X on autopilot went viral on PornHub.&lt;br /&gt;
&lt;br /&gt;
;Full trips with no input from driver&lt;br /&gt;
:The main point of self-driving cars, allowing all humans within to act as passengers. As of 2017, self-driving cars require a human to be able to take over just in case, but any such trip where the human never actually took control would qualify for this milestone. However, there could be an additional joke here that the car is driving without human input ''including the destination.'' In this case, the car itself is choosing where to go, leaving the humans helpless.&lt;br /&gt;
&lt;br /&gt;
;Full trips by empty cars&lt;br /&gt;
:A more complete version of the above, since with no humans present, no human can take control. This could be considered fulfilled by the {{w|DARPA Grand Challenge}} entrants, as the challenges are racing competitions of autonomous cars with no humans on board.&lt;br /&gt;
&lt;br /&gt;
;Self-refueling of empty cars&lt;br /&gt;
:This would require either: a robotic fuel station, able to refuel cars with humans inside as well; an ordinary full-service fuel station (that is, one where the station's employee performs the refueling of the car) that happens to service a self-driving car with no humans aboard (which could be arranged as a publicity stunt); a specially designed fuel station that would allow self-driving cars to refuel by docking to it (likely to require fine control of the docking procedure that would render it unsuitable for more fallible human-driven cars); or, perhaps least likely, a robotic arm attachment on the car that would allow it to use a normal self-service fuel station. Currently [https://www.theverge.com/2015/8/6/9109027/tesla-model-s-snake-charger-elon-musk Tesla's robotic charging station] is the closest thing to this accomplishment.&lt;br /&gt;
&lt;br /&gt;
;An empty car wandering the highways for months or years until someone notices the credit card fuel charges&lt;br /&gt;
:The first completely facetious milestone of the list (since &amp;quot;first sex&amp;quot;, despite having little to do with self-driving cars, has probably happened). Cars are expensive enough that, were one to drive itself off and wander, some effort would be made to track it down. As this would require the self-refueling milestone, local fuel stations could be alerted to look for the &amp;quot;rogue&amp;quot; car—and in any case, whatever payment method is used to pay for the fuel would be traced.&lt;br /&gt;
&lt;br /&gt;
;Cars that read other cars' bumper stickers before deciding whether to cut them off&lt;br /&gt;
:Another facetious milestone, implying self-driving cars might obtain the capacity to hold and act upon opinions that might override safety and efficiency of transit. This would be generally considered undesirable{{Citation needed}}, so this seems unlikely to actually happen, except perhaps as an unintended consequence of runaway self-learning.&lt;br /&gt;
&lt;br /&gt;
;Autonomous engine revving at red lights&lt;br /&gt;
:Mimicking the human practice. This is often done by human drivers who wish to draw attention to their car and then speed off as quickly as possible once the light turns green, but is regarded by most as being a nuisance. As such, this is an unlikely goal for self-driving cars to achieve.&lt;br /&gt;
&lt;br /&gt;
;Self-loathing cars&lt;br /&gt;
:This would require cars to become sentient enough to understand, and have negative opinions about, themselves. Depending on one's definition, though, self-diagnostic software might qualify, as they would be running on a car's computer and could express a negative opinion about the car (albeit normally limited to the context of the car needing maintenance).&lt;br /&gt;
&lt;br /&gt;
;Autonomous canyon jumping&lt;br /&gt;
:Although it seems unlikely that a navigation routine would ever decide that jumping a canyon is part of an optimal route, a car could be programmed to jump a canyon as part of a stunt or show, with no human driver (or any other human aboard) at the time of the jump. It is questionable how &amp;quot;autonomous&amp;quot; such a car would be, though. Could also be a reference to the next point, with another popular setting in below mentioned discussions: &amp;quot;should a self-driving car leave the road and drive into a canyon, which will kill the driver (and passengers), or stay on the road and kill others?&amp;quot;. Possibly a reference to [https://electrek.co/2017/04/19/tesla-model-s-crash-cliff-save-life/ when a Tesla was driven off a cliff] and the driver and his passenger survived without injury. The car was not on autopilot at the time. Could also be a reference to the previous point where the car develops enough self-loathing to want to commit suicide. Or it may be a reference to [http://www.imdb.com/title/tt0620882/ certain Knight Rider episodes.]&lt;br /&gt;
&lt;br /&gt;
;Cars capable of arguing about the trolley problem on {{w|Facebook}}&lt;br /&gt;
:The {{w|Trolley problem}} is a well-known thought experiment in ethics, in which a person must choose between passively allowing several people to die, or actively causing a single person to die. With the increasing likelihood of fully autonomous vehicles, there's been a flurry of interest in this problem, centered around what a vehicle should be programmed to do in such a case (for example, if avoiding a high-speed collision required running over a pedestrian). Munroe seems to mock this debate by arguing that the true milestone would not be when the vehicle can make such a decision, but when it can argue about it on Facebook. This may refer to the idea that humans aren't capable of agreeing on a resolution to the problem, so expecting a vehicle to resolve it would be less reasonable than expecting it to be able to debate. On the day this comic was released the Youtube channel Vsauce posted a video, [https://youtu.be/1sl5KJ69qiA The Greater Good - Mind Field S2 (Ep 1)], where they tested people's reactions to the trolley problem in a fake situation where the subjects genuinely believed they were in a situation where they where choosing between saving five from an oncoming train by killing one on another track. Given such a coincidence, it is extremely likely that this milestone was added after Munroe saw the episode.&lt;br /&gt;
&lt;br /&gt;
;Evaluating arbitrarily complex Boolean expressions on &amp;quot;honk if [...]&amp;quot; bumper stickers and responding accordingly (title text)&lt;br /&gt;
:As with the cut-off milestone, this implies development of artificial intelligence unrelated to the basic functions of a car, though still imitating human drivers' behavior. This joke is a reference to [[1033| a previous comic about honking and formal logic]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
:Upcoming and recently-achieved&lt;br /&gt;
:'''Self-driving car milestones'''&lt;br /&gt;
&lt;br /&gt;
:* Automatic emergency braking&lt;br /&gt;
:* Highway lane-keeping&lt;br /&gt;
:* Self-parking&lt;br /&gt;
:* Full highway autonomy&lt;br /&gt;
:* First sex in a self-driving car&lt;br /&gt;
:* Full trips with no input from driver&lt;br /&gt;
:* Full trips by empty cars&lt;br /&gt;
:* An empty car wandering the highways for months or years until someone notices the credit card fuel charges&lt;br /&gt;
:* Cars that read other cars' bumper stickers before deciding whether to cut them off&lt;br /&gt;
:* Autonomous engine revving at red lights&lt;br /&gt;
:* Self-loathing cars&lt;br /&gt;
:* Autonomous canyon jumping&lt;br /&gt;
:* Cars capable of arguing about the trolley problem on Facebook&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*The Trolley problem became part of the joke a month after this comic in [[1938: Meltdown and Spectre]]. And earlier, in [[1455: Trolley Problem]], it is even the entire subject.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Self-driving cars]]&lt;br /&gt;
[[Category:Sex]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1925:_Self-Driving_Car_Milestones&amp;diff=181475</id>
		<title>1925: Self-Driving Car Milestones</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1925:_Self-Driving_Car_Milestones&amp;diff=181475"/>
				<updated>2019-10-20T22:56:59Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Milestones */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1925&lt;br /&gt;
| date      = December 6, 2017&lt;br /&gt;
| title     = Self-Driving Car Milestones&lt;br /&gt;
| image     = self_driving_car_milestones.png&lt;br /&gt;
| titletext = I'm working on a car capable of evaluating arbitrarily complex boolean expressions on &amp;quot;honk if [...]&amp;quot; bumper stickers and responding accordingly.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
With the creation of self driving cars, many new milestones are being found and / or solved thanks to them. Some are good, and some are downright weird. This comic lists some that have already been achieved, some that that are being worked on, and some that are facetious &amp;quot;milestones&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
===Milestones===&lt;br /&gt;
&lt;br /&gt;
;Automatic emergency brakes&lt;br /&gt;
:This is another reference to how hard it can be to program human-obvious stuff (as in [[1425: Tasks]]). A self driving car has to be able to distinguish a danger (cliff, person on foot/cycle/etc., other cars coming the wrong way/doing weird stuff) from the side of the road, the background, the other cars or even a light pole safely standing on the side of the road. Then the car also has to decide the optimal response, taking into account weather conditions, road type and traffic - whether to turn aside, just slow down (as danger is not imminent), or actually do the strong brake. There are big potential advantages for self-driving cars, if this problem can be solved: computers don't tend to panic as much as humans, would have faster reaction times, and would have {{w|Autonomous_car#Safety|more reliable judgment}}. (Done)&lt;br /&gt;
&lt;br /&gt;
;Highway lane-keeping&lt;br /&gt;
:Sometimes, especially on highways where road delimitations might be [https://upload.wikimedia.org/wikipedia/commons/thumb/1/11/Route_66_2073773569_7b3fae3b91_b.jpg/220px-Route_66_2073773569_7b3fae3b91_b.jpg faint or absent], or when lane markings could have faded away, a self-driving car programmed to pilot based on road markings would have issues holding to the correct side of the road. This is a bigger problem on highways than in cities, as cars move faster on highways, so the danger detection mentioned above might not manage to detect danger in time, while braking or avoiding the obstacle needs to be anticipated much more.(Done)&lt;br /&gt;
&lt;br /&gt;
;Self-parking&lt;br /&gt;
:Already implemented in recent normal cars, this feature is important to remove the car from the road while not in use, and is sometimes considered a difficult maneuver for drivers to master, as it requires a good &amp;quot;feeling&amp;quot; of the car dimensions, as well as of distances and maneuverability of the car, and information about surrounding barriers. The latter parameters, being easy to sense with radar and back-camera aide, are made more reliable with computers.(Done)&lt;br /&gt;
&lt;br /&gt;
;Full highway autonomy&lt;br /&gt;
:The ability for a car to drive itself on a highway. As of 2017, there are [http://www.popularmechanics.com/technology/infrastructure/a13615577/self-driving-cars-lane-wisconsin/ plans] under consideration to set highway lanes aside for self-driving cars, but this milestone would require a car to be able to operate on a highway that also has human-driven cars, as well as wildlife, pedestrians, debris, and other obstacles, should they enter the highway.(Done with restrictions)&lt;br /&gt;
&lt;br /&gt;
;First sex in a self-driving car&lt;br /&gt;
:This is not a milestone for the cars themselves, but just the age-old practice of having sex in cars, performed in a car that happens to be self-driving. Given the nature of human sexuality, it is probable that this had already happened at the time of the comics publishing. The first public documentation of this milestone was published in May of 2019, as a video featuring coitus occurring in a Tesla Model X on autopilot went viral on PornHub.&lt;br /&gt;
&lt;br /&gt;
;Full trips with no input from driver&lt;br /&gt;
:The main point of self-driving cars, allowing all humans within to act as passengers. As of 2017, self-driving cars require a human to be able to take over just in case, but any such trip where the human never actually took control would qualify for this milestone. However, there could be an additional joke here that the car is driving without human input ''including the destination.'' In this case, the car itself is choosing where to go, leaving the humans helpless.&lt;br /&gt;
&lt;br /&gt;
;Full trips by empty cars&lt;br /&gt;
:A more complete version of the above, since with no humans present, no human can take control. This could be considered fulfilled by the {{w|DARPA Grand Challenge}} entrants, as the challenges are racing competitions of autonomous cars with no humans on board.&lt;br /&gt;
&lt;br /&gt;
;Self-refueling of empty cars&lt;br /&gt;
:This would require either: a robotic fuel station, able to refuel cars with humans inside as well; an ordinary full-service fuel station (that is, one where the station's employee performs the refueling of the car) that happens to service a self-driving car with no humans aboard (which could be arranged as a publicity stunt); a specially designed fuel station that would allow self-driving cars to refuel by docking to it (likely to require fine control of the docking procedure that would render it unsuitable for more fallible human-driven cars); or, perhaps least likely, a robotic arm attachment on the car that would allow it to use a normal self-service fuel station. Currently [https://www.theverge.com/2015/8/6/9109027/tesla-model-s-snake-charger-elon-musk Tesla's robotic charging station] is the closest thing to this accomplishment.&lt;br /&gt;
&lt;br /&gt;
;An empty car wandering the highways for months or years until someone notices the credit card fuel charges&lt;br /&gt;
:The first completely facetious milestone of the list (since &amp;quot;first sex&amp;quot;, despite having little to do with self-driving cars, has probably happened). Cars are expensive enough that, were one to drive itself off and wander, some effort would be made to track it down. As this would require the self-refueling milestone, local fuel stations could be alerted to look for the &amp;quot;rogue&amp;quot; car—and in any case, whatever payment method is used to pay for the fuel would be traced.&lt;br /&gt;
&lt;br /&gt;
;Cars that read other cars' bumper stickers before deciding whether to cut them off&lt;br /&gt;
:Another facetious milestone, implying self-driving cars might obtain the capacity to hold and act upon opinions that might override safety and efficiency of transit. This would be generally considered undesirable{{Citation needed}}, so this seems unlikely to actually happen, except perhaps as an unintended consequence of runaway self-learning.&lt;br /&gt;
&lt;br /&gt;
;Autonomous engine revving at red lights&lt;br /&gt;
:Mimicking the human practice. This is often done by human drivers who wish to draw attention to their car and then speed off as quickly as possible once the light turns green, but is regarded by most as being a nuisance. As such, this is an unlikely goal for self-driving cars to achieve.&lt;br /&gt;
&lt;br /&gt;
;Self-loathing cars&lt;br /&gt;
:This would require cars to become sentient enough to understand, and have negative opinions about, themselves. Depending on one's definition, though, self-diagnostic software might qualify, as they would be running on a car's computer and could express a negative opinion about the car (albeit normally limited to the context of the car needing maintenance).&lt;br /&gt;
&lt;br /&gt;
;Autonomous canyon jumping&lt;br /&gt;
:Although it seems unlikely that a navigation routine would ever decide that jumping a canyon is part of an optimal route, a car could be programmed to jump a canyon as part of a stunt or show, with no human driver (or any other human aboard) at the time of the jump. It is questionable how &amp;quot;autonomous&amp;quot; such a car would be, though. Could also be a reference to the next point, with another popular setting in below mentioned discussions: &amp;quot;should a self-driving car leave the road and drive into a canyon, which will kill the driver (and passengers), or stay on the road and kill others?&amp;quot;. Possibly a reference to [https://electrek.co/2017/04/19/tesla-model-s-crash-cliff-save-life/ when a Tesla was driven off a cliff] and the driver and his passenger survived without injury. The car was not on autopilot at the time. Could also be a reference to the previous point where the car develops enough self-loathing to want to commit suicide. Or it may be a reference to [http://www.imdb.com/title/tt0620882/ certain Knight Rider episodes.]&lt;br /&gt;
&lt;br /&gt;
;Cars capable of arguing about the trolley problem on {{w|Facebook}}&lt;br /&gt;
:The {{w|Trolley problem}} is a well-known thought experiment in ethics, in which a person must choose between passively allowing several people to die, or actively causing a single person to die. With the increasing likelihood of fully autonomous vehicles, there's been a flurry of interest in this problem, centered around what a vehicle should be programmed to do in such a case (for example, if avoiding a high-speed collision required running over a pedestrian). Munroe seems to mock this debate by arguing that the true milestone would not be when the vehicle can make such a decision, but when it can argue about it on Facebook. This may refer to the idea that humans aren't capable of agreeing on a resolution to the problem, so expecting a vehicle to resolve it would be less reasonable than expecting it to be able to debate. On the day this comic was released the Youtube channel Vsauce posted a video, [https://youtu.be/1sl5KJ69qiA The Greater Good - Mind Field S2 (Ep 1)], where they tested people's reactions to the trolley problem in a fake situation where the subjects genuinely believed they were in a situation where they where choosing between saving five from an oncoming train by killing one on another track. Given such a coincidence, it is extremely likely that this milestone was added after Munroe saw the episode.&lt;br /&gt;
&lt;br /&gt;
;Evaluating arbitrarily complex Boolean expressions on &amp;quot;honk if [...]&amp;quot; bumper stickers and responding accordingly (title text)&lt;br /&gt;
:As with the cut-off milestone, this implies development of artificial intelligence unrelated to the basic functions of a car, though still imitating human drivers' behavior. This joke is a reference to [[1033| a previous comic about honking and formal logic]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
:Upcoming and recently-achieved&lt;br /&gt;
:'''Self-driving car milestones'''&lt;br /&gt;
&lt;br /&gt;
:* Automatic emergency braking&lt;br /&gt;
:* Highway lane-keeping&lt;br /&gt;
:* Self-parking&lt;br /&gt;
:* Full highway autonomy&lt;br /&gt;
:* First sex in a self-driving car&lt;br /&gt;
:* Full trips with no input from driver&lt;br /&gt;
:* Full trips by empty cars&lt;br /&gt;
:* An empty car wandering the highways for months or years until someone notices the credit card fuel charges&lt;br /&gt;
:* Cars that read other cars' bumper stickers before deciding whether to cut them off&lt;br /&gt;
:* Autonomous engine revving at red lights&lt;br /&gt;
:* Self-loathing cars&lt;br /&gt;
:* Autonomous canyon jumping&lt;br /&gt;
:* Cars capable of arguing about the trolley problem on Facebook&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*The Trolley problem became part of the joke a month after this comic in [[1938: Meltdown and Spectre]]. And earlier, in [[1455: Trolley Problem]], it is even the entire subject.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Self-driving cars]]&lt;br /&gt;
[[Category:Sex]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2217:_53_Cards&amp;diff=181445</id>
		<title>2217: 53 Cards</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2217:_53_Cards&amp;diff=181445"/>
				<updated>2019-10-19T02:26:00Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2217&lt;br /&gt;
| date      = October 18, 2019&lt;br /&gt;
| title     = 53 Cards&lt;br /&gt;
| image     = 53_cards.png&lt;br /&gt;
| titletext = Well, there's one right here at the bottom, where it says &amp;quot;53.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a 53-CARD DECK. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
In this comic Cueball claims that he has found a way to manipulate a 52-card deck into a 53-card deck with only shuffling and rearranging. This is absurd, since there is no way for new cards to be incorporated. He backs up this claim with a diagram containing random mathematical jargon and challenges Ponytail to find an error. However, the given math is sufficiently esoteric that an error cannot easily be found. It's possible that the process [[804:_Pumpkin_Carving|involves the Banach-Tarski paradox at some step.]]&lt;br /&gt;
&lt;br /&gt;
The caption below the comic states that this is how Randall feels when talking to someone who likes the theory of {{w|perpetual motion}}, motion of bodies that continues indefinitely. This is considered impossible according to the laws of physics, but adherents still believe it is possible.&lt;br /&gt;
&lt;br /&gt;
In the title text, Ponytail responds to Cueball's challenge with snark, claiming that the most obvious error is the fact that the formula's result is &amp;quot;53&amp;quot;. This doesn't actually prove that there is an error in Cueball's math, but Ponytail refuses to entertain the possibility that 52 items can become 53 items without having any items added to the system in the process.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:Cueball: I've found a way to turn a 52-card deck into 53 cards by shuffling and rearranging them.&lt;br /&gt;
:Ponytail: No, you haven't.&lt;br /&gt;
:Cueball: How do you know?! I challenge you to find an error in my math!&lt;br /&gt;
&lt;br /&gt;
:Caption: Every conversation between a physicist and a perpetual motion enthusiast.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Physics]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2217:_53_Cards&amp;diff=181444</id>
		<title>2217: 53 Cards</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2217:_53_Cards&amp;diff=181444"/>
				<updated>2019-10-19T02:25:38Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2217&lt;br /&gt;
| date      = October 18, 2019&lt;br /&gt;
| title     = 53 Cards&lt;br /&gt;
| image     = 53_cards.png&lt;br /&gt;
| titletext = Well, there's one right here at the bottom, where it says &amp;quot;53.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a 53-CARD DECK. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
In this comic Cueball claims that he has found a way to manipulate a 52-card deck into a 53-card deck with only shuffling and rearranging. This is absurd, since there is no way for new cards to be incorporated. He backs up this claim with a diagram containing random mathematical jargon and challenges Ponytail to find an error. However, the given math is sufficiently esoteric that an error cannot easily be found. (It's possible that the process [[804:_Pumpkin_Carving|involves the Banach-Tarski paradox at some step.]]&lt;br /&gt;
&lt;br /&gt;
The caption below the comic states that this is how Randall feels when talking to someone who likes the theory of {{w|perpetual motion}}, motion of bodies that continues indefinitely. This is considered impossible according to the laws of physics, but adherents still believe it is possible.&lt;br /&gt;
&lt;br /&gt;
In the title text, Ponytail responds to Cueball's challenge with snark, claiming that the most obvious error is the fact that the formula's result is &amp;quot;53&amp;quot;. This doesn't actually prove that there is an error in Cueball's math, but Ponytail refuses to entertain the possibility that 52 items can become 53 items without having any items added to the system in the process.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:Cueball: I've found a way to turn a 52-card deck into 53 cards by shuffling and rearranging them.&lt;br /&gt;
:Ponytail: No, you haven't.&lt;br /&gt;
:Cueball: How do you know?! I challenge you to find an error in my math!&lt;br /&gt;
&lt;br /&gt;
:Caption: Every conversation between a physicist and a perpetual motion enthusiast.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Physics]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2217:_53_Cards&amp;diff=181443</id>
		<title>2217: 53 Cards</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2217:_53_Cards&amp;diff=181443"/>
				<updated>2019-10-19T02:20:47Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2217&lt;br /&gt;
| date      = October 18, 2019&lt;br /&gt;
| title     = 53 Cards&lt;br /&gt;
| image     = 53_cards.png&lt;br /&gt;
| titletext = Well, there's one right here at the bottom, where it says &amp;quot;53.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a 53-CARD DECK. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
In this comic Cueball claims that he has found a way to manipulate a 52-card deck into a 53-card deck with only shuffling and rearranging. This is absurd, since there is no way for new cards to be incorporated. He backs up this claim with a diagram containing random mathematical jargon and challenges Ponytail to find an error. However, the given math is sufficiently esoteric that an error cannot easily be found.&lt;br /&gt;
&lt;br /&gt;
The caption below the comic states that this is how Randall feels when talking to someone who likes the theory of {{w|perpetual motion}}, motion of bodies that continues indefinitely. This is considered impossible according to the laws of physics, but adherents still believe it is possible.&lt;br /&gt;
&lt;br /&gt;
In the title text, Ponytail responds to Cueball's challenge with snark, claiming that the most obvious error is the fact that the formula's result is &amp;quot;53&amp;quot;. This doesn't actually prove that there is an error in Cueball's math, but Ponytail refuses to entertain the possibility that 52 items can become 53 items without having any items added to the system in the process.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:Cueball: I've found a way to turn a 52-card deck into 53 cards by shuffling and rearranging them.&lt;br /&gt;
:Ponytail: No, you haven't.&lt;br /&gt;
:Cueball: How do you know?! I challenge you to find an error in my math!&lt;br /&gt;
&lt;br /&gt;
:Caption: Every conversation between a physicist and a perpetual motion enthusiast.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Physics]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1258:_First&amp;diff=181423</id>
		<title>1258: First</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1258:_First&amp;diff=181423"/>
				<updated>2019-10-18T23:56:31Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1258&lt;br /&gt;
| date      = August 30, 2013&lt;br /&gt;
| title     = First&lt;br /&gt;
| image     = first.png&lt;br /&gt;
| titletext = Fortunately, exactly zero other annoying internet behaviors have developed during this time. &lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
[http://knowyourmeme.com/memes/first Firstposting], or [https://www.urbandictionary.com/define.php?term=thread%20sniping thread sniping], is the habit of posting short messages to obnoxiously point out that you have found and seen this content first. This practice was far more common in the years leading up to this comic, when high-traffic and poorly-moderated social media sites tended to display comments in increasing chronological order by default; as such, the oldest comments would be most prominently displayed at the top, while the newest comments would be buried at the bottom.&lt;br /&gt;
&lt;br /&gt;
In the first two panels, [[Cueball]] stares at his screen, implying that a long time passes before he finally points this out. He has probably submitted a post and is awaiting for comments that are not coming. Cueball might actually have mixed feelings about the practice slowly dying out. However, someone offscreen is worried he will jinx it, encouraging more people to do so.&lt;br /&gt;
&lt;br /&gt;
In reality, Cueball's observation has held true, due to changes in best practices for web design. Social media sites in particular often sort comments by user rating; as such, the most appreciated comments are given the most prominence, and trollish comments like the cliche &amp;quot;F1rst p0st!!&amp;quot; are buried. Meanwhile, low-traffic forums with smaller communities still display comments from oldest to newest; in these environments, firstposters are reported and dealt with by human moderators in a timely fashion. In short, the internet as a whole does not reward or reinforce firstposting the way it once did pre-2013.&lt;br /&gt;
&lt;br /&gt;
See also [[269: TCMP]] and [[1019: First Post]].&lt;br /&gt;
&lt;br /&gt;
The title text sarcastically states that no new annoying internet behaviors have emerged since the &amp;quot;first post&amp;quot; trend began which would continue to annoy users: a fact which is clearly wrong to anyone who spends a length of time on the internet. See for instance [[493: Actuarial]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball sits at his desk, using a computer.]&lt;br /&gt;
&lt;br /&gt;
:[Cueball is still sitting at the desk, but with hands off the keyboard in his lap.]&lt;br /&gt;
&lt;br /&gt;
:[Cueball is in the same position as before, talking with off-panel.]&lt;br /&gt;
:Cueball: After a couple of unbearable decades, the &amp;quot;first post&amp;quot; thing seems to be dying a quiet death.&lt;br /&gt;
:Off-screen: ''Shh.'' You'll jinx it.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Internet]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1258:_First&amp;diff=181422</id>
		<title>1258: First</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1258:_First&amp;diff=181422"/>
				<updated>2019-10-18T23:43:33Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1258&lt;br /&gt;
| date      = August 30, 2013&lt;br /&gt;
| title     = First&lt;br /&gt;
| image     = first.png&lt;br /&gt;
| titletext = Fortunately, exactly zero other annoying internet behaviors have developed during this time. &lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
[http://knowyourmeme.com/memes/first Firstposting], or [https://www.urbandictionary.com/define.php?term=thread%20sniping thread sniping], is the practice of posting short messages to obnoxiously point out that you have found and seen this content first. This practice was far more common at the time this comic was written, when high-traffic and poorly-moderated social media sites tended to display comments in increasing chronological order by default; as such, the oldest comments would be most prominently displayed at the top, while the newest comments would be buried at the bottom. These days, while low-traffic and closely-monitored forums still use this approach, social media sites instead tend to sort comments by rating, so that the most appreciated comments are given the most prominence and trollish comments like the cliche &amp;quot;F1rst p0st!!&amp;quot; are buried.&lt;br /&gt;
&lt;br /&gt;
In the first two panels, [[Cueball]] stares at his screen, implying that a long time passes before he finally points this out. He has probably submitted a post and is awaiting for comments that are not coming. Cueball might actually have mixed feelings about the practice slowly dying out. However, someone offscreen is worried he will jinx it, encouraging more people to do so. See also [[269: TCMP]] and [[1019: First Post]].&lt;br /&gt;
&lt;br /&gt;
The title text sarcastically states that no new annoying internet behaviors have emerged since the &amp;quot;first post&amp;quot; trend began which would continue to annoy users: a fact which is clearly wrong to anyone who spends a length of time on the internet. See for instance [[493: Actuarial]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball sits at his desk, using a computer.]&lt;br /&gt;
&lt;br /&gt;
:[Cueball is still sitting at the desk, but with hands off the keyboard in his lap.]&lt;br /&gt;
&lt;br /&gt;
:[Cueball is in the same position as before, talking with off-panel.]&lt;br /&gt;
:Cueball: After a couple of unbearable decades, the &amp;quot;first post&amp;quot; thing seems to be dying a quiet death.&lt;br /&gt;
:Off-screen: ''Shh.'' You'll jinx it.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Internet]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=269:_TCMP&amp;diff=181421</id>
		<title>269: TCMP</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=269:_TCMP&amp;diff=181421"/>
				<updated>2019-10-18T23:40:02Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 269&lt;br /&gt;
| date      = May 28, 2007&lt;br /&gt;
| title     = TCMP&lt;br /&gt;
| image     = tcmp.png&lt;br /&gt;
| titletext = A big obstacle in experimenting with the mind's dream-simulation-engine is holding onto the details as you wake up. With TCMP you can bring back any information you want.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
&lt;br /&gt;
[[Cueball]] trained himself to type while asleep, so he could communicate from inside his dreams. He calls this ''Trans-Consciousness Messaging Protocol'', or '''TCMP'''. He succeeds in using this system to send a message from inside his dream, but his friends, [[Megan]] and another Cueball-like guy, are disappointed when that first message is a {{w|troll (Internet)|trollish}} &amp;quot;F1rst p0st!!&amp;quot;, in this case, &amp;quot;trans-reality trolling&amp;quot;, instead of something constructive.&lt;br /&gt;
&lt;br /&gt;
Firstposting, or [https://www.urbandictionary.com/define.php?term=thread%20sniping thread sniping], is the practice of posting short messages to brag to others that you found and saw this content first. This practice was far more common at the time this comic was written, when high-traffic and poorly-moderated social media sites tended to display comments in increasing chronological order by default; as such, the oldest comments would be most prominently displayed at the top, while the newest comments would be buried at the bottom. These days, while low-traffic and closely-monitored forums still use this approach, social media sites instead tend to sort comments by rating, so that the most appreciated comments are given the most prominence and trollish comments like the cliche &amp;quot;F1rst p0st!!&amp;quot; are buried. See also [[1019: First Post]] and [[1258: First]] and regarding trolling [[493: Actuarial]].&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Bell &amp;amp; Watson&amp;quot; refers to {{w|Alexander Graham Bell}} and his assistant {{w|Thomas A. Watson}}. Bell is traditionally credited with inventing the {{w|telephone}}, because he was awarded the patent for it, although {{w|Elisha Gray and Alexander Bell telephone controversy|that is still controversial}}. His first phone call was to Watson in another part of their lab.&lt;br /&gt;
&lt;br /&gt;
The title text explains how this protocol, if real, would be of great value in dream research, since you then would not have to worry about forgetting the dreams after waking up like as in [[430: Every Damn Morning]]. You can relay the dreams as you experience them.&lt;br /&gt;
&lt;br /&gt;
A possible downside is that in order for this to work, the dream has to be {{w|Lucid dream|lucid}}, where the dreamer is aware that he or she is dreaming. This type of dream is very fascinating to [[Randall]], as mentioned in the title text of [[203: Hallucinations]]. Because this method could not be used to study regular dreams, some possibilities for studying dreams would be limited.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball stand with a keyboard next to a bed. The keyboard is connected with a wire to a computer on a desk to the right. He talks to Megan and a Cueball-like friend.]&lt;br /&gt;
:Cueball: Hey, help me test the Trans-Consciousness Messaging Protocol.&lt;br /&gt;
:Friend: What's that?&lt;br /&gt;
:Cueball: I've been training myself to keep my fingers moving slightly as I fall asleep. So I can type from inside dreams.&lt;br /&gt;
&lt;br /&gt;
:[Cueball sits with the keyboard on the bed.]&lt;br /&gt;
:Cueball: I'm going to sleep now. My computer will relay my messages to you as I explore the dream world.&lt;br /&gt;
&lt;br /&gt;
:[Cueball stand with the keyboard in a forest with tall trees. The leaves are not visible; they are above the top of the drawing. At the top, there is a frame with text:]&lt;br /&gt;
:In the dream:&lt;br /&gt;
:Cueball (thinking): So strange to think none of this is real. &lt;br /&gt;
:Cueball (thinking): And yet I have this lifeline to the internet back home.&lt;br /&gt;
&lt;br /&gt;
:[Cueball places the keyboard on a stone, bends down, and types.]&lt;br /&gt;
:Cueball (thinking): A chance to speak from one reality to another. &lt;br /&gt;
:Cueball (thinking): I feel like Bell &amp;amp; Watson. I get to write the inaugural TCMP message. &lt;br /&gt;
:Cueball (thinking): Let's see...&lt;br /&gt;
:Keyboard: *Type type type*&lt;br /&gt;
&lt;br /&gt;
:[Megan is at the computer, and the Cueball-like friend behind her looks at his message from the dream. At the top, there is a frame with text:]&lt;br /&gt;
:Outside:&lt;br /&gt;
:Megan: &amp;quot;F1RST P0ST!!&amp;quot;?&lt;br /&gt;
:Friend: Great. He's jumped straight to trans-reality trolling.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Multiple Cueballs]]&lt;br /&gt;
[[Category:Dreams]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=269:_TCMP&amp;diff=181312</id>
		<title>269: TCMP</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=269:_TCMP&amp;diff=181312"/>
				<updated>2019-10-16T13:32:40Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 269&lt;br /&gt;
| date      = May 28, 2007&lt;br /&gt;
| title     = TCMP&lt;br /&gt;
| image     = tcmp.png&lt;br /&gt;
| titletext = A big obstacle in experimenting with the mind's dream-simulation-engine is holding onto the details as you wake up. With TCMP you can bring back any information you want.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
&lt;br /&gt;
[[Cueball]] trained himself to type while asleep, so he could communicate from inside his dreams. He calls this ''Trans-Consciousness Messaging Protocol'', or '''TCMP'''. He succeeds in using this system to send a message from inside his dream, but his friends, [[Megan]] and another Cueball-like guy, are disappointed when that first message is a {{w|troll (Internet)|trollish}} &amp;quot;F1rst p0st!!&amp;quot;, in this case, &amp;quot;trans-reality trolling&amp;quot;, instead of something constructive.&lt;br /&gt;
&lt;br /&gt;
Firstposting, or sniping, is the practice of posting short messages to brag to others that you found and saw this content first. This practice was far more common at the time this comic was written, when high-traffic and poorly-moderated social media sites tended to display comments in increasing chronological order by default; as such, the oldest comments would be most prominently displayed at the top, while the newest comments would be buried at the bottom. These days, while low-traffic and closely-monitored forums still use this approach, social media sites instead tend to sort comments by rating, so that the most appreciated comments are given the most prominence and trollish comments like the cliche &amp;quot;F1rst p0st!!&amp;quot; are buried. See also [[1019: First Post]] and [[1258: First]] and regarding trolling [[493: Actuarial]].&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Bell &amp;amp; Watson&amp;quot; refers to {{w|Alexander Graham Bell}} and his assistant {{w|Thomas A. Watson}}. Bell is traditionally credited with inventing the {{w|telephone}}, because he was awarded the patent for it, although {{w|Elisha Gray and Alexander Bell telephone controversy|that is still controversial}}. His first phone call was to Watson in another part of their lab.&lt;br /&gt;
&lt;br /&gt;
The title text explains how this protocol, if real, would be of great value in dream research, since you then would not have to worry about forgetting the dreams after waking up like as in [[430: Every Damn Morning]]. You can relay the dreams as you experience them.&lt;br /&gt;
&lt;br /&gt;
A possible downside is that in order for this to work, the dream has to be {{w|Lucid dream|lucid}}, where the dreamer is aware that he or she is dreaming. This type of dream is very fascinating to [[Randall]], as mentioned in the title text of [[203: Hallucinations]]. Because this method could not be used to study regular dreams, some possibilities for studying dreams would be limited.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball stand with a keyboard next to a bed. The keyboard is connected with a wire to a computer on a desk to the right. He talks to Megan and a Cueball-like friend.]&lt;br /&gt;
:Cueball: Hey, help me test the Trans-Consciousness Messaging Protocol.&lt;br /&gt;
:Friend: What's that?&lt;br /&gt;
:Cueball: I've been training myself to keep my fingers moving slightly as I fall asleep. So I can type from inside dreams.&lt;br /&gt;
&lt;br /&gt;
:[Cueball sits with the keyboard on the bed.]&lt;br /&gt;
:Cueball: I'm going to sleep now. My computer will relay my messages to you as I explore the dream world.&lt;br /&gt;
&lt;br /&gt;
:[Cueball stand with the keyboard in a forest with tall trees. The leaves are not visible; they are above the top of the drawing. At the top, there is a frame with text:]&lt;br /&gt;
:In the dream:&lt;br /&gt;
:Cueball (thinking): So strange to think none of this is real. &lt;br /&gt;
:Cueball (thinking): And yet I have this lifeline to the internet back home.&lt;br /&gt;
&lt;br /&gt;
:[Cueball places the keyboard on a stone, bends down, and types.]&lt;br /&gt;
:Cueball (thinking): A chance to speak from one reality to another. &lt;br /&gt;
:Cueball (thinking): I feel like Bell &amp;amp; Watson. I get to write the inaugural TCMP message. &lt;br /&gt;
:Cueball (thinking): Let's see...&lt;br /&gt;
:Keyboard: *Type type type*&lt;br /&gt;
&lt;br /&gt;
:[Megan is at the computer, and the Cueball-like friend behind her looks at his message from the dream. At the top, there is a frame with text:]&lt;br /&gt;
:Outside:&lt;br /&gt;
:Megan: &amp;quot;F1RST P0ST!!&amp;quot;?&lt;br /&gt;
:Friend: Great. He's jumped straight to trans-reality trolling.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Multiple Cueballs]]&lt;br /&gt;
[[Category:Dreams]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:1544:_Margaret&amp;diff=96660</id>
		<title>Talk:1544: Margaret</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:1544:_Margaret&amp;diff=96660"/>
				<updated>2015-06-29T15:30:10Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* the the */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;I though it was Anna, not Margaret... but it turns out that {{w|Mister God, This Is Anna}} is a different book... --[[User:JakubNarebski|JakubNarebski]] ([[User talk:JakubNarebski|talk]]) 13:13, 29 June 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== Judy Blume ==&lt;br /&gt;
The text in the comic comprises titles of Judy Blume's novels:&lt;br /&gt;
* Otherwise Known as Sheila the Great&lt;br /&gt;
* Are You There God? It's Me, Margaret. &lt;br /&gt;
* Then Again, Maybe I Won't &lt;br /&gt;
* The Pain and the Great One&lt;br /&gt;
&lt;br /&gt;
== the the ==&lt;br /&gt;
Why the double &amp;quot;the the&amp;quot; in the Title text?&lt;br /&gt;
Maybe it's supposed to be &amp;quot;thee&amp;quot;?&lt;br /&gt;
: Look out! It's an anacoluthon! [[User:ImVeryAngryItsNotButter|ImVeryAngryItsNotButter]] ([[User talk:ImVeryAngryItsNotButter|talk]]) 15:30, 29 June 2015 (UTC)&lt;br /&gt;
: Maybe it's a typo? ;) [[Special:Contributions/173.245.51.116|173.245.51.116]] 12:05, 29 June 2015 (UTC)&lt;br /&gt;
::Maybe it's supposed to be 'the The Great One' [[Special:Contributions/108.162.219.122|108.162.219.122]] 14:55, 29 June 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
== hot ==&lt;br /&gt;
Margaret is kinda hot.&lt;br /&gt;
Is it normal to be sexually attracted to an xkcd character ?&lt;br /&gt;
&lt;br /&gt;
[[Special:Contributions/108.162.221.87|108.162.221.87]] 14:09, 29 June 2015 (UTC) See also title text of comic [[1354: Heartbleed Explanation]]&lt;br /&gt;
&lt;br /&gt;
== transformers ==&lt;br /&gt;
This is almost an exact quote from the end of transformers age of extinction... Optimus prime rhetorically asks his makers of they are scared, then follows with you should be because I'm coming for you&lt;br /&gt;
&lt;br /&gt;
== stirring the pot ==&lt;br /&gt;
Ooh, ooh, let's say that the &amp;quot;second Megan&amp;quot; in [[1496: Art Project]] was this [[Margaret]] girl!  I'm sure everyone can agree to that!!! [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 15:24, 29 June 2015 (UTC)&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1543:_Team_Effort&amp;diff=96433</id>
		<title>1543: Team Effort</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1543:_Team_Effort&amp;diff=96433"/>
				<updated>2015-06-26T14:30:37Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1543&lt;br /&gt;
| date      = June 26, 2015&lt;br /&gt;
| title     = Team Effort&lt;br /&gt;
| image     = team_effort.png&lt;br /&gt;
| titletext = Given the role they play in every process in my body, really, they deserve this award more than me. Just gotta figure out how to give it to them. Maybe I can cut it into pieces to make it easier to swallow ...&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
&lt;br /&gt;
[[Megan]] has won an award at a ceremony (presumably movie-related and possibly an [http://en.wikipedia.org/wiki/Academy_Awards|Academy Award], as she mentions her director). Traditionally, when a person receives a major award, they give an acceptance speech which traditionally begins with the recipient thanking people who have helped them achieve the honour. Sometimes when a number of people are mentioned, the recipient will say that it was a team effort - a comment which elevates the &amp;quot;helpers&amp;quot; to virtually the same level as the recipient.&lt;br /&gt;
&lt;br /&gt;
Megan's (rather self-absorbed) acceptance speech takes things a step further; she thanks not only her director and her and family and friends, but also the bacteria that populate her gastrointestinal tract. As she states correctly, the number of bacterial cells inside a human body outnumber the number of human cells by as much as a factor 10. This bacteria is largely what makes digestion possible, and without it she would die - and not be able to win the award.&lt;br /&gt;
&lt;br /&gt;
In the title text, Megan contemplates ''how'' to thank her micro-organisms and considers to eat the trophy after having it cut in pieces.&lt;br /&gt;
&lt;br /&gt;
1.5 pints (the average of one or two pints) is 712,5 ml.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
[Megan is on a stage receiving an award from Ponytail, the latter of whom is standing behind a podium.]&lt;br /&gt;
&lt;br /&gt;
Megan:&lt;br /&gt;
:I'd like to thank my director,&lt;br /&gt;
:my friends and family, and–&lt;br /&gt;
:of course–the writhing mass&lt;br /&gt;
:of gut bacteria inside me.&lt;br /&gt;
&lt;br /&gt;
:I mean, there's like one or&lt;br /&gt;
:two pints of them in here;&lt;br /&gt;
:their cells outnumber mine!&lt;br /&gt;
&lt;br /&gt;
:Anyway, This was a real team effort.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1537:_Types&amp;diff=95361</id>
		<title>1537: Types</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1537:_Types&amp;diff=95361"/>
				<updated>2015-06-12T14:21:26Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: American spellings, please.&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1537&lt;br /&gt;
| date      = June 12, 2015&lt;br /&gt;
| title     = Types&lt;br /&gt;
| image     = types.png&lt;br /&gt;
| titletext = colors.rgb(&amp;quot;blue&amp;quot;) yields &amp;quot;#0000FF&amp;quot;. colors.rgb(&amp;quot;yellowish blue&amp;quot;) yields NaN. colors.sort() yields &amp;quot;rainbow&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Title text not explained. More details before the list.}}&lt;br /&gt;
&lt;br /&gt;
This comic is a series of programming jokes about a ridiculous new programming language, inspired by [https://www.destroyallsoftware.com/talks/wat Gary Bernhardt's CodeMash 2012 lightning talk] on Javascript's unpredictable typing. The (highly technical) audience is unable to correctly guess the results of adding various Javascript types, and roars with laughter when they're revealed.&lt;br /&gt;
&lt;br /&gt;
Most regular programming languages distinguish a number of types, e.g. integers , strings, lists,... All of which have different behaviours. The operation &amp;quot;+&amp;quot; is conventionally defined over more than one of these types. Applied to two integers, it returns their addition, but applied to two strings it concatenates them:&lt;br /&gt;
&lt;br /&gt;
&amp;lt;code&amp;gt;&amp;gt; 2 + 3&lt;br /&gt;
&lt;br /&gt;
5&lt;br /&gt;
&lt;br /&gt;
&amp;gt; &amp;quot;123&amp;quot; + &amp;quot;abc&amp;quot;&lt;br /&gt;
&lt;br /&gt;
&amp;quot;123abc&amp;quot;&amp;lt;/code&amp;gt;&lt;br /&gt;
&lt;br /&gt;
While these behaviours are standard, conventional, and intuitive, there is a huge amount of variation among programming languages when you apply an operation like &amp;quot;+&amp;quot; to different types. One logical approach is to always return an error in all cases of type mixing, but it is often practical to allow some case mixing, since it can hugely simplify an operation. Variation and lack of a clearly more intuitive behaviour leads some languages to have weird results when you mix types.&lt;br /&gt;
&lt;br /&gt;
# &amp;lt;code&amp;gt;2 + &amp;quot;2&amp;quot;&amp;lt;/code&amp;gt; uses the &amp;lt;code&amp;gt;+&amp;lt;/code&amp;gt; operator on a number and a string. In a normal language, this would result either the number &amp;lt;code&amp;gt;4&amp;lt;/code&amp;gt; (addition), or &amp;lt;code&amp;gt;&amp;quot;22&amp;quot;&amp;lt;/code&amp;gt; (string concatenation); however, the new language converts the string to an integer, adds them to produce &amp;lt;code&amp;gt;4&amp;lt;/code&amp;gt; and converts back to a string.&lt;br /&gt;
# &amp;lt;code&amp;gt;&amp;quot;2&amp;quot; + []&amp;lt;/code&amp;gt; adds a string to an array (a list), this time. This first inexplicably converts the string to a number again, and then it literally adds the number to the list by appending it (this would make sense if it was &amp;lt;code&amp;gt;[] + 2&amp;lt;/code&amp;gt;, but usually not the other way around). And then the result is converted to a string again.&lt;br /&gt;
# &amp;lt;code&amp;gt;(2/0)&amp;lt;/code&amp;gt; divides &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt; by &amp;lt;code&amp;gt;0&amp;lt;/code&amp;gt; and quite reasonably results in &amp;lt;code&amp;gt;NaN&amp;lt;/code&amp;gt; (not a number).&lt;br /&gt;
# &amp;lt;code&amp;gt;(2/0)+2&amp;lt;/code&amp;gt; adds &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt; to &amp;lt;code&amp;gt;NaN&amp;lt;/code&amp;gt;. &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt; is &amp;quot;added&amp;quot; to the string &amp;lt;code&amp;gt;&amp;quot;NaN&amp;quot;&amp;lt;/code&amp;gt; (again, the number is converted to a string for apparently no reason), which produces &amp;lt;code&amp;gt;&amp;quot;NaP&amp;quot;&amp;lt;/code&amp;gt;, as if &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt; was added to &amp;lt;code&amp;gt;&amp;quot;N&amp;quot;&amp;lt;/code&amp;gt; to produce &amp;lt;code&amp;gt;&amp;quot;P&amp;quot;&amp;lt;/code&amp;gt; (as per alphabetical order or ASCII encoding; &amp;lt;code&amp;gt;N&amp;lt;/code&amp;gt; is &amp;lt;code&amp;gt;01001100&amp;lt;/code&amp;gt;, and adding 2 to this results in &amp;lt;code&amp;gt;01010000&amp;lt;/code&amp;gt; which is &amp;lt;code&amp;gt;P&amp;lt;/code&amp;gt;).&lt;br /&gt;
# &amp;lt;code&amp;gt;&amp;quot;&amp;quot;+&amp;quot;&amp;quot;&amp;lt;/code&amp;gt; looks like it is concatenating (adding) an empty string to another empty string, which should produce an empty string. However, the entire thing is treated as one string (with the start quote being the first one and the end quote being the very last one), which produces the egregious '&amp;lt;code&amp;gt;&amp;quot;+&amp;quot;&amp;lt;/code&amp;gt;'.&lt;br /&gt;
# &amp;lt;code&amp;gt;[1,2,3]+2&amp;lt;/code&amp;gt; seems to test whether it's sound to append &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt; to the list &amp;lt;code&amp;gt;[1,2,3]&amp;lt;/code&amp;gt;, and concludes that it doesn't fit the pattern, returning the boolean value &amp;lt;code&amp;gt;false&amp;lt;/code&amp;gt;. It could conceivably also be the result of an attempt to add &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt; to the ''set'' &amp;lt;code&amp;gt;[1,2,3]&amp;lt;/code&amp;gt;, which already contains that element (although &amp;lt;code&amp;gt;{1,2,3}&amp;lt;/code&amp;gt; would be a more common notation for sets).&lt;br /&gt;
# &amp;lt;code&amp;gt;[1,2,3]+4&amp;lt;/code&amp;gt; returns &amp;lt;code&amp;gt;true&amp;lt;/code&amp;gt; for much the same reason.&lt;br /&gt;
# &amp;lt;code&amp;gt;2/(2-(3/2+1/2))&amp;lt;/code&amp;gt; is a floating point joke. Floating point numbers are notoriously imprecise. With precise mathematics, &amp;lt;code&amp;gt;(3/2+1/2)&amp;lt;/code&amp;gt; would be exactly 2, hence the entire thing would evaluate to &amp;lt;code&amp;gt;2/0&amp;lt;/code&amp;gt; or &amp;lt;code&amp;gt;NaN&amp;lt;/code&amp;gt; in Randall's new language. However, the result of &amp;lt;code&amp;gt;(3/2+1/2)&amp;lt;/code&amp;gt; is &amp;quot;just slightly off,&amp;quot; which makes the result &amp;quot;just slightly off&amp;quot; of &amp;lt;code&amp;gt;NaN&amp;lt;/code&amp;gt; (which would be ridiculous in a real language). The ironic thing is that fractions with 2 in the denominator are ''not'' the kind of numbers that typically suffer from floating point impreciseness.&lt;br /&gt;
# &amp;lt;code&amp;gt;range(&amp;quot; &amp;quot;)&amp;lt;/code&amp;gt; normally wouldn't make any sense. However, the new language appears to interpret it as ASCII, and in the ASCII table, character #32 is space, #33 is &amp;lt;code&amp;gt;!&amp;lt;/code&amp;gt;, and #34 is &amp;lt;code&amp;gt;&amp;quot;&amp;lt;/code&amp;gt;. So, instead of interpreting &amp;lt;code&amp;gt;&amp;quot; &amp;quot;&amp;lt;/code&amp;gt; as a string, it seems to be interpreted as &amp;lt;code&amp;gt;34, 32, 34&amp;lt;/code&amp;gt; (in ASCII), and then &amp;lt;code&amp;gt;range&amp;lt;/code&amp;gt; appears to transform this into &amp;lt;code&amp;gt;34, 33, 32, 33, 34&amp;lt;/code&amp;gt; (the &amp;quot;ranges&amp;quot; between the numbers), which, interpreted as ASCII, becomes &amp;lt;code&amp;gt;['&amp;quot;', '!', ' ', '!', '&amp;quot;']&amp;lt;/code&amp;gt;.&lt;br /&gt;
# &amp;lt;code&amp;gt;+2&amp;lt;/code&amp;gt; appears to be applying a unary &amp;lt;code&amp;gt;+&amp;lt;/code&amp;gt; to the number &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt;, which should just be &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt;. However, the code is adding  &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt; to the line number &amp;lt;code&amp;gt;10&amp;lt;/code&amp;gt; in this context.&lt;br /&gt;
# &amp;lt;code&amp;gt;2+2&amp;lt;/code&amp;gt; would normally be &amp;lt;code&amp;gt;4&amp;lt;/code&amp;gt;. However, the interpreter takes this instruction to mean to add the value 2 to the literal value of &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt;, making it &amp;lt;code&amp;gt;4&amp;lt;/code&amp;gt; and then reports that the work is &amp;quot;Done&amp;quot;.  This can be seen in the subsequent lines where all &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt;s are replaced by &amp;lt;code&amp;gt;4&amp;lt;/code&amp;gt;s.  This could be a reference to languages like Fortran where literals were able to be assigned new values.&lt;br /&gt;
# &amp;lt;code&amp;gt;range(1,5)&amp;lt;/code&amp;gt; would normally return &amp;lt;code&amp;gt;[1, 2, 3, 4, 5]&amp;lt;/code&amp;gt;. However, since the value of &amp;lt;code&amp;gt;2&amp;lt;/code&amp;gt; has been changed to &amp;lt;code&amp;gt;4&amp;lt;/code&amp;gt;, it returns &amp;lt;code&amp;gt;[1, 4, 3, 4, 5]&amp;lt;/code&amp;gt;, and this even affects the line number (which is 14 instead of 12).&lt;br /&gt;
# &amp;lt;code&amp;gt;floor(10.5)&amp;lt;/code&amp;gt; should return &amp;lt;code&amp;gt;10&amp;lt;/code&amp;gt; (the &amp;quot;floor&amp;quot; of a decimal number is that number rounded down). However, it instead returns {{w|ASCII art}} of the number on a &amp;quot;floor.&amp;quot;&lt;br /&gt;
&lt;br /&gt;
The title text contains three further examples relating to color. &amp;lt;code&amp;gt;color.rgb(&amp;quot;blue&amp;quot;)&amp;lt;/code&amp;gt; returns the hexadecimal code for pure blue (as would be used in HTML, for example), which is how a real programming language might work. The lookup for &amp;quot;yellowish blue&amp;quot; returns &amp;quot;NaN&amp;quot; (Not a Number) again, which makes sense at one level because there is no such color as &amp;quot;yellowish blue&amp;quot; (yellow and blue are complements: mix them and you get white or black depending on whether you are using additive or subtractive colors). However a more typical result would have been a failure indicating that the color database does not include the name, in the same way that a typo such as &amp;quot;bluw&amp;quot; would. Simlarly sorting the colors would normally produce some defined ordering, such as alphabetical, but in this language it generates the string &amp;quot;rainbow&amp;quot;. It seems that Randall's new language understands color theory in an unusually deep way.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
My new language is great, but it has a few quirks regarding type:&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
 [1]&amp;gt; 2+&amp;quot;2&amp;quot;&lt;br /&gt;
   =&amp;gt; &amp;quot;4&amp;quot;&lt;br /&gt;
 [2]&amp;gt; &amp;quot;2&amp;quot;+[]&lt;br /&gt;
   =&amp;gt; &amp;quot;[2]&amp;quot;&lt;br /&gt;
 [3]&amp;gt; (2/0)&lt;br /&gt;
   =&amp;gt; NaN&lt;br /&gt;
 [4]&amp;gt; (2/0)+2&lt;br /&gt;
   =&amp;gt; NaP&lt;br /&gt;
 [5]&amp;gt; &amp;quot;&amp;quot;+&amp;quot;&amp;quot;&lt;br /&gt;
   =&amp;gt; '&amp;quot;+&amp;quot;'&lt;br /&gt;
 [6]&amp;gt; [1,2,3]+2&lt;br /&gt;
   =&amp;gt; FALSE&lt;br /&gt;
 [7]&amp;gt; [1,2,3]+4&lt;br /&gt;
   =&amp;gt; TRUE&lt;br /&gt;
 [8]&amp;gt; 2/(2-(3/2+1/2))&lt;br /&gt;
   =&amp;gt; NaN.0000000000000013&lt;br /&gt;
 [9]&amp;gt; range(&amp;quot; &amp;quot;)&lt;br /&gt;
   =&amp;gt; ('&amp;quot;','!',&amp;quot; &amp;quot;,&amp;quot;!&amp;quot;,'&amp;quot;')&lt;br /&gt;
[10]&amp;gt; +2&lt;br /&gt;
   =&amp;gt; 12&lt;br /&gt;
[11]&amp;gt; 2+2&lt;br /&gt;
   =&amp;gt; DONE&lt;br /&gt;
[14]&amp;gt; RANGE(1,5)&lt;br /&gt;
   =&amp;gt; (1,4,3,4,5)&lt;br /&gt;
[13]&amp;gt; FLOOR(10.5)&lt;br /&gt;
   =&amp;gt; |&lt;br /&gt;
   =&amp;gt; |&lt;br /&gt;
   =&amp;gt; |&lt;br /&gt;
   =&amp;gt; |&lt;br /&gt;
   =&amp;gt; |___10.5___&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The alt text for the image starts out with colors.rgb(&amp;quot;blue&amp;quot;) yields &amp;quot;#0000FF&amp;quot;. Again, it just took a string, turned it into a variable, and made it a string again. However, the .rgb function shouldn't be returning a hex code for the color!&lt;br /&gt;
It then transitions into colors.rgb(&amp;quot;yellowish blue&amp;quot;) yields &amp;quot;NaN&amp;quot;. Seeing how it returned a hex code for the last one, attempting to get the RGB value of an [https://en.wikipedia.org/wiki/Impossible_color impossible color] would predictably cause it to return NaN.&lt;br /&gt;
Finally, colors.sort() yields &amp;quot;rainbow&amp;quot;. It just got stuffed through a prism, which sorted the colors into a rainbow!&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:1065:_Shoes&amp;diff=94426</id>
		<title>Talk:1065: Shoes</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:1065:_Shoes&amp;diff=94426"/>
				<updated>2015-05-28T10:43:03Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Can we choose to wear another pair of bigger shoes over the magic shoes? '''[[User:Davidy22|&amp;lt;span title=&amp;quot;I want you.&amp;quot;&amp;gt;&amp;lt;u&amp;gt;&amp;lt;font color=&amp;quot;purple&amp;quot; size=&amp;quot;2px&amp;quot;&amp;gt;David&amp;lt;/font&amp;gt;&amp;lt;font color=&amp;quot;green&amp;quot; size=&amp;quot;3px&amp;quot;&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;sup&amp;gt;&amp;lt;font color=&amp;quot;indigo&amp;quot; size=&amp;quot;1px&amp;quot;&amp;gt;22&amp;lt;/font&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 13:39, 8 January 2013 (UTC)&lt;br /&gt;
: Probably when you use the power of magic shoes, the magic shoes will &amp;quot;outrun&amp;quot; the bigger shoes, either manage to slip out of it or destroy it outright.&amp;lt;br /&amp;gt;&lt;br /&gt;
:That said, I agree with you, the magic shoes will be felt close to no shoes at all, and therefore daily you will wear other shoes over it. [[User:Arifsaha|Arifsaha]] ([[User talk:Arifsaha|talk]]) 16:32, 8 December 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
There should be four toe-holes, not five. The fourth and last toes are almost always in the same toe-hole, as the shoes become very uncomfortable otherwise. The (four-toed) shoes, however, are very nice for relaxation, general purposes, and the outdoors.&lt;br /&gt;
:Technically, since these are stick figures, they shouldn't have any toes. Anonymous. 07:24, 12 January 2014 (UTC)&lt;br /&gt;
::Technically, I don't even see any feet.  [[Special:Contributions/108.162.219.223|108.162.219.223]] 06:24, 23 January 2014 (UTC)&lt;br /&gt;
:::[[1475: Technically|Oh, look, a squirrel!]] [[User:ImVeryAngryItsNotButter|ImVeryAngryItsNotButter]] ([[User talk:ImVeryAngryItsNotButter|talk]]) 10:43, 28 May 2015 (UTC)&lt;br /&gt;
:After playing Mirror's Edge, the idea of using shoes with a separate space for the big toe grew on me. [[Special:Contributions/108.162.254.65|108.162.254.65]] 03:20, 2 February 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
I would like to note that shoes made out of bread were actually sold [http://www.dadadastudio.eu/Shop/prod/19/30/ here]. [[Special:Contributions/141.101.104.39|141.101.104.39]] 21:31, 5 October 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Not sure enough of this to edit, but is it possible there is a whole loaf / sliced bread ~ whole shoe / toe shoe analogy going on here? [[User:Plm-qaz snr|Plm-qaz snr]] ([[User talk:Plm-qaz snr|talk]]) 08:32, 14 October 2014 (UTC)&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1530:_Keyboard_Mash&amp;diff=94347</id>
		<title>1530: Keyboard Mash</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1530:_Keyboard_Mash&amp;diff=94347"/>
				<updated>2015-05-27T14:22:50Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1530&lt;br /&gt;
| date      = May 27, 2015&lt;br /&gt;
| title     = Keyboard Mash&lt;br /&gt;
| image     = keyboard mash.png&lt;br /&gt;
| titletext = WHY DON'T YOU COME HANG OUT INSIDE MY HOUSE. WE CAN COOK BREAD AND CHAT ABOUT OUR INTERNAL SKELETONS.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
&lt;br /&gt;
[[Cueball]] is chatting online (supposedly) with [[White Hat]], who says he is frustrated because a barking dog is preventing him from sleeping. White Hat apparently mashes the keyboard to show his frustration. Keyboard mashing is often used in this way where the user makes their hands spasm across the keyboard, creating a line of text that can be compared to an angry groan in real life. Cueball is about to give some advice, but is confused by a quirk in what White Hat &lt;br /&gt;
typed. Most of the characters he typed were on the home row of the QWERTY keyboard, (the middle set of letters on the keyboard, starting with the letters A, S, D, and F on a QWERTY keyboard) the letters A, S, D, F, J, K, and L are scattered throughout the text, but there is a 7 in the middle of this text. Cueball, (being himself) wonders why White Hat put a seven in there, because if White Hat was keyboard mashing and touched the 7 key, he likely would have hit any of the QWERTY row keys because of keyboard mashing hand spasms, but he didn't. All the other characters were on the home row. White Hat berates Cueball for always focusing on strange, tiny details. When the final panel shows what's going on where White Hat is, we see that a giant spider (possibly a joke about the spider &amp;quot;on the Web&amp;quot; here) has imprisoned him in a web and is talking to Cueball, which explains how the keyboard mashing &amp;quot;White Hat&amp;quot; did was strange.&lt;br /&gt;
&lt;br /&gt;
The title text implies that the spider also wants to trap (and possibly eat) Cueball as well, or actually hang out with him in an attempt to make friends. &amp;quot;HANG OUT INSIDE MY HOUSE&amp;quot; may also have a double meaning, as White Hat is actually &amp;quot;hanging&amp;quot; from the ceiling inside his house.&lt;br /&gt;
&lt;br /&gt;
The statement &amp;quot;I am a normal human typing with my human hands&amp;quot; is [https://allthetropes.orain.org/wiki/Suspiciously_Specific_Denial an oddly specific assertion] from the giant spider that it is actually a human, a claim that would normally be taken for granted and had not really been cast into doubt by Cueball's inquiries about how &amp;quot;7&amp;quot; got into a string of home-row keystrokes. The title text invitation ends with a similar statement, suggesting that they &amp;quot;CHAT ABOUT OUR INTERNAL SKELETONS&amp;quot;, a subject that would not normally come up in conversation (except for fans of the Pierce Quincuncial projection, as detailed in xkcd [[977]]) but is being offered as more evidence that the typist is most certainly not a giant spider.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&amp;lt;nowiki&amp;gt;[&amp;lt;/nowiki&amp;gt;[[Cueball]] approaches his desktop computer, which has emitted a &amp;quot;NEW CHAT MESSAGE&amp;quot; from seemingly [[White Hat]] as it displays a picture of him&amp;lt;nowiki&amp;gt;]&amp;lt;/nowiki&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;nowiki&amp;gt;[&amp;lt;/nowiki&amp;gt;Chat log is in all uppercase:&amp;lt;nowiki&amp;gt;]&amp;lt;/nowiki&amp;gt;&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: CAN'T SLEEP. STUPID DOG KEEPS BARKING.&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: SO FRUSTRATING. FJAFJKLDSKF7JKFDJ&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: UGH, I'M SORRY. MAYBE YOU COULD...&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: ... OKAY, WAIT. I HAVE TO ASK.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: HOW DID YOU HIT A &amp;quot;7&amp;quot; IN THE MIDDLE THERE?&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: HUH?&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: I WAS JUST RANDOMLY KEYBOARD MASHING.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: SORRY, RIGHT.&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: ANYWAY,&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: I KNOW THIS IS SILLY, BUT LIKE ... ALL YOUR HANDS WERE CLEARLY RIGHT ON THE HOME ROW.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: I DON'T GET HOW ONE FINGER COULD HAVE STRETCHED UP TO THE &amp;quot;7&amp;quot;.&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: WHY DO YOU ALWAYS FIXATE ON THESE BIZARRE DETAILS?&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: I DON'T KNOW.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: SORRY.&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: IT'S WEIRD, IS ALL.&amp;lt;br /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;nowiki&amp;gt;[&amp;lt;/nowiki&amp;gt;Chat transcript continues, but now we see a human-sized spider suspended from the ceiling by web is using three of its legs to type on a laptop computer. Behind the spider, White Hat is upside down, almost totally encased in spider web, also suspended from the ceiling, verbalising MMM!! MMPH!!! Between them, a chair has been knocked over onto its back.&amp;lt;nowiki&amp;gt;]&amp;lt;/nowiki&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Spider (chat dialogue shows White Hat's picture): I AM A NORMAL HUMAN TYPING WITH MY HUMAN HANDS.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: YEAH, OF COURSE. I KNOW.&amp;lt;br /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&amp;lt;!-- Include any categories below this line. --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring White Hat]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1530:_Keyboard_Mash&amp;diff=94346</id>
		<title>1530: Keyboard Mash</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1530:_Keyboard_Mash&amp;diff=94346"/>
				<updated>2015-05-27T14:21:41Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1530&lt;br /&gt;
| date      = May 27, 2015&lt;br /&gt;
| title     = Keyboard Mash&lt;br /&gt;
| image     = keyboard mash.png&lt;br /&gt;
| titletext = WHY DON'T YOU COME HANG OUT INSIDE MY HOUSE. WE CAN COOK BREAD AND CHAT ABOUT OUR INTERNAL SKELETONS.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
&lt;br /&gt;
[[Cueball]] is chatting online (supposedly) with [[White Hat]], who says he is frustrated because a barking dog is preventing him from sleeping. White Hat apparently mashes the keyboard to show his frustration. Keyboard mashing is often used in this way where the user makes their hands spasm across the keyboard, creating a line of text that can be compared to an angry groan in real life. Cueball is about to give some advice, but is confused by a quirk in what White Hat &lt;br /&gt;
typed. Most of the characters he typed were on the home row of the QWERTY keyboard, (the middle set of letters on the keyboard, starting with the letters A, S, D, and F on a QWERTY keyboard) the letters A, S, D, F, J, K, and L are scattered throughout the text, but there is a 7 in the middle of this text. Cueball, (being himself) wonders why White Hat put a seven in there, because if White Hat was keyboard mashing and touched the 7 key, he likely would have hit any of the QWERTY row keys because of keyboard mashing hand spasms, but he didn't. All the other characters were on the home row. White Hat berates Cueball for always focusing on strange, tiny details. When the final panel shows what's going on where White Hat is, we see that a giant spider (possibly a joke about the spider &amp;quot;on the Web&amp;quot; here) has imprisoned him in a web and is talking to Cueball, which explains how the keyboard mashing &amp;quot;White Hat&amp;quot; did was strange.&lt;br /&gt;
&lt;br /&gt;
The title text implies that the spider also wants to trap (and possibly eat) Cueball as well, or actually hang out with him in an attempt to make friends. &amp;quot;HANG OUT INSIDE MY HOUSE&amp;quot; may also have a double meaning, as White Hat is actually &amp;quot;hanging&amp;quot; from the ceiling inside his house.&lt;br /&gt;
&lt;br /&gt;
The statement &amp;quot;I am a normal human typing with my human hands&amp;quot; is [http://tvtropes.org/pmwiki/pmwiki.php/Main/SuspiciouslySpecificDenial an oddly specific] assertion from the giant spider that it is actually a human, a claim that would normally be taken for granted and had not really been cast into doubt by Cueball's inquiries about how &amp;quot;7&amp;quot; got into a string of home-row keystrokes. The title text invitation ends with a similar statement, suggesting that they &amp;quot;CHAT ABOUT OUR INTERNAL SKELETONS&amp;quot;, a subject that would not normally come up in conversation (except for fans of the Pierce Quincuncial projection, as detailed in xkcd [[977]]) but is being offered as more evidence that the typist is most certainly not a giant spider.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&amp;lt;nowiki&amp;gt;[&amp;lt;/nowiki&amp;gt;[[Cueball]] approaches his desktop computer, which has emitted a &amp;quot;NEW CHAT MESSAGE&amp;quot; from seemingly [[White Hat]] as it displays a picture of him&amp;lt;nowiki&amp;gt;]&amp;lt;/nowiki&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;nowiki&amp;gt;[&amp;lt;/nowiki&amp;gt;Chat log is in all uppercase:&amp;lt;nowiki&amp;gt;]&amp;lt;/nowiki&amp;gt;&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: CAN'T SLEEP. STUPID DOG KEEPS BARKING.&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: SO FRUSTRATING. FJAFJKLDSKF7JKFDJ&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: UGH, I'M SORRY. MAYBE YOU COULD...&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: ... OKAY, WAIT. I HAVE TO ASK.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: HOW DID YOU HIT A &amp;quot;7&amp;quot; IN THE MIDDLE THERE?&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: HUH?&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: I WAS JUST RANDOMLY KEYBOARD MASHING.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: SORRY, RIGHT.&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: ANYWAY,&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: I KNOW THIS IS SILLY, BUT LIKE ... ALL YOUR HANDS WERE CLEARLY RIGHT ON THE HOME ROW.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: I DON'T GET HOW ONE FINGER COULD HAVE STRETCHED UP TO THE &amp;quot;7&amp;quot;.&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: WHY DO YOU ALWAYS FIXATE ON THESE BIZARRE DETAILS?&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: I DON'T KNOW.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: SORRY.&amp;lt;br /&amp;gt;&lt;br /&gt;
White Hat: IT'S WEIRD, IS ALL.&amp;lt;br /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;nowiki&amp;gt;[&amp;lt;/nowiki&amp;gt;Chat transcript continues, but now we see a human-sized spider suspended from the ceiling by web is using three of its legs to type on a laptop computer. Behind the spider, White Hat is upside down, almost totally encased in spider web, also suspended from the ceiling, verbalising MMM!! MMPH!!! Between them, a chair has been knocked over onto its back.&amp;lt;nowiki&amp;gt;]&amp;lt;/nowiki&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Spider (chat dialogue shows White Hat's picture): I AM A NORMAL HUMAN TYPING WITH MY HUMAN HANDS.&amp;lt;br /&amp;gt;&lt;br /&gt;
Cueball: YEAH, OF COURSE. I KNOW.&amp;lt;br /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&amp;lt;!-- Include any categories below this line. --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring White Hat]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1527:_Humans&amp;diff=93813</id>
		<title>1527: Humans</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1527:_Humans&amp;diff=93813"/>
				<updated>2015-05-21T23:48:22Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1527&lt;br /&gt;
| date      = May 20, 2015&lt;br /&gt;
| title     = Humans&lt;br /&gt;
| image     = humans.png&lt;br /&gt;
| titletext = At this point, if we're going to keep insisting on portraying dinosaurs as featherless because it's &amp;amp;quot;cooler&amp;amp;quot;, it's time to apply that same logic to art involving bald eagles.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{Incomplete|Title text explanation needs improvement. Cleaning up required.}}&lt;br /&gt;
The comic is set in the future, with two hovering robot 'beings' discussing ancient history, in particular the clothing styles of kings and queens of the now extinct human race. It appears that robot archeologists have long ago unearthed remains from the human civilization. Recently they must have discovered something new, that presumably indicates the wearing of colorful clothing by human monarchs. Until this occurred they had no reason to believe that people wore clothing. Noting that some humans had metal rings around their heads, they have drawn the conclusion that these formed a separate species &amp;quot;Human Kings&amp;quot; and the crown is a natural outgrowth of the skeleton.&lt;br /&gt;
&lt;br /&gt;
When {{w|dinosaur}} bones were first dug up, the idea that dinosaurs were scaly, reptilian-like creatures was developed with the information available at the time.  In recent times, it's been discovered that most dinosaurs actually had {{w|Feathered dinosaur|feathers}}, and in well preserved specimens, often from the {{w|Jiufotang Formation}} in Northern China, feathers of various forms are clearly visible.&lt;br /&gt;
&lt;br /&gt;
As this runs counter to the widespread and long-held image of dinosaurs as dramatic reptiles, the public has been reluctant to accept this new discovery, especially as the addition of feathers often conjures up the image of a giant chicken. (See [[1104: Feathers]]). Had it been discovered that dinosaurs were in fact covered with 6-inch long razor tipped spikes, people may have accepted this immediately as it conforms to the stereotype of dinosaurs as killing machines. There have even been attempts to claim that the feathers did not exist.{{Citation needed}}&lt;br /&gt;
&lt;br /&gt;
In the same way, the new information on kings and queens being covered in fabric runs counter to the movie inspired image that the robot on the right had about humans, picturing them as being pink warriors that could grow metal out of their heads.  (The head-metal image may have been inspired by the discovery of kings and queens buried or entombed with their crowns lying on top of their skulls - for example the [http://www.nature.com/news/the-last-medici-may-not-have-died-of-syphilis-after-all-1.12435 Electress Palatine Anna Maria de'Medici].   If the robot beings in this comic don't know enough about human anatomy, they may assume that the metal crown is a specialized part of the human skeleton.)  Since they themselves are made of metal, they may conclude that that humans also were part metal.&lt;br /&gt;
&lt;br /&gt;
Shown at least some evidence pointing to the truth - that humans typically wore clothing, and that a monarch's crown is only a symbol worn atop the head and not part of his or her body - the robot is predictably disappointed.  Humans wearing clothing reduces them, in its opinion, to &amp;quot;big pillows&amp;quot;.  Something made of cloth (or covered in it), at least in this robot's mind, cannot be a significant actor in history.&lt;br /&gt;
&lt;br /&gt;
The robot fails to reason that, among other things, history was what it was, and its wanting things to have been a certain way does not make it so.  In addition, just as the clothing-wearing human is more than a mere pillow, a feathered dinosaur is not necessarily merely a giant chicken.&lt;br /&gt;
&lt;br /&gt;
The reference to colorful fabric may also be indicative of the popular and mistaken view that all ancient statues (particularly ancient Roman and Greek sculpture) were white. Instead, many of the statues were painted (sometimes rather gaudily due to the low availability of various dyes) and the paint has merely worn off, leading to the present belief that ancient Athens was a city of shining white marble porticoes, colonnades and statues. (See [http://www.smithsonianmag.com/arts-culture/true-colors-17888/?no-ist Reference])&lt;br /&gt;
&lt;br /&gt;
The title text references our failure to change the popular image of dinosaurs to reflect the way they truthfully once were. [[Randall]] jokingly suggests that we should apply the same &amp;quot;featherless is cooler&amp;quot; logic to popular images of bald eagles ([[1211: Birds and Dinosaurs|since they are modern dinosaurs]]), and remove their feathers (only in depictions of them, presumably), leaving them entirely bald.&lt;br /&gt;
&lt;br /&gt;
It is worth noting that this comic was released a few weeks before the scheduled release of ''{{w|Jurassic World}}'', a reboot of the {{w|Jurassic Park}} movie franchise.  This new movie, while supposedly aware of recent advances in dinosaur research, still depicts dinosaurs as giant lizards without feathers.  It seems likely that the robot's comment about &amp;quot;pink humans&amp;quot; is targeted at this movie, especially given Randall's many earlier [[:Category:Jurassic Park|references to Jurassic Park]] and his [[:Category:Velociraptors|fear of velociraptors]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Two robots are hovering in mid-air in the comic; what appear to be their optical arrays are facing each other]&lt;br /&gt;
:Robot 1: You know, new research suggests ancient human kings and queens were covered in colorful fabric.&lt;br /&gt;
:Robot 2: Ugh, I like '''movie''' humans more. Screaming pink warriors with metal crowns poking through the skin on their heads!&lt;br /&gt;
:Robot 2: Now they're, what, big pillows?&lt;br /&gt;
:Robot 2: Science ruins everything.&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Robots]]&lt;br /&gt;
[[Category:Science]]&lt;br /&gt;
[[Category:Dinosaurs]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1525:_Emojic_8_Ball&amp;diff=93383</id>
		<title>1525: Emojic 8 Ball</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1525:_Emojic_8_Ball&amp;diff=93383"/>
				<updated>2015-05-15T13:26:06Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1525&lt;br /&gt;
| date      = May 15, 2015&lt;br /&gt;
| title     = Emojic 8 Ball&lt;br /&gt;
| image     = emojic 8 ball.png&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
To experience the interactivity, visit the {{xkcd|1525|original comic}}.&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|There may be issues with the purpose explained.}}&lt;br /&gt;
Emojic 8 Ball is a type of parody of {{w|Magic 8 Ball}} using {{w|emoji}} instead of words. Whereas the real Magic 8 Ball is shaken while you ask it a question and gives out an answer along the lines of &amp;quot;yes&amp;quot;, &amp;quot;no&amp;quot;, or &amp;quot;maybe&amp;quot;, this comic takes written user input and once submitted gives a non-verbal answer using graphical {{w|Unicode}} &amp;quot;text&amp;quot; called emoji.&lt;br /&gt;
&lt;br /&gt;
It is possible that this may be commentary on the inclusion of such &amp;quot;meaningless&amp;quot; symbols into Unicode. Ask a question and get a meaningless reply, even more meaningless than the answers given by a Magic 8 Ball.&lt;br /&gt;
&lt;br /&gt;
Emoji were previously referenced in [[1513: Code Quality]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:Title: Emojic 8 Ball [with the 8 itself an emoji that looks like an 8-ball]&lt;br /&gt;
:[Form input field with placeholder text]: How will I die?&lt;br /&gt;
:[Submit button]: Ask&lt;br /&gt;
:[Image of a shiny black ball with a smaller circular window at its center.]&lt;br /&gt;
:[After the submit button is pressed, 1 to 3 emoji symbols appear in the window, framed inside a light blue triangle.]&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
&lt;br /&gt;
* The 8-ball randomly returns between one and three emoji characters. The source code reveals there is 42.1% chance of getting one character, 52.6% chance of getting two characters, and 5.3% chance of getting three.&lt;br /&gt;
* The source code contains 507 different emoji characters. For a full list of the supported characters, see [[1525:_Emojic_8_Ball/List_of_emoji|List of emoji]].&lt;br /&gt;
* This is the second comic without title text.  The first was [[1506: xkcloud]].&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&amp;lt;!-- Include any categories below this line. --&amp;gt;&lt;br /&gt;
&amp;lt;noinclude&amp;gt;&lt;br /&gt;
[[Category:Interactive comics]]&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:No title text]]&lt;br /&gt;
&amp;lt;/noinclude&amp;gt;&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1516:_Win_by_Induction&amp;diff=90881</id>
		<title>1516: Win by Induction</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1516:_Win_by_Induction&amp;diff=90881"/>
				<updated>2015-04-24T16:07:03Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1516&lt;br /&gt;
| date      = April 24, 2015&lt;br /&gt;
| title     = Win by Induction&lt;br /&gt;
| image     = win by induction.png&lt;br /&gt;
| titletext = This would be bad enough, but every 30th or 40th pokéball has TWO of them inside.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Does the &amp;quot;induction&amp;quot; have any relevance to the fact that Pikachu are &amp;quot;Electric-type&amp;quot; Pokémon?}}&lt;br /&gt;
&lt;br /&gt;
In the {{w|Pokémon}} franchise, human characters called Trainers capture fantastical creatures from the wild, the titular Pokémon (originally known as Pocket Monsters in Japan), and train them to battle one another. Pokémon are captured and stored in devices called Pokéballs, which shrink the creatures down to pocket size (hence &amp;quot;Pocket Monsters&amp;quot;). When Trainers do battle, it is common practice to summon a Pokémon by announcing the phrase &amp;quot;''&amp;lt;Pokémon's name&amp;gt;'', I choose you!&amp;quot;, and throwing the ball containing the selected Pokémon to the ground, releasing it onto the battlefield at full size.&lt;br /&gt;
&lt;br /&gt;
In this comic, a Pokémon chosen at some point was a {{w|Pikachu}}, which does not intend to engage in the battle himself.  Instead, the Pikachu chooses another Pikachu to fight for him. This process then repeats itself. Behind the Pikachu with the Pokéball is a long line of other Pikachu, suggesting that this process has been going on for a while.&lt;br /&gt;
&lt;br /&gt;
Nearby stand Cueball, holding a closed Pokéball, and Megan, looking at her watch. This suggests that Cueball intends to have his own Pokémon fight the Pikachu, but is waiting for the battle to actually begin (waiting in vain, if the above described process repeats indefinitely), while Megan (who may have chosen the original Pikachu) is growing impatient with the delay.&lt;br /&gt;
&lt;br /&gt;
The joke in this comic comes from analogy with the mathematical {{w|proof by induction}}, which is a proof with a base case, followed by a never ending sequence of steps.  Each step leads to the next, thus proving something for all cases. This title seems to suggest that the process of Pikachu choosing Pikachu will not end, effectively postponing the battle indefinitely.&lt;br /&gt;
&lt;br /&gt;
If there were a single Pikachu in each ball, this would spawn an unlimited number of Pikachu forming a single line.  Since, as title text notes, there's occasionally two of them in a Pokéball, this would lead to exponential rather than linear growth, even more quickly forming a huge mob.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[There's a long queue of Pikachu extending out of the frame to the left. They are all just out from their ball, at least the last eight Pikachu's open balls lie in two parts on the ground at their feet. They are standing in front of Megan and Cueball. Cueball is holding a closed pokéball while Megan checks the time on her watch. The front most Pikachu, holding a closed pokéball, speaks.]&lt;br /&gt;
&lt;br /&gt;
:Pikachu at the front: Pikachu, I choose ''you!''&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Pokémon‏‎]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1516:_Win_by_Induction&amp;diff=90880</id>
		<title>1516: Win by Induction</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1516:_Win_by_Induction&amp;diff=90880"/>
				<updated>2015-04-24T15:50:56Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1516&lt;br /&gt;
| date      = April 24, 2015&lt;br /&gt;
| title     = Win by Induction&lt;br /&gt;
| image     = win by induction.png&lt;br /&gt;
| titletext = This would be bad enough, but every 30th or 40th pokéball has TWO of them inside.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Does the &amp;quot;induction&amp;quot; have any relevance to the fact that Pikachu are &amp;quot;Electric-type&amp;quot; Pokémon?}}&lt;br /&gt;
&lt;br /&gt;
{{w|Pikachu}} is a type of {{w|Pokémon}} from the Pokémon multimedia franchise. In the show, human characters frequently 'battle' each other. This involves each character choosing a Pokémon to battle in their stead, and the Pokémon attack each other. Choosing a Pokémon is done by saying the name of a particular Pokémon and &amp;quot;I choose you!&amp;quot; and then throwing a Pokéball to the ground. The named Pokémon then appears from the Pokéball.&lt;br /&gt;
&lt;br /&gt;
In this comic a Pokémon chosen at some point was a Pikachu which does not intend to engage in the battle himself.  Instead, the Pikachu chooses another Pikachu to fight for him. This process then repeats itself. Behind the Pikachu with the Pokéball is a long line of other Pikachu, suggesting that this process has been going on for a while.&lt;br /&gt;
&lt;br /&gt;
Nearby stand Cueball, holding a closed Pokéball, and Megan, looking at her watch. This suggests that Cueball intends to have his own Pokémon fight the Pikachu, but is waiting for the battle to actually begin (waiting in vain, if the above described process repeats indefinitely), while Megan (who may have chosen the original Pikachu) is growing impatient with the delay.&lt;br /&gt;
&lt;br /&gt;
The joke in this comic comes from analogy with the mathematical {{w|proof by induction}}, which is a proof with a base case, followed by a never ending sequence of steps.  Each step leads to the next, thus proving something for all cases. This title seems to suggest that the process of Pikachu choosing Pikachu will not end, effectively postponing the battle indefinitely.&lt;br /&gt;
&lt;br /&gt;
If there were a single Pikachu in each ball, this would spawn an unlimited number of Pikachu forming a single line.  Since, as title text notes, there's occasionally two of them in a Pokéball, this would lead to exponential rather than linear growth, even more quickly forming a huge mob.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[There's a long queue of Pikachu extending out of the frame to the left. They are all just out from their ball, at least the last eight Pikachu's open balls lie in two parts on the ground at their feet. They are standing in front of Megan and Cueball. Cueball is holding a closed pokéball while Megan checks the time on her watch. The front most Pikachu, holding a closed pokéball, speaks.]&lt;br /&gt;
&lt;br /&gt;
:Pikachu at the front: Pikachu, I choose ''you!''&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Pokémon‏‎]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1503:_Squirrel_Plan&amp;diff=87009</id>
		<title>1503: Squirrel Plan</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1503:_Squirrel_Plan&amp;diff=87009"/>
				<updated>2015-03-25T05:17:08Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1503&lt;br /&gt;
| date      = March 25, 2015&lt;br /&gt;
| title     = Squirrel Plan&lt;br /&gt;
| image     = squirrel plan.png&lt;br /&gt;
| titletext = [Halfway to the Sun ...] Heyyyy ... what if this BALLOON is full of acorns?!&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Explanation is absent and therefore incomplete.}}&lt;br /&gt;
&lt;br /&gt;
The joke is that squirrels are stupid and have no business trying their paws at aeronautics.&lt;br /&gt;
&lt;br /&gt;
The title text further compounds this notion when the airborne squirrel jeopardizes the entire mission because he wants to test if the balloon itself is full of acorns. Basic observational skills will tell anyone that acorns do not float, and in fact have noticeable weight to them. Elementary logic then dictates that the balloon lifting the squirrel should not contain objects that contribute only weight, and therefore the balloon must not contain acorns. Yet perhaps this is for the best, since continuing on with the mission would (obviously, to us humans) end in death for the airborne squirrel, as well as inconclusive data for the ground team.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
There are three squirrels.  One is suspended from a balloon. The other two are standing on the ground, looking up at it.&lt;br /&gt;
&lt;br /&gt;
Squirrel on right: Once you've chewed a hole in the sun, shoot the balloon to fall back to earth, then pull the parachute ripcord to land.&lt;br /&gt;
&lt;br /&gt;
Squirrel holding balloon: Are you &amp;lt;b&amp;gt;&amp;lt;i&amp;gt;sure&amp;lt;/i&amp;gt;&amp;lt;/b&amp;gt; it's full of acorns?&lt;br /&gt;
&lt;br /&gt;
Squirrel on right: Look how bright and magnificent it is! What else could be in there?&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&amp;lt;!-- Include any categories below this line. --&amp;gt;&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1503:_Squirrel_Plan&amp;diff=87007</id>
		<title>1503: Squirrel Plan</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1503:_Squirrel_Plan&amp;diff=87007"/>
				<updated>2015-03-25T05:08:03Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1503&lt;br /&gt;
| date      = March 25, 2015&lt;br /&gt;
| title     = Squirrel Plan&lt;br /&gt;
| image     = squirrel plan.png&lt;br /&gt;
| titletext = [Halfway to the Sun ...] Heyyyy ... what if this BALLOON is full of acorns?!&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Explanation is absent and therefore incomplete.}}&lt;br /&gt;
&lt;br /&gt;
The joke is that squirrels are stupid and have no business trying their paws at aeronautics.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
There are three squirrels.  One is suspended from a balloon. The other two are standing on the ground, looking up at it.&lt;br /&gt;
&lt;br /&gt;
Squirrel on right: Once you've chewed a hole in the sun, shoot the balloon to fall back to earth, then pull the parachute ripcord to land.&lt;br /&gt;
&lt;br /&gt;
Squirrel holding balloon: Are you &amp;lt;b&amp;gt;&amp;lt;i&amp;gt;sure&amp;lt;/i&amp;gt;&amp;lt;/b&amp;gt; it's full of acorns?&lt;br /&gt;
&lt;br /&gt;
Squirrel on right: Look how bright and magnificent it is! What else could be in there?&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&amp;lt;!-- Include any categories below this line. --&amp;gt;&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1468:_Worrying&amp;diff=86631</id>
		<title>1468: Worrying</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1468:_Worrying&amp;diff=86631"/>
				<updated>2015-03-18T22:42:02Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1468&lt;br /&gt;
| date      = January 2, 2015&lt;br /&gt;
| title     = Worrying&lt;br /&gt;
| image     = worrying.png&lt;br /&gt;
| titletext = If the breaking news is about an event at a hospital or a lab, move it all the way over to the right.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
This chart is a visual representation of how worried people should be by various events in real life compared to the same events in movies, based on the the likelihood of the event causing serious harm. In effect it's poking fun at various cliches and the emphasis on dramatic flair, regardless of realism. The chart's Y-axis indicates how worrying an event is in real life (from &amp;quot;not very worried&amp;quot; to &amp;quot;very worried&amp;quot;), while its X-axis shows how worrying the event is in movies. Nine events are shown in the chart, all of them cliches in the medium of film:&lt;br /&gt;
&lt;br /&gt;
*'''Spilling a drink on your shirt''': In both real life and in movies, this just causes a stain and maybe a little embarrassment.&lt;br /&gt;
*'''Nosebleed''': Nosebleeds are common in real life and almost never are serious...almost. [https://allthetropes.orain.org/wiki/Deadly_Nosebleed Nosebleeds in movies] are almost always a sign that something ''is'' seriously wrong - the common, mundane nosebleeds never come up. In ''Firefly'', the blue hand men use a device that causes a nosebleed followed by  massive haemorrhaging and death. Even &amp;quot;mundane&amp;quot; nosebleeds brought on by fisticuffs are a sign that either someone has just lost, [https://allthetropes.orain.org/wiki/Heroic_Second_Wind or someone is about to have an adrenaline rush]. This does not always apply to boxing movies where the hero can easily have a massive nosebleed and still win the fight.&lt;br /&gt;
*'''Breaking news''': People in real life commonly don't pay much attention to the news at all, so many breaking stories go unnoticed until much later.  Most breaking news stories are also about non-threatening events (eg. presidential addresses) or events that are far removed from the viewer. However, in movies, seeing the news station switch to a &amp;quot;breaking news&amp;quot; broadcast is usually a means to introduce a significant plot element that the characters find worrying, and large numbers of people are often shown watching and being emotionally affected by the news while it's breaking. XKCD has referenced [[1387|news reports as foreshadowing before]].&lt;br /&gt;
*'''Parking ticket''': Tickets in movies are almost always ignored, but in real life they are moderately worrying because they cost money and can tarnish your driving record.&lt;br /&gt;
*'''Persistent cough''': In real life, coughing fits can be a sign of serious illness, but usually aren't. If you have a persistent cough, you should check with a doctor. In movies, just like with nosebleeds, a person with a [https://allthetropes.orain.org/wiki/Incurable_Cough_of_Death persistent cough] is almost always extremely ill or infectious.&lt;br /&gt;
*'''&amp;quot;We need to talk.&amp;quot;''': This phrase is a common, stereotypical lead-in to a serious conversation, usually about a couple's relationship status, that often causes a high level of worry in the recipient.  According to this chart, this phrase is equally worrisome both in movies and in real life.&lt;br /&gt;
*'''Getting knocked out by a punch''': In movies, a character who is [https://allthetropes.orain.org/wiki/Tap_on_the_Head knocked out by a punch] always wakes up sometime later with no lasting effects, making it less cause for concern than a spilt drink. In real life, however, a person knocked out by a punch can suffer serious brain injuries or even die from the punch itself, or can sustain further injuries from their head hitting the ground.&lt;br /&gt;
*'''Chest wounds''': The chart mentions wounds on both your right and left sides. In real life, a chest wound to either side is extremely worrying. But in movies, getting wounded on the right side of the chest will rarely deal lasting damage to the hero or primary villain, to show how badass they are. Wounds on the ''left'' side of the chest signify swift death. This can be explained by the common misconception that the heart is on the left side of the chest - it is actually in the centre, with a slight tendency to the left. However, even left-side chest wounds are apparently still less worrisome than nosebleeds. It must also be noted that the term &amp;quot;chest wound&amp;quot; is more broad than what the author of the comic appears to mean. More narrow terms of &amp;quot;thoracic gunshot wound&amp;quot;, &amp;quot;gunshot chest wound&amp;quot;, &amp;quot;thoracic ballistic trauma&amp;quot; or &amp;quot;penetrating chest wound&amp;quot; (the latter is slightly broader and includes the damage inflicted by blades and other impaled objects) would be more appropriate, because just a &amp;quot;chest wound&amp;quot; includes such insignificant events as minor skin cuts in the chest area.&lt;br /&gt;
&lt;br /&gt;
The title text expands on the aforementioned breaking news reports. While already overly worrying whenever they occur in movies compared to real life, should the movie's news report cover an event at a hospital (usually an outbreak of some major disease) or a laboratory (a monster escaping, a toxic gas released, an explosion, etc.), these events are universally much more worrisome than any other type of news story since they are guaranteed to be important for the protagonists in short order.&lt;br /&gt;
&lt;br /&gt;
==Table==&lt;br /&gt;
The comic shows an X-Y plot of events, showing how worried you should be ''in real life'' on the vertical axis and ''in movies'' on the horizontal axis. The axis goes from &amp;quot;not very worried&amp;quot; to &amp;quot;very worried&amp;quot;. &lt;br /&gt;
&lt;br /&gt;
Below is a table listing the coordinate for each event according to how worrying it is. The coordinates have been found by measuring each dot to the two axises and then assuming that the extremes are at 100%. &lt;br /&gt;
*Note that this gives two possible ways to interpret the Y-axis &amp;quot;In real life&amp;quot; coordinate. &lt;br /&gt;
**Either chest wound is at 100% - this is the first Y-axis coordinate given below under &amp;quot;In real life&amp;quot;. &lt;br /&gt;
**But alternatively it could be the most worrisome event over all that should be set to 100% including also the most worrisome event on the X-axis for &amp;quot;In movies&amp;quot;. In this case the nosebleed event sets the 100% bar higher, thus lowering the percentage for the &amp;quot;In real life&amp;quot; events. Either way could be argued, and thus this other coordinate is given as In Real Life vs. Nose Bleed ('''IRL vs. NB'''). &lt;br /&gt;
*For the &amp;quot;In movies&amp;quot; coordinate nosebleed is at 100%. However since nosebleed is located past the end of the x-axis arrow it could be argued that it is this event that is off the chart in the movies. But this table will assume this as the 100% mark either over all or at least for the X-axis for &amp;quot;In Movies&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable sortable&amp;quot;&lt;br /&gt;
! In real life !! IRL vs. NB !! In movies !! Event&lt;br /&gt;
|-&lt;br /&gt;
| 100% || 73% || 30% || Chest wound on your right side&lt;br /&gt;
|-&lt;br /&gt;
| 100% || 73% || 80% || Chest wound on your left side&lt;br /&gt;
|-&lt;br /&gt;
| 81% || 59% || 9% || Getting knocked out by a punch&lt;br /&gt;
|-&lt;br /&gt;
| 75% || 55% || 62% || &amp;quot;We need to talk.&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| 51% || 37% || 90% || Persistent cough&lt;br /&gt;
|-&lt;br /&gt;
| 28% || 20% || 8% || Parking ticket&lt;br /&gt;
|-&lt;br /&gt;
| 24% || 18% || 74% || Breaking news&lt;br /&gt;
|-&lt;br /&gt;
| 12% || 8% || 11% || Spilling a drink on your shirt&lt;br /&gt;
|-&lt;br /&gt;
| 11% || 8% || 100% || Nosebleed&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:'''How worried should you be when various things happen to you:'''&lt;br /&gt;
:[A chart with a scatter plot on which 9 dots are labeled. Each axis have a title and a scale. Reading from the top to the bottom and then left to right along the axis are:]&lt;br /&gt;
:Very worried&lt;br /&gt;
:'''...In Real Life'''&lt;br /&gt;
:Not very worried&lt;br /&gt;
&lt;br /&gt;
:Not very worried&lt;br /&gt;
:'''...In Movies'''&lt;br /&gt;
:Very worried&lt;br /&gt;
&lt;br /&gt;
:[The labels in the chart from the top:]&lt;br /&gt;
:[This first entry is standing in the middle of a square bracket that points to the two next entires both of which are at the same level:]&lt;br /&gt;
:Chest wound&lt;br /&gt;
:...on your right side&lt;br /&gt;
:...on your left side&lt;br /&gt;
:Getting knocked out by a punch&lt;br /&gt;
:&amp;quot;We need to talk.&amp;quot;&lt;br /&gt;
:Persistent cough&lt;br /&gt;
:Parking ticket&lt;br /&gt;
:Breaking news&lt;br /&gt;
:Spilling a drink on your shirt&lt;br /&gt;
:Nosebleed&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Charts]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1468:_Worrying&amp;diff=86630</id>
		<title>1468: Worrying</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1468:_Worrying&amp;diff=86630"/>
				<updated>2015-03-18T22:37:49Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1468&lt;br /&gt;
| date      = January 2, 2015&lt;br /&gt;
| title     = Worrying&lt;br /&gt;
| image     = worrying.png&lt;br /&gt;
| titletext = If the breaking news is about an event at a hospital or a lab, move it all the way over to the right.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
This chart is a visual representation of how worried people should be by various events in real life compared to the same events in movies, based on the the likelihood of the event causing serious harm. In effect it's poking fun at various cliches and the emphasis on dramatic flair, regardless of realism. The chart's Y-axis indicates how worrying an event is in real life (from &amp;quot;not very worried&amp;quot; to &amp;quot;very worried&amp;quot;), while its X-axis shows how worrying the event is in movies. Nine events are shown in the chart, all of them cliches in the medium of film:&lt;br /&gt;
&lt;br /&gt;
*'''Spilling a drink on your shirt''': In both real life and in movies, this just causes a stain and maybe a little embarrassment.&lt;br /&gt;
*'''Nosebleed''': Nosebleeds are common in real life and almost never are serious...almost. [http://tvtropes.org/pmwiki/pmwiki.php/Main/DeadlyNosebleed Nosebleeds in movies] are almost always a sign that something ''is'' seriously wrong - the common, mundane nosebleeds never come up. In ''Firefly'', the blue hand men use a device that causes a nosebleed followed by  massive haemorrhaging and death. Even &amp;quot;mundane&amp;quot; nosebleeds brought on by fisticuffs are a sign that either someone has just lost, [https://allthetropes.orain.org/wiki/Heroic_Second_Wind or someone is about to have an adrenaline rush]. This does not always apply to boxing movies where the hero can easily have a massive nosebleed and still win the fight.&lt;br /&gt;
*'''Breaking news''': People in real life commonly don't pay much attention to the news at all, so many breaking stories go unnoticed until much later.  Most breaking news stories are also about non-threatening events (eg. presidential addresses) or events that are far removed from the viewer. However, in movies, seeing the news station switch to a &amp;quot;breaking news&amp;quot; broadcast is usually a means to introduce a significant plot element that the characters find worrying, and large numbers of people are often shown watching and being emotionally affected by the news while it's breaking. XKCD has referenced [[1387|news reports as foreshadowing before]].&lt;br /&gt;
*'''Parking ticket''': Tickets in movies are almost always ignored, but in real life they are moderately worrying because they cost money and can tarnish your driving record.&lt;br /&gt;
*'''Persistent cough''': In real life, coughing fits can be a sign of serious illness, but usually aren't. If you have a persistent cough, you should check with a doctor. In movies, just like with nosebleeds, a person with a [http://tvtropes.org/pmwiki/pmwiki.php/Main/IncurableCoughOfDeath persistent cough] is almost always extremely ill or infectious.&lt;br /&gt;
*'''&amp;quot;We need to talk.&amp;quot;''': This phrase is a common, stereotypical lead-in to a serious conversation, usually about a couple's relationship status, that often causes a high level of worry in the recipient.  According to this chart, this phrase is equally worrisome both in movies and in real life.&lt;br /&gt;
*'''Getting knocked out by a punch''': In movies, a character who is [http://tvtropes.org/pmwiki/pmwiki.php/Main/TapOnTheHead knocked out by a punch] always wakes up sometime later with no lasting effects, making it less cause for concern than a spilt drink. In real life, however, a person knocked out by a punch can suffer serious brain injuries or even die from the punch itself, or can sustain further injuries from their head hitting the ground.&lt;br /&gt;
*'''Chest wounds''': The chart mentions wounds on both your right and left sides. In real life, a chest wound to either side is extremely worrying. But in movies, getting wounded on the right side of the chest will rarely deal lasting damage to the hero or primary villain, to show how badass they are. Wounds on the ''left'' side of the chest signify swift death. This can be explained by the common misconception that the heart is on the left side of the chest - it is actually in the centre, with a slight tendency to the left. However, even left-side chest wounds are apparently still less worrisome than nosebleeds. It must also be noted that the term &amp;quot;chest wound&amp;quot; is more broad than what the author of the comic appears to mean. More narrow terms of &amp;quot;thoracic gunshot wound&amp;quot;, &amp;quot;gunshot chest wound&amp;quot;, &amp;quot;thoracic ballistic trauma&amp;quot; or &amp;quot;penetrating chest wound&amp;quot; (the latter is slightly broader and includes the damage inflicted by blades and other impaled objects) would be more appropriate, because just a &amp;quot;chest wound&amp;quot; includes such insignificant events as minor skin cuts in the chest area.&lt;br /&gt;
&lt;br /&gt;
The title text expands on the aforementioned breaking news reports. While already overly worrying whenever they occur in movies compared to real life, should the movie's news report cover an event at a hospital (usually an outbreak of some major disease) or a laboratory (a monster escaping, a toxic gas released, an explosion, etc.), these events are universally much more worrisome than any other type of news story since they are guaranteed to be important for the protagonists in short order.&lt;br /&gt;
&lt;br /&gt;
==Table==&lt;br /&gt;
The comic shows an X-Y plot of events, showing how worried you should be ''in real life'' on the vertical axis and ''in movies'' on the horizontal axis. The axis goes from &amp;quot;not very worried&amp;quot; to &amp;quot;very worried&amp;quot;. &lt;br /&gt;
&lt;br /&gt;
Below is a table listing the coordinate for each event according to how worrying it is. The coordinates have been found by measuring each dot to the two axises and then assuming that the extremes are at 100%. &lt;br /&gt;
*Note that this gives two possible ways to interpret the Y-axis &amp;quot;In real life&amp;quot; coordinate. &lt;br /&gt;
**Either chest wound is at 100% - this is the first Y-axis coordinate given below under &amp;quot;In real life&amp;quot;. &lt;br /&gt;
**But alternatively it could be the most worrisome event over all that should be set to 100% including also the most worrisome event on the X-axis for &amp;quot;In movies&amp;quot;. In this case the nosebleed event sets the 100% bar higher, thus lowering the percentage for the &amp;quot;In real life&amp;quot; events. Either way could be argued, and thus this other coordinate is given as In Real Life vs. Nose Bleed ('''IRL vs. NB'''). &lt;br /&gt;
*For the &amp;quot;In movies&amp;quot; coordinate nosebleed is at 100%. However since nosebleed is located past the end of the x-axis arrow it could be argued that it is this event that is off the chart in the movies. But this table will assume this as the 100% mark either over all or at least for the X-axis for &amp;quot;In Movies&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable sortable&amp;quot;&lt;br /&gt;
! In real life !! IRL vs. NB !! In movies !! Event&lt;br /&gt;
|-&lt;br /&gt;
| 100% || 73% || 30% || Chest wound on your right side&lt;br /&gt;
|-&lt;br /&gt;
| 100% || 73% || 80% || Chest wound on your left side&lt;br /&gt;
|-&lt;br /&gt;
| 81% || 59% || 9% || Getting knocked out by a punch&lt;br /&gt;
|-&lt;br /&gt;
| 75% || 55% || 62% || &amp;quot;We need to talk.&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
| 51% || 37% || 90% || Persistent cough&lt;br /&gt;
|-&lt;br /&gt;
| 28% || 20% || 8% || Parking ticket&lt;br /&gt;
|-&lt;br /&gt;
| 24% || 18% || 74% || Breaking news&lt;br /&gt;
|-&lt;br /&gt;
| 12% || 8% || 11% || Spilling a drink on your shirt&lt;br /&gt;
|-&lt;br /&gt;
| 11% || 8% || 100% || Nosebleed&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:'''How worried should you be when various things happen to you:'''&lt;br /&gt;
:[A chart with a scatter plot on which 9 dots are labeled. Each axis have a title and a scale. Reading from the top to the bottom and then left to right along the axis are:]&lt;br /&gt;
:Very worried&lt;br /&gt;
:'''...In Real Life'''&lt;br /&gt;
:Not very worried&lt;br /&gt;
&lt;br /&gt;
:Not very worried&lt;br /&gt;
:'''...In Movies'''&lt;br /&gt;
:Very worried&lt;br /&gt;
&lt;br /&gt;
:[The labels in the chart from the top:]&lt;br /&gt;
:[This first entry is standing in the middle of a square bracket that points to the two next entires both of which are at the same level:]&lt;br /&gt;
:Chest wound&lt;br /&gt;
:...on your right side&lt;br /&gt;
:...on your left side&lt;br /&gt;
:Getting knocked out by a punch&lt;br /&gt;
:&amp;quot;We need to talk.&amp;quot;&lt;br /&gt;
:Persistent cough&lt;br /&gt;
:Parking ticket&lt;br /&gt;
:Breaking news&lt;br /&gt;
:Spilling a drink on your shirt&lt;br /&gt;
:Nosebleed&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Charts]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1499:_Arbitrage&amp;diff=86532</id>
		<title>1499: Arbitrage</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1499:_Arbitrage&amp;diff=86532"/>
				<updated>2015-03-18T02:46:29Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1499&lt;br /&gt;
| date      = March 16, 2015&lt;br /&gt;
| title     = Arbitrage&lt;br /&gt;
| image     = arbitrage.png&lt;br /&gt;
| titletext = The invisible hand of the market never texts me back.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
&lt;br /&gt;
In {{w|economics}} and {{w|finance}}, {{w|arbitrage}} is the practice of buying cheaply on one market whilst immediately selling at a higher price on another market, taking advantage of the price difference to make relatively risk-free profit.&lt;br /&gt;
&lt;br /&gt;
In real-world {{w|Market liquidity|liquid financial markets}}, arbitrage ensures that there is only one price for a product. Arbitrageurs are the individuals performing this act to equalize the prices in those markets and hopefully make a profit.&lt;br /&gt;
&lt;br /&gt;
The place where [[Cueball]] and [[Hairy]] are eating is giving away unlimited free {{w|tortilla chip}}s. Hairy is acting as an arbitrageur by collecting the chips to later resell them. This is much to the consternation of Cueball, who is (depending on how you interpret the simple art-style) holding his hands up in front of his mouth in shock, covering the lower half of his face in shame, covering his eyes out of denial, sliding his palms down the front of his face in disgust, or eating chips. Possibly all in sequence.&lt;br /&gt;
&lt;br /&gt;
Trying this strategy in the real world would not work. Customers leaving the restaurant with bags of chips would presumably be barred from the establishment, limiting supply as a result. And then there's the matter of a lack of demand, given the absence of a {{w|secondary market}}. Case in point: would ''you'' buy open bags of perishable, presumably hand-soiled chips? We didn't think so.&lt;br /&gt;
&lt;br /&gt;
In the caption below the comic, [[Randall]] suggests that society only functions because we don't take people like Hairy &amp;quot;out to dinner&amp;quot;, i.e., we generally have an aversion to dealing with people with such extreme self-interest, bordering on {{w|Psychopathy#Sociopathy|sociopathic}} behavior. We see from Cueball's reaction that he is appalled by what Hairy is doing believing he can profit from the apparent generosity.&lt;br /&gt;
&lt;br /&gt;
A distinguishing feature of {{w|social animals}}, rather than animals simply sharing a {{w|habitat}}, is that they perform tasks that benefit their group. All such societies rely on some situations where the individual is not working purely on short term self interest. The payoff for this is generally that co-operation makes things better for the group as a whole. Most people would find Hairy's behavior embarrassing and shameful, and thus would not socialize with people who behave like that. By rejecting such individuals, society protects itself from such people.&lt;br /&gt;
&lt;br /&gt;
The title text mentions the ''{{w|invisible hand}}''. In economics this is a metaphor used by {{w|Adam Smith}} to describe unintended social benefits resulting from the individual actions of self-interested parties.  In the context of arbitrage, the &amp;quot;invisible hand&amp;quot; compels all of a given fungible substance to be sold for the same price, as a result of the actions of individuals like Hairy who are only seeking personal profit.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball and Hairy are sitting at a table with a bowl of chips in the middle. Hairy is taking chips from the bowl on the table with one hand, and his other hand is dropping chips into a large bag behind him. Cueball is double facepalming.]&lt;br /&gt;
:Hairy: ''They're'' the ones giving chips away!&lt;br /&gt;
:Hairy: If they don't see the arbitrage potential, sucks for them.&lt;br /&gt;
:On the bag is written: Chips&lt;br /&gt;
&lt;br /&gt;
:[Below the main frame:]&lt;br /&gt;
:In a deep sense, society functions only because we generally avoid taking these people out to dinner.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Hairy]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1499:_Arbitrage&amp;diff=86482</id>
		<title>1499: Arbitrage</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1499:_Arbitrage&amp;diff=86482"/>
				<updated>2015-03-16T19:06:39Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: Added all possible interpretations of Cueball's expression.&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1499&lt;br /&gt;
| date      = March 16, 2015&lt;br /&gt;
| title     = Arbitrage&lt;br /&gt;
| image     = arbitrage.png&lt;br /&gt;
| titletext = The invisible hand of the market never texts me back.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Very long and tedious explanation. Can anyone with knowledge of Arbitrage make it more compact and easier to read for the lay man. For instance what does &amp;quot;even if reactionary server slow down, and a minimum paid order per unit time rule were ignored&amp;quot; even mean? At least some wiki links would be in order. I have added several. Also the part of the title text about not getting text back is not mentioned. Is it clear what he means?}}&lt;br /&gt;
&lt;br /&gt;
In {{w|economics}} and {{w|finance}}, {{w|arbitrage}} is the practice of taking advantage of a price difference between two or more markets to make risk-free profit by buying in the market with a lower price and simultaneously selling in the market with the higher price. &lt;br /&gt;
&lt;br /&gt;
In real-world {{w|Market liquidity|liquid financial markets}}, the possibility of arbitrage ensures that there is only a single price for a given product, since if a product is available for a low price in one market and a high price in another, the buying and selling by arbitrageurs will bid the price up in the low-price market and down in the high-price market until the prices are equal.&lt;br /&gt;
&lt;br /&gt;
The place where [[Cueball]] and [[Hairy]] are eating is giving away unlimited free {{w|potato chip}}s, effectively a market selling chips for $0. Hairy is taking advantage of this fact to turn a profit for himself by collecting the chips and attempting to resell them elsewhere. Any price higher than $0 would make him a profit. This is obviously much to the consternation of Cueball, who is (depending on how you interpret the simple art-style) holding his hands up in front of his mouth in shock, covering the lower half of his face in shame, covering his eyes out of denial, cradling his forehead in his hands to soothe the oncoming headache, or sliding his palms down the front of his face in disgust. Possibly all five in sequence.&lt;br /&gt;
&lt;br /&gt;
In the real world, one wouldn't be allowed to carry large bags full of chips out of the restaurant, nor would there be many buyers for chips taken from a restaurant in this manner, so this is not expected to work even if reactionary server slow down, and a minimum paid order per unit time rule were ignored. In financial terms, the extreme {{w|liquidity}} of the chip market is what allows the obvious arbitrage opportunity to persist indefinitely. &lt;br /&gt;
&lt;br /&gt;
Another related issue is the poor {{w|fungibility}} of chips. Chips that are factory-sealed in a bag or served in a restaurant are served in a context where cleanliness and {{w|food safety}} practices can be assumed to have been followed. Chips sold from an open bag by some random person do not have that expectation associated with them and would not command as high a price as they do in a restaurant transaction.&lt;br /&gt;
&lt;br /&gt;
In the caption below the comic, [[Randall]] suggests that society only functions because we don't take people like Hairy &amp;quot;out to dinner&amp;quot;, i.e., we generally have an aversion to dealing with people with such extreme self-interest, bordering on {{w|Psychopathy#Sociopathy|sociopathic}} behavior.  Apart from the fact that he intends to sell the chips, we also see from Cueball's reaction, how appalled he is by what Hairy is doing right in front of the waiters in the restaurant.&lt;br /&gt;
&lt;br /&gt;
A distinguishing feature of {{w|social animals}}, rather than animals simply sharing a {{w|habitat}}, is that they perform tasks that benefit their group. All such societies rely on some situations where the individual is not working purely on short term self interest. The payoff for this is generally that co-operation makes things better for the group as a whole. Most people would find Hairy's behavior embarrassing and shameful, and thus would not socialize with people who behave like that. By rejecting such individuals, society protects itself from such people.&lt;br /&gt;
&lt;br /&gt;
The title text mentions the ''{{w|invisible hand}}''. In economics this is a metaphor used by {{w|Adam Smith}} to describe unintended social benefits resulting from the individual actions of self-interested parties.  In the context of arbitrage, the &amp;quot;invisible hand&amp;quot; compels all of a given fungible substance to be sold for the same price, as a result of the actions of individuals like Hairy who are only seeking personal profit.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball and Hairy are sitting at a table with a bowl of chips in the middle. Hairy is taking chips from the bowl on the table with one hand, and his other hand is dropping chips into a large bag behind him.]&lt;br /&gt;
:Hairy: ''They're'' the ones giving chips away!&lt;br /&gt;
:Hairy: If they don't see the arbitrage potential, sucks for them.&lt;br /&gt;
:On the bag is written: Chips&lt;br /&gt;
&lt;br /&gt;
:[Below the main frame]: In a deep sense, society functions only because we generally avoid taking these people out to dinner.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Hairy]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1499&amp;diff=86413</id>
		<title>1499</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1499&amp;diff=86413"/>
				<updated>2015-03-16T12:50:19Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1499&lt;br /&gt;
| date      = March 16, 2015&lt;br /&gt;
| title     = Arbitrage&lt;br /&gt;
| image     = arbitrage.png&lt;br /&gt;
| titletext = The invisible hand of the market never texts me back.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Very early draft.}}&lt;br /&gt;
In economics and finance, arbitrage is the practice of taking advantage of a price difference between two or more markets. Some place give unlimited free chips while you are eating there. In the comic &amp;quot;hair guy&amp;quot; is taking advantage of this fact to turn a profit for himself. In the real world one wouldn't be allowed to carry bags full of chips out of the restaurant, nor is one expected to try to do this.&lt;br /&gt;
&lt;br /&gt;
Title text&lt;br /&gt;
&lt;br /&gt;
In economics, the invisible hand is a metaphor used by Adam Smith to describe unintended social benefits resulting from individual actions.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1307:_Buzzfeed_Christmas&amp;diff=86330</id>
		<title>1307: Buzzfeed Christmas</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1307:_Buzzfeed_Christmas&amp;diff=86330"/>
				<updated>2015-03-15T06:05:38Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1307&lt;br /&gt;
| date      = December 22, 2013&lt;br /&gt;
| title     = Buzzfeed Christmas&lt;br /&gt;
| image     = buzzfeed christmas.png&lt;br /&gt;
| titletext = The 6 Weirdest Objects The Buzzfeed Writers Are Throwing Out Their Windows At Us&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
Christmas caroling is a tradition in which groups of singers travel from house to house, singing {{w|Christmas carol|carols}}.&lt;br /&gt;
&lt;br /&gt;
These carolers are in front of the [http://www.buzzfeed.com/ BuzzFeed] offices singing the {{w|The Twelve Days of Christmas (song)|The Twelve Days of Christmas}}, which ''usually'' contains:&lt;br /&gt;
&lt;br /&gt;
:On the twelfth day of Christmas, my true love gave to me.&lt;br /&gt;
:12 Drummers drumming&lt;br /&gt;
:11 Pipers piping&lt;br /&gt;
:10 Lords a-leaping&lt;br /&gt;
:9 Ladies dancing&lt;br /&gt;
:8 Maids a-milking&lt;br /&gt;
:7 Swans a-swimming&lt;br /&gt;
:6 Geese a-laying&lt;br /&gt;
:5 Golden rings&lt;br /&gt;
:4 Calling birds&lt;br /&gt;
:3 French hens&lt;br /&gt;
:2 Turtle doves&lt;br /&gt;
:And a partridge in a pear tree.&lt;br /&gt;
&lt;br /&gt;
The carolers changed the lyrics to match the style of headlines of the topics published by BuzzFeed, which usually contain a number and a superlative; for example, ''13 Worst Plane Crashes of the Decade'' or ''8 Otters Who Are So Cute We Can't Even Handle It''. This method of writing headlines, referred to as clickbait, is used by several other news sites, because it is known to generate a lot of visits and ad revenue. [[Randall]] has touched on this subject before in [[1283: Headlines]].&lt;br /&gt;
&lt;br /&gt;
Carolers are usually rewarded with a gift, but the BuzzFeed writers probably didn't appreciate the song, because they threw weird stuff at them which the carolers used in their 6th verse.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Carolers singing.]&lt;br /&gt;
::12 Best drummers of ''all time''&lt;br /&gt;
::11 Pipers whose jaw-dropping good piping will make you cry&lt;br /&gt;
::You won't ''believe'' what these 10 lords leap over&lt;br /&gt;
:Carolers outside the Buzzfeed offices perform &amp;quot;12 Weird things I ''actually got'' for Christmas&amp;quot;&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*The Buzzfeed YouTube Channel uploaded a [http://www.youtube.com/watch?v=_v92edGrMbY video] called ''The 12 Days of Internet Christmas'', which is similar to ''The Twelve Days of Christmas'' song. But the video contains a number of strange objects and images, to name a few, a naked Ryan Gosling and four men with curly beard. Because of its absurd content, according to the like-dislike ratio, the video's quality is rather controversial.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Christmas]]&lt;br /&gt;
[[Category:Music]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1492:_Dress_Color&amp;diff=85358</id>
		<title>1492: Dress Color</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1492:_Dress_Color&amp;diff=85358"/>
				<updated>2015-02-27T23:37:12Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1492&lt;br /&gt;
| date      = February 27, 2015&lt;br /&gt;
| title     = Dress Color&lt;br /&gt;
| image     = dress_color.png&lt;br /&gt;
| titletext = This white-balance illusion hit so hard because it felt like someone had been playing through the Monty Hall scenario and opened their chosen door, only to find there was unexpectedly disagreement over whether the thing they'd revealed was a goat or a car.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
This comic shows two drawings of [[Megan]] wearing the same dress, but with different background colors. The two drawings are split with a narrow vertical portion of an image from the web.&lt;br /&gt;
&lt;br /&gt;
The comic strip refers to a dress whose image went viral on [http://swiked.tumblr.com/post/112174461490/officialunitedstates-unclefather Tumblr] ony hours before the strip was posted and soon showed up also on [http://www.reddit.com/r/explainlikeimfive/comments/2xaprc/eli5why_does_this_dress_appear_whitegold_to_some/ Reddit], [https://twitter.com/hashtag/thedress?src=hash Twitter], [http://www.wired.com/2015/02/science-one-agrees-color-dress/ Wired] and on [http://www.nytimes.com/2015/02/28/business/a-simple-question-about-a-dress-and-the-world-weighs-in.html The New York Times].&lt;br /&gt;
&lt;br /&gt;
Due to the dress' particular color scheme and the exposure of the photo, it forms an {{w|optical illusion}} causing viewers to disagree on what color the dress actually seems to be. The xkcd strip sandwiches a cropped segment of the photographed dress between two drawings which use the colors from the image against different backgrounds, leading the eye to interpret the white balance differently, demonstrating how the dress can appear different colors depending on context and the viewer's previous experiences.&lt;br /&gt;
&lt;br /&gt;
Both dresses have exactly the same colors actually:&lt;br /&gt;
* RGB 113, 94, 58 (orange) &amp;lt;div style=&amp;quot;display:inline-block; height:1em; width:1em; background-color: #715E3A&amp;quot;&amp;gt;&amp;lt;/div&amp;gt;&lt;br /&gt;
* RGB 135, 154, 189 (blue) &amp;lt;div style=&amp;quot;display:inline-block; height:1em; width:1em; background-color: #879ABD&amp;quot;&amp;gt;&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Below is an illustration demonstrating that the &amp;quot;colors&amp;quot; of the dresses are the same by connecting them with two lines with the above mentioned colors (all the way!):&lt;br /&gt;
:[[File:dress.png|400px]]&lt;br /&gt;
&lt;br /&gt;
Similar types of illusions can be seen at Wikipedias {{w|Optical illusion#Color_and_brightness_constancies|optical illusion page}} and for instance here at [http://www.echalk.co.uk/amusements/OpticalIllusions/colourPerception/colourPerception.html echalk] (the latter page requires Flash®player).&lt;br /&gt;
&lt;br /&gt;
This image has sparked surprisingly heated debate in many internet communities. A select few individuals may have prior experience with optical illusions of this ilk, but because this particular image went viral -- it got heavy exposure over such a short amount of time -- it reached millions of people who aren't so familiar with these sorts of mind tricks. To the uninitiated, the color of the dress seems immediately obvious; when others cannot see it their way, it can be a surreal (even uncomfortable) experience.&lt;br /&gt;
&lt;br /&gt;
The title text refers to the game show ''{{w|Let's Make a Deal}}'', hosted by Monty Hall, which was famous for having contestants pick among several doors which either had a real prize (for example, a car) or a joke prize (for example, a goat). [[Randall]] states that people find the dress color issue just as baffling as if upon opening the chosen door no one can agree if the item behind the door is a car or a goat. This just shows how ridiculous this outrage people feel about the color is. This is a typical kind of prank that Randall enjoys. &lt;br /&gt;
&lt;br /&gt;
''Let's Make a Deal'' previously appeared in [[1282: Monty Hall]], where [[Beret Guy]] decides to take the goat.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Two images of Megan in a dress on each side of an image of a close up of a real dress with the same colors. On the left, she is coloured blue on a dark blue background, while on the right, she is yellow against a buttercup background. Her dress is the same colour in each panel - the same as the real one in-between.]&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1490:_Atoms&amp;diff=85000</id>
		<title>1490: Atoms</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1490:_Atoms&amp;diff=85000"/>
				<updated>2015-02-23T18:54:01Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1490&lt;br /&gt;
| date      = February 23, 2015&lt;br /&gt;
| title     = Atoms&lt;br /&gt;
| image     = atoms.png&lt;br /&gt;
| titletext = When I was little I had trouble telling my dad apart form the dog. I always recognized my mom because she had a bunch of extra plutoniums in her middle. I never did ask her why ...&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
In this comic, [[Megan]] is preparing a sample of what appears to be some mineral for {{w|elemental analysis}}. It seems to be some kind of {{w|silicate}} containing a small amount of {{w|iron}} (a common example of this would be {{w|red sandstone}}), and she is running a test to see if it contains {{w|beryllium}} (a rarer element whose best-known natural form is as a component of {{w|emerald}}).&lt;br /&gt;
&lt;br /&gt;
[[Beret Guy]] seems to be able to tell what elements the substance is composed of just by eyeballing it, making him perhaps the perfect elemental analysis instrument. To confirm this, Megan asks Beret Guy what he sees when he looks at her face. Since he only sees the atoms Megan is composed of (mostly {{w|Composition_of_the_human_body|oxygen, carbon and hydrogen}}) he only notices the unusual atoms. In this case he sees the metal atoms her {{w|Dental_restoration#Materials_used|dental fillings}} are composed of. This shows his &amp;quot;atomic vision&amp;quot; extends beyond the surface of the substances. Megan finds this bizarre and asks him what is wrong with him. He states that he suspects people think he is weird because he contains too much {{w|zinc}}, missing Megan’s point: what is weird is not Beret guy’s zinc content, but his tendency to apparently see everyone as clouds of atoms.&lt;br /&gt;
&lt;br /&gt;
High zinc intake ({{w|Zinc_toxicity|zinc toxicity}}) can cause nausea, vomiting, pain, cramps and diarrhea. It also reduces copper absorption, which affects the immune system.&lt;br /&gt;
&lt;br /&gt;
The comic continues the theme of Beret Guy’s naive misunderstandings of scientific terminology turning to be literally true: in a previous [[1486: Vacuum|comic]] his ill-informed misinterpretation of the notion of energy in the vacuum resulted in him gaining significant superpowers.&lt;br /&gt;
&lt;br /&gt;
In the title text, the concept is taken even further: Beret Guy found his dad indistinguishable from a dog; and apparently could recognize his mother only because she contained {{w|plutonium}} ― a very unusual occurrence that cannot possibly occur in nature ― either she had an {{w|Radioisotope thermoelectric generator|RTG}}-powered pacemaker (a few hundred were made in the 1970s), or she was the victim of unethical medical experimentation. The presence of plutonium in his mother may be an explanation or source of his own differences. &lt;br /&gt;
&lt;br /&gt;
A typo in the title text mistakes form for from. This may alternatively be a play on form as in form factor - dog vs man or even man = dog.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:Beret guy: What’re you doing?&lt;br /&gt;
:&lt;br /&gt;
:Megan: Testing a sample for beryllium.&lt;br /&gt;
:Beret guy: That? Yeah, there’s a bunch of berylliums.&lt;br /&gt;
:Megan: How do you know?&lt;br /&gt;
:&lt;br /&gt;
:Beret guy: Look at it! See? Tons of oxygens and silicons, a few irons but definitely some berylliums too! Can’t you see them?&lt;br /&gt;
:&lt;br /&gt;
:Megan: No, I can’t see a list of the atoms in a thing by looking.&lt;br /&gt;
:Beret guy: How do you tell what things are?&lt;br /&gt;
:&lt;br /&gt;
:Megan: This is ridiculous. Look at me. What do you see?&lt;br /&gt;
:Beret guy: You have tons of metal in your face. Lots of fillings, I guess?&lt;br /&gt;
:&lt;br /&gt;
:Megan: What’s wrong with you?&lt;br /&gt;
:Beret guy: Too many zincs? I’ve always worried I had too much zinc and everyone thought I was weird.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Beret Guy]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=567:_Urgent_Mission&amp;diff=84765</id>
		<title>567: Urgent Mission</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=567:_Urgent_Mission&amp;diff=84765"/>
				<updated>2015-02-20T02:31:21Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 567&lt;br /&gt;
| date      = April 10, 2009&lt;br /&gt;
| title     = Urgent Mission&lt;br /&gt;
| image     = urgent_mission.png&lt;br /&gt;
| titletext = Sure, we could stop dictators and pandemics, but we could also make the signs on every damn diagram make sense.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{w|Benjamin Franklin}} was one of the Founding Fathers of the United States. Aside from uniting most of his country against Britain's heavy-handed rule, he was also a model of a {{w|renaissance man}}: an author, printer, musician, politician, postmaster, inventor, scientist, and diplomat. Some of his legacies include bifocals, the Franklin stove, an odometer for a horse-drawn carriage, the almanac, and abolitionist ideals. He has since been honored with the use of his image on the $100 bill. &lt;br /&gt;
&lt;br /&gt;
Franklin also did several {{w|Benjamin_Franklin#Electricity|experiments regarding electricity}}, and invented the {{w|lightning rod}}. He discovered the fundamentals of electricity, including positive and negative charges, as well as the principle of conservation of charge. When Franklin first wrote down his notes for electricity, he defined a positive charge as one left on a glass rod by rubbing it with silk, and a negative change as one left on rubber by rubbing it with fur. Without realizing it, this meant that he had assigned a negative value to the charge on the electron, later identified as the fundamental carrier of electrical charge.&lt;br /&gt;
&lt;br /&gt;
In an electrical circuit, we envisage the charge to be flowing from positive to negative. This is analogous to energy flowing from a region of high temperature to one of low temperature, or a fluid moving from an area of high pressure to one of low pressure.  However, because an electron is negatively charged, the actual flow of electrons is in the opposite direction, from negative to positive. This reversal of the natural expectation has caused unnecessary confusion to many fledgling engineers.&lt;br /&gt;
&lt;br /&gt;
In the comic, the invention of a time machine was commissioned with the intent of preventing a [https://allthetropes.orain.org/wiki/Robot_War robot apocalypse]. However, the [[Cueball]] that built and used the the machine is an electrical engineer with misplaced priorities, believing that reversing Franklin's &amp;quot;mistake&amp;quot; takes precedence over eliminating a more immediate threat to the human race. &lt;br /&gt;
&lt;br /&gt;
Cueball tells Franklin that the charge left on a glass rod by rubbing it with silk should be the ''negative'' charge, not the positive charge, because the friction ''removes'' electrons from the rod. This would not have been intuitive to Franklin, because the electron had not as of yet been discovered. Yet by telling Franklin to reverse the positive and negative conventions, this would ultimately result in an alternate universe where electrons are assigned a positive charge. One can only speculate what other changes this reversal of convention would lead to, [https://allthetropes.orain.org/wiki/For_Want_of_a_Nail as small changes tend to cascade into huge ones]. Would the positron have been instead named the negatron? And would this affect the success of the {{w|Transformers}} franchise?&lt;br /&gt;
&lt;br /&gt;
In the title text, Cueball defends his actions, claiming that correcting the signs on &amp;quot;every damn diagram&amp;quot; is more important than preventing the rise of atrocity-committing autocrats and deadly diseases. Cueball is likely voicing [[Randall]]'s own frustration with this breach of logic, albeit exaggerated to comedic levels.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball steps out of rift. Benjamin Franklin is sitting at his desk with quill and parchment.]&lt;br /&gt;
:Cueball: Benjamin Franklin?&lt;br /&gt;
:Franklin: Yes?&lt;br /&gt;
:Cueball: I bring a message from the future! I don't have much time.&lt;br /&gt;
:Franklin: What is it?&lt;br /&gt;
:Cueball: The convention you're setting for electric charge is backward. The one left on glass by silk should be the negative charge.&lt;br /&gt;
:We were going to use the time machine to prevent the robot apocalypse, but the guy who built it was an electrical engineer.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring real people]]&lt;br /&gt;
[[Category:Physics]]&lt;br /&gt;
[[Category:Time travel]]&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Radiation&amp;diff=84622</id>
		<title>Radiation</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Radiation&amp;diff=84622"/>
				<updated>2015-02-17T01:37:23Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    =&lt;br /&gt;
| date      = March 19, 2011&lt;br /&gt;
| title     = Radiation&lt;br /&gt;
| image     = radiation.png&lt;br /&gt;
| titletext =&lt;br /&gt;
}}&lt;br /&gt;
[[Category:Charts]]&lt;br /&gt;
A larger version of this picture can be found here: [http://xkcd.com/radiation/ http://xkcd.com/radiation/].&lt;br /&gt;
The original blog post &amp;quot;Radiation Chart&amp;quot; can be found here: [http://blog.xkcd.com/2011/03/19/radiation-chart/ http://blog.xkcd.com/2011/03/19/radiation-chart/]&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Links at the top are broken and the comic does not have a number. This comic was part of a blog post and not a normal comic and thus is not part of the normal sequence. The navigation links should be modified to reflect this. Some features still not explained.}}&lt;br /&gt;
This is a chart listing various sources of radiation and the amount of dosage in sieverts (a unit of absorbed radiation) you would receive. There is an image of squares next to each radiation source, which act as a representation for an amount of sieverts. The blue squares represent .05 micro sieverts each, the green squares represent  20 micro sieverts each, the red squares represent 10 milli sieverts each, and the yellow squares represent 1 sievert each.&lt;br /&gt;
&lt;br /&gt;
The first section, the blue section, shows small dosages of radiation compared to 1 to 800 blue squares.&lt;br /&gt;
A much smaller version of the blue chart is shown in the green section to compare blue to green squares. The green section uses green squares in comparison to its radiation amounts, which are much larger than those listed on the blue section.&lt;br /&gt;
The red section uses red squares to compare its much more powerful radiation sources. It has a smaller revision of the green chart to compare green to red squares.&lt;br /&gt;
The yellow section compares yellow squares to a single source, the amount of radiation absorbed during ten minutes next to the Chernobyl reactor core after explosion and meltdown. It likewise features a small version of the red chart to compare yellow to red squares.&lt;br /&gt;
&lt;br /&gt;
Randall points out the cell phones do not produce ionizing radiation, &amp;quot;unless it's a bananaphone&amp;quot;. This is in reference to ''[[wikipedia:Bananaphone|Bananaphone]]'', a 1994 children's song by Raffi which, on the internet, saw its peak of memetic popularity in 2004. As noted in the blue chart, bananas give off less than a fraction of a micro-Sievert of radiation; thus, a phone that is also a banana would give off radiation.&lt;br /&gt;
&lt;br /&gt;
Below the charts there is a conversion table comparing various squares to each other and their conversion rates.&lt;br /&gt;
Below that is various web sources that have just the urls listed, not in any official citation like MLA or APA.&lt;br /&gt;
&lt;br /&gt;
Randal explains at the bottom that this chart is merely a rough guideline, and may have errors. Indeed, his sources that he listed have many typos and some are broken links.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:Title: Radiation Dose Chart&lt;br /&gt;
:Subtitle: This is a chart of the ionization dose a person can absorb from various sources. The unit for absorbed dose is &amp;quot;sievert&amp;quot; (Sv), and measures the effect a dose of radiation will have on the cells of the body. One sievert (all at once) will make you sick, and too many more will kill you, but we safely absorb small amounts of natural radiation daily. Note: The same number of sieverts absorbed in a shorter time will generally cause more damage, but your cumulative long-term dose plays a big role in things like cancer risk.&lt;br /&gt;
&lt;br /&gt;
:Blue section:&lt;br /&gt;
:1 blue square: Sleeping next to someone (0.05 μSv)&lt;br /&gt;
:1.8 blue squares: Living within 50 miles of a nuclear power plant for a year (0.09 μSv)&lt;br /&gt;
:2 blue squares: Eating one banana (0.1 μUsv)&lt;br /&gt;
:6 blue squares: Living within 50 miles of a coal power plant for a year (0.3 μSv)&lt;br /&gt;
:20 blue squares: Arm X-Ray (1 μSv)&lt;br /&gt;
:25 blue squares: Extra dose from spending one day in an area with higher-than-average natural background radiation, such as the Colorado plateau (1.2 μSv)&lt;br /&gt;
:100 blue squares: Dental x-ray (5 μSv)&lt;br /&gt;
:200 blue squares: Background dose received by an average person over one normal day (10 μSv)&lt;br /&gt;
:800 blue squares: Airplane flight from New York to LA (400 μSv)&lt;br /&gt;
&lt;br /&gt;
:Note under blue section: Using a cell phone (0 μSv)-a cell phone's transmitter does not produce ionizing radiation* and does not cause cancer.&lt;br /&gt;
:*Unless it's a bananaphone.&lt;br /&gt;
&lt;br /&gt;
:Green section:&lt;br /&gt;
:1 green square: Chest x-ray (20 μSv)&lt;br /&gt;
:1.5 green squares: EPA yearly release target for a nuclear power plant (30 μSv)&lt;br /&gt;
:3 green squares: All the does in the blue chart combined (~60 μSv)&lt;br /&gt;
:2 green squares: Extra dose to Tokyo in weeks following Fukushima accident (40 μSv&lt;br /&gt;
:3.5 green squares: Living in a stone, brick, or concrete building for a year (70 μSv)&lt;br /&gt;
:4 green squares: Average total dose from the Three Mile Island accident to someone living within 10 miles (80 μSv)&lt;br /&gt;
:5 green squares: Approximate total dose received at Fukushima Town Hall over two weeks following accident (100 μSv)&lt;br /&gt;
:12.5 green squares: EPA yearly release limit for a nuclear power plant (250 μSv)&lt;br /&gt;
:19.5 green squares: Yearly dose from natural potassium in the body (390 μSv)&lt;br /&gt;
:20 green squares: Mammogram (400 μSv)&lt;br /&gt;
:50 green squares: EPA yearly limit on radiation exposure to a single member of the public (1 mSv=1,000 μSv)&lt;br /&gt;
:50 green squares: Maximum external dose from Three Mile Island accident (1 mSv)&lt;br /&gt;
:50 green squares: Typical dose over two weeks in Fukushima Exclusion Zone (1 mSv, but areas northwest saw far higher doses)&lt;br /&gt;
:100 green squares: Head CT Scan (2 mSv)&lt;br /&gt;
:200 green squares: Normal yearly background dose. About 85% is from natural sources. Nearly all the rest os from medical scans (~4 mSv)&lt;br /&gt;
:300 green squares: Dose from spending an hour on the grounds at the Chernobyl plant in 2010 (6 mSv in one spot, but varies wildly)&lt;br /&gt;
:350 green squares: Chest CT scan (7 mSv)&lt;br /&gt;
:2,500 green squares: Maximum yearly dose permitted for US radiation workers (50 mSv)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:Red section:&lt;br /&gt;
:4 red squares: Approximate total dose at one station at the north-west station of the Fukushima exclusion zone (40 mSv)&lt;br /&gt;
:5 red squares: Radiation worker one-year dose limit (50 mSv)&lt;br /&gt;
:7.5 red squares: All doses in green chart combined (~75 mSv)&lt;br /&gt;
:10 red squares: Lowest one-year dose clearly linked to increased cancer risk (100 mSv)&lt;br /&gt;
:18 red squares: Dose received by two Fukushima plant workers (~180 mSv)&lt;br /&gt;
:40 red squares: Dose causing symptoms of radiation poisoning if received in a short time (400 mSv, but it varies)&lt;br /&gt;
:200 red squares: severe radiation poisoning, in some cases fatal (2000 mSv, 2 Sv)&lt;br /&gt;
:400 red squares: Usually fatal radiation poisoning. Survival occassionally possible with prompt treatment (4 Sv)&lt;br /&gt;
:800 red squares: Fatal dose, even with treatment (8 Sv)&lt;br /&gt;
&lt;br /&gt;
:Smaller section within red section:&lt;br /&gt;
:EPA guidelines for emergency situations, provided to ensure quick decision-making:&lt;br /&gt;
:10 red squares: Dose limit for emergency workers protecting valuable property (100 mSv)&lt;br /&gt;
:25 red squares: Dose limit for emergency workers in lifesaving operations (250 mSv)&lt;br /&gt;
&lt;br /&gt;
:Yellow section:&lt;br /&gt;
:50 yellow squares: Ten minutes next to the Chernobyl reactor core after explosion and meltdown (50 Sv)&lt;br /&gt;
&lt;br /&gt;
:Conversion charts:&lt;br /&gt;
:1 blue square equals (0.05 μSv)&lt;br /&gt;
:400 blue squares equal 1 green square (20 μSv)&lt;br /&gt;
:500 green squares equal 1 red square (10 mSv)&lt;br /&gt;
:100 red squares equal 1 yellow square (1 Sv)&lt;br /&gt;
&lt;br /&gt;
:Sources:&lt;br /&gt;
:http://www.nrc.gov/reading-rm/doc-collections/cfr/part020/&lt;br /&gt;
:www.nema.ne.gov/technological/dose-limits.html&lt;br /&gt;
:http://www.deq/idaho.gov/inl_oversight/radiation/dose_calculator.cfm&lt;br /&gt;
:http://www.deq/idaho.gov/inl_oversight/radiation/radiation_guide.cfm&lt;br /&gt;
:http://mitnse.com/&lt;br /&gt;
:http://www.bnl.gov/bnlweb/PDF/03SER/Chapter_8.pdf&lt;br /&gt;
:http://dels-old.nas.edu/dels/rpt_briefs/rerf_final.pdf&lt;br /&gt;
:http://en.wikipedia.org/wiki/Sievert&lt;br /&gt;
:http://blog.vornaskotti.com/2010/07/15/into-the-zone-chernobyl-pripyat/&lt;br /&gt;
:http://www.nrc.gov/reading-rm/doc-collections/fzact-sheets/tritium-radiation-fs.html&lt;br /&gt;
:http://www.mext.go.jp/component/a_menu/other/detail/))icsFiles/afieldfile/20011/03/18/1303723_1716.pdf&lt;br /&gt;
:http://radiology.rnsa.org/content/248/1/254&lt;br /&gt;
&lt;br /&gt;
:Chart by Randal Munroe, with help from Ellen, Senior Reactor Operator at the Reed Research Reactor, who suggested the idea and provided a lot of the sources. I'm sure I've added in lots of mistakes; it's for general education only. If you're basing radiation safety procedures on an internet PNG image and things go wrong, you have no one to blame but yourself.&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:1487:_Tornado&amp;diff=84581</id>
		<title>Talk:1487: Tornado</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:1487:_Tornado&amp;diff=84581"/>
				<updated>2015-02-16T15:14:01Z</updated>
		
		<summary type="html">&lt;p&gt;ImVeryAngryItsNotButter: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Is there any point in including &amp;quot;like most amusement rides, it is for children&amp;quot;? I don't know about others but most of the amusement parks near me are for late teens-twenties. They all have a childrens section but it is pretty tiny. --[[Special:Contributions/173.245.56.202|173.245.56.202]] 14:29, 16 February 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
Are we sure this is cueball? it seems like it might be just a generic newscaster cartoon. &lt;br /&gt;
[[User:Reywas|Reywas]] ([[User talk:Reywas|talk]]) 07:41, 16 February 2015 (UTC)&lt;br /&gt;
: Cueball is not a character; it's a name given to any featureless stick figure in XKCD. [[User:ImVeryAngryItsNotButter|ImVeryAngryItsNotButter]] ([[User talk:ImVeryAngryItsNotButter|talk]]) 15:14, 16 February 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
Can a weather expert verify the claim that a tornado will destroy a merry-go-round? From what little I read and understood (Weather is confusing, and there was no graph!), a F0 or F1 tornado would not destroy it. From my estimations, a merry-go-round weighs 1350kg (2976.24054 lbs). Thanks, [[Special:Contributions/141.101.106.95|141.101.106.95]] 08:53, 16 February 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
Another type of &amp;quot;merry-go-round&amp;quot; is a very common playground device, much simpler than the type with seats or horses.  This https://smilekiddo.files.wordpress.com/2013/08/zipline_merry-go-round.jpg is what I envisioned from the comic, although it could refer to either type.  The freely-rotating small platform, usually with bars for children to hold onto while standing, and rotated merely by people-power, is probably the most common type of merry-go-round in the US.  They may weigh from 500 to 2000 lbs, or mass from about 15 to 60 slugs (I'll assume xkcd readers can convert to other mass units if desired.) [[User:Taibhse|Taibhse]] ([[User talk:Taibhse|talk]]) 09:24, 16 February 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
I think tornado can destroy the merry-go-round of either type and STILL make it a fun ride. The part of &amp;quot;no injuries&amp;quot; is the suspicious one. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 10:25, 16 February 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
Wait, what I got from this comic is the classical mass media sensationalism joke, there is no tornado, they simply invented one by taking a merry go round as one, that's why the victims say &amp;quot;Fun and Awesome&amp;quot;, they interviewed the kids as victims while they were just enjoying the ride. The title text does the same, with the difference they went further this time, as trying to pass a teacup ride as a multi-vortex tornado is even more hilarious. [[Special:Contributions/141.101.103.206|141.101.103.206]] 11:29, 16 February 2015 (UTC)&lt;/div&gt;</summary>
		<author><name>ImVeryAngryItsNotButter</name></author>	</entry>

	</feed>