explain xkcd - User contributions [en]

3004: Wells

2026-04-22T08:57:21Z

PaintspotInfez: /* Explanation */ Clarifed.

{{distinguish|561: Well|common=Wells}}
{{comic
| number = 3004
| date = October 28, 2024
| title = Wells
| image = wells_2x.png
| imagesize = 306x402px
| noexpand = true
| titletext = You do have to be careful, though--sometimes, instead of water, you hit this free fuel that you can sell for a lot of money instead.
}}

==Explanation==
Water is essential to life,{{cn}} and humans have long sought out places to get it. Freshwater surface sources like rivers and lakes most obviously dictate where people live, but are subject to changes of quantity and quality (e.g. the seasons/weather and what other people are doing with(/in) the water, upstream). Water can also be present beneath the surface in {{w|aquifer}}s, gradually having soaked through into various soil and/or rock layers, and may emerge (far more reliably and usably) from {{w|spring line settlement|handy seeps and springs}} where the local ground topology is favorable. But geology and geography don't coincide so usefully everywhere that someone requires water.

Many modern countries (and a number of historic ones) will have at least some ability to pipe water from areas of high availability (e.g. from areas with reservoirs, natural or constructed) to other places of higher consumption (towns and cities), but not everyone will have [[1599: Water Delivery|piped water]] and may find it better to rely upon a {{w|well}}, a hole dug into the ground, deep enough to reach the local water to lift or [[2963: House Inputs and Outputs|pump]] out as needed. A borehole is similar, but may even puncture impermeable bedrock to access water held (under significant pressure) in rock layers below.

This comic pokes fun of the seemingly improbable characteristics of wells and boreholes; talking about how water "randomly" forms below the surface of the ground and how they "magically" refill themselves. It also pokes fun at how unrealistic it seems for people to have come up with the concept of wells in the first place; people would have had to dig a hole and hope that water appears.

In reality the complex systems of the {{w|water cycle}} dictate the formation of the underground 'pools' that the wells take from and the seeps of underground water that supply them, meaning that it's not really so surprising (nor necessarily quite as simple as it sounds) to get your water from beneath the ground, and is a process {{w|Elephant#Behaviour and ecology|not restricted to humans}}. This theme of things that seem like they shouldn't work, but do, has also been used in [[2540: TTSLTSWBD]], [[2115: Plutonium]], and [[2775: Siphon]], among others.

The title text points out a possibility that sounds even ''more'' absurd when abstracted like this: the fact that you could find a highly-valuable resource instead (oil). In some cases, people intending to drill water wells instead found oil beds. Oil is a very valuable energy source, so they became [https://www.youtube.com/watch?v=kCfGVLKr5oM very wealthy as a result]. This is the source of the idiom "struck oil" to mean receiving a windfall as a result of a lucky occurrence. But you have to be careful — if you blindly "drink whatever you find at the bottom", as Megan says, you'll [https://www.merckmanuals.com/home/injuries-and-poisoning/poisoning/hydrocarbon-poisoning get very sick] if it's oil rather than water. Oil tends to be buried much deeper than water, but each has its own (different) prerequisites that don't make it equally likely to get either (or both) at any given spot. A [[1662: Jack and Jill|prior comic]] made some related points about ground-hydrology.

This comic bears similarity to a [https://web.archive.org/web/20250116002502/https://www.gocomics.com/calvinandhobbes/1993/06/11 Calvin and Hobbes comic from 1993], one Randall may have been aware of, that points out properties of a common drink that can appear disgusting when the underpinnings are known.

==Transcript==
:[Megan is standing on the left and facing Cueball on the right. Megan has her left palm raised.]
:Megan: I need water, so I think I'll dig a deep hole and drink whatever liquid I find at the bottom.
:Cueball: What will you do after you drink it all? Dig another hole?
:Megan: I dunno. Hopefully it magically refills itself or something.

:[Caption below the panel:]
:It's ridiculous that wells work.

{{comic discussion}}

[[Category:Comics featuring Megan]]
[[Category:Comics featuring Cueball]]
[[Category:Geology]]

3234: Europa Missions

2026-04-22T08:40:03Z

PaintspotInfez: /* Trivia */ Clarified.

{{comic
| number = 3234
| date = April 17, 2026
| title = Europa Missions
| image = europa_missions_2x.png
| imagesize = 515x274px
| noexpand = true
| titletext = Before resurfacing, they promise to inspect the ice for any evidence of hockey-playing life.
}}

==Explanation==
In recent years, multiple space agencies have sent spacecraft to observe Jupiter’s moon {{w|Europa (moon)|Europa}}. In part, this is because, according to {{w|NASA}}, the moon could be a candidate for life due to the presence of a subsurface ocean and (possibly) {{w|hydrothermal vents}}. The first two craft — the {{w|Europa Clipper}} and {{w|Jupiter Icy Moons Explorer}} (Juice), respectively — will investigate the ocean, topography and chemistry of the moon, to help in searching for signs of life. Europa's ocean is frozen on top — the whole surface being solid ice with no exposed liquid, except perhaps at the bottom of any transient deep crevasses — which is why it described as a "subsurface ocean".

A {{w|Zamboni}} is a vehicle that is meant to quickly resurface ice rinks that have been worn down — not a scientific mission or a transport for other scientific missions. The comic describes a non-existent spacecraft known as the ''Zamboni Voyager'', operated by the {{w|National Hockey League}} (NHL). The spacecraft is carrying a Zamboni because the NHL is trying to 'expand the league'. Normally, expanding a sports league would involve, at the very least, forming a new team in a city which did not have one. In this scenario, they appear to be more literally trying to expand the available space for play, by resurfacing Europa to make it viable for hockey-playing. (Although Europa is the {{w|Europa (moon)#Surface environment|smoothest known body}} in the solar system, it's probably not smooth enough for playing hockey. Yet.) Hockey in reduced gravity — Europa's gravity is less than 1/7 that of Earth — would be {{What If|124|an interesting idea}}.

The title text talks about finding hockey-playing life on Europa, which would be unlikely, as any life on Europa would exist underwater, where it's difficult to play hockey.{{cn}} In addition, any conceivable culture(s) there would almost certainly be extremely different from Earth's, so even if the lifeforms on Europa do have entertainment similar to sports, it's unlikely that they have even {{w|Convergent evolution|remotely similar}} rules or equipment. If, though, there were intelligent non-hockey-playing life on Europa, the NHL may consider them fair game as a virgin market for their product.

On top of that, making a spacecraft to send a Zamboni to Europa would be very difficult, as 14,000 m/s of delta-v (a measure of the total change in velocity required to transfer between orbital or 'ground' locations) is needed. With a typical Zamboni weighing five tons, a very heavy rocket would be needed. Europa clipper weighs about six tons, which is comparable to a heavy Zamboni. That particular spacecraft will not perform an orbital insertion or a landing, but only a fly-by to save fuel. Even then, it needs a fully expendable Falcon Heavy, the largest commercially available rocket (as of the comic being published), to achieve the fly-by. A landing would need much more available delta-v for the final approach.

If whoever was talking (e.g. NASA) tried to stop them, something like an SLS launch with more payload capacity may not even be possible. Even with an SLS, successfully achieving a propulsive landing would be very difficult, as demonstrated by {{w|IM-1}} and {{w|IM-2}}, which both failed to land on our own Moon. A normal Zamboni is probably not hardened against Jupiter’s intense radiation environment and, unless adapted for robotic remote control, the life support system for the operator would greatly increase the total weight of the mission. Also, the water in a Zamboni would freeze.

==Transcript==
:[Cueball's upper body is shown; he is in front of an image of a spacecraft.]
:Cueball: There are now three spacecraft headed to Europa:
:Cueball: NASA's ''Europa Clipper'', which investigate Europa's subsurface ocean,

:[In a longer shot, Cueball, Ponytail, and Hairy are all shown standing in front of another spacecraft image, with Cueball gesturing at it.]
:Cueball: ESA's ''Jupiter Icy Moons Explorer'', which will study the topography and chemistry of Europa and the other moons,

:[Another closeup on Cueball, who is in front of an image of a Zamboni with a firing rocket nozzle on its bottom.]
:Cueball: And the NHL's ''Zamboni Voyager'', which plans to resurface Europa.
:Voice out of frame: Oh no.
:Cueball: We tried to stop them, but the league is set on an expansion.

==Trivia==
* The [https://www.explainxkcd.com/wiki/images/archive/f/fd/20260418170145%21europa_missions_2x.png original version of the comic] incorrectly referred to the "Jupiter Icy Moons ''Orbiter''" rather than "Jupiter Icy Moons ''Explorer''."

* This comic was created at around the time of the start of the season's NHL playoffs.

* This comic was posted 10 days after April 7, 2026, a pivotal date in ''{{w|17776}}'' — a space-probe related and sports-related webcomic which features Jupiter Icy Moons Explorer ("Juice"), the space probe mentioned in this comic, as a main character. (While the webcomic began in 2017, it received another wave of popularity in the lead-up to April 7, 2026, the date on which humans stopped being born (and essentially stopped dying and aging) within the story's fiction.)

* Kerbal Space Program is a great way to learn the basics of orbital mechanics.

{{comic discussion}}<noinclude>

[[Category:Comics edited after their publication]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Hairy]]
[[Category:Space probes]]
[[Category:Sport]]

3234: Europa Missions

2026-04-22T08:38:04Z

PaintspotInfez: /* Trivia */ Timing.

{{comic
| number = 3234
| date = April 17, 2026
| title = Europa Missions
| image = europa_missions_2x.png
| imagesize = 515x274px
| noexpand = true
| titletext = Before resurfacing, they promise to inspect the ice for any evidence of hockey-playing life.
}}

==Explanation==
In recent years, multiple space agencies have sent spacecraft to observe Jupiter’s moon {{w|Europa (moon)|Europa}}. In part, this is because, according to {{w|NASA}}, the moon could be a candidate for life due to the presence of a subsurface ocean and (possibly) {{w|hydrothermal vents}}. The first two craft — the {{w|Europa Clipper}} and {{w|Jupiter Icy Moons Explorer}} (Juice), respectively — will investigate the ocean, topography and chemistry of the moon, to help in searching for signs of life. Europa's ocean is frozen on top — the whole surface being solid ice with no exposed liquid, except perhaps at the bottom of any transient deep crevasses — which is why it described as a "subsurface ocean".

A {{w|Zamboni}} is a vehicle that is meant to quickly resurface ice rinks that have been worn down — not a scientific mission or a transport for other scientific missions. The comic describes a non-existent spacecraft known as the ''Zamboni Voyager'', operated by the {{w|National Hockey League}} (NHL). The spacecraft is carrying a Zamboni because the NHL is trying to 'expand the league'. Normally, expanding a sports league would involve, at the very least, forming a new team in a city which did not have one. In this scenario, they appear to be more literally trying to expand the available space for play, by resurfacing Europa to make it viable for hockey-playing. (Although Europa is the {{w|Europa (moon)#Surface environment|smoothest known body}} in the solar system, it's probably not smooth enough for playing hockey. Yet.) Hockey in reduced gravity — Europa's gravity is less than 1/7 that of Earth — would be {{What If|124|an interesting idea}}.

The title text talks about finding hockey-playing life on Europa, which would be unlikely, as any life on Europa would exist underwater, where it's difficult to play hockey.{{cn}} In addition, any conceivable culture(s) there would almost certainly be extremely different from Earth's, so even if the lifeforms on Europa do have entertainment similar to sports, it's unlikely that they have even {{w|Convergent evolution|remotely similar}} rules or equipment. If, though, there were intelligent non-hockey-playing life on Europa, the NHL may consider them fair game as a virgin market for their product.

On top of that, making a spacecraft to send a Zamboni to Europa would be very difficult, as 14,000 m/s of delta-v (a measure of the total change in velocity required to transfer between orbital or 'ground' locations) is needed. With a typical Zamboni weighing five tons, a very heavy rocket would be needed. Europa clipper weighs about six tons, which is comparable to a heavy Zamboni. That particular spacecraft will not perform an orbital insertion or a landing, but only a fly-by to save fuel. Even then, it needs a fully expendable Falcon Heavy, the largest commercially available rocket (as of the comic being published), to achieve the fly-by. A landing would need much more available delta-v for the final approach.

If whoever was talking (e.g. NASA) tried to stop them, something like an SLS launch with more payload capacity may not even be possible. Even with an SLS, successfully achieving a propulsive landing would be very difficult, as demonstrated by {{w|IM-1}} and {{w|IM-2}}, which both failed to land on our own Moon. A normal Zamboni is probably not hardened against Jupiter’s intense radiation environment and, unless adapted for robotic remote control, the life support system for the operator would greatly increase the total weight of the mission. Also, the water in a Zamboni would freeze.

==Transcript==
:[Cueball's upper body is shown; he is in front of an image of a spacecraft.]
:Cueball: There are now three spacecraft headed to Europa:
:Cueball: NASA's ''Europa Clipper'', which investigate Europa's subsurface ocean,

:[In a longer shot, Cueball, Ponytail, and Hairy are all shown standing in front of another spacecraft image, with Cueball gesturing at it.]
:Cueball: ESA's ''Jupiter Icy Moons Explorer'', which will study the topography and chemistry of Europa and the other moons,

:[Another closeup on Cueball, who is in front of an image of a Zamboni with a firing rocket nozzle on its bottom.]
:Cueball: And the NHL's ''Zamboni Voyager'', which plans to resurface Europa.
:Voice out of frame: Oh no.
:Cueball: We tried to stop them, but the league is set on an expansion.

==Trivia==
* The [https://www.explainxkcd.com/wiki/images/archive/f/fd/20260418170145%21europa_missions_2x.png original version of the comic] incorrectly referred to the "Jupiter Icy Moons ''Orbiter''" rather than "Jupiter Icy Moons ''Explorer''."

* This comic was created at around the time of the start of the season's NHL playoffs.

* This comic was posted 10 days after April 7, 2026, a pivotal date (on which humans stopped being born, and essentially stopped dying and aging) within the fiction of ''{{w|17776}}'' — a space-probe related and sports-related webcomic which features Jupiter Icy Moons Explorer ("Juice"), the space probe mentioned in this comic, as a main character.

* Kerbal Space Program is a great way to learn the basics of orbital mechanics.

{{comic discussion}}<noinclude>

[[Category:Comics edited after their publication]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Hairy]]
[[Category:Space probes]]
[[Category:Sport]]

3234: Europa Missions

2026-04-22T08:34:36Z

PaintspotInfez: /* Trivia */ Timing.

{{comic
| number = 3234
| date = April 17, 2026
| title = Europa Missions
| image = europa_missions_2x.png
| imagesize = 515x274px
| noexpand = true
| titletext = Before resurfacing, they promise to inspect the ice for any evidence of hockey-playing life.
}}

==Explanation==
In recent years, multiple space agencies have sent spacecraft to observe Jupiter’s moon {{w|Europa (moon)|Europa}}. In part, this is because, according to {{w|NASA}}, the moon could be a candidate for life due to the presence of a subsurface ocean and (possibly) {{w|hydrothermal vents}}. The first two craft — the {{w|Europa Clipper}} and {{w|Jupiter Icy Moons Explorer}} (Juice), respectively — will investigate the ocean, topography and chemistry of the moon, to help in searching for signs of life. Europa's ocean is frozen on top — the whole surface being solid ice with no exposed liquid, except perhaps at the bottom of any transient deep crevasses — which is why it described as a "subsurface ocean".

A {{w|Zamboni}} is a vehicle that is meant to quickly resurface ice rinks that have been worn down — not a scientific mission or a transport for other scientific missions. The comic describes a non-existent spacecraft known as the ''Zamboni Voyager'', operated by the {{w|National Hockey League}} (NHL). The spacecraft is carrying a Zamboni because the NHL is trying to 'expand the league'. Normally, expanding a sports league would involve, at the very least, forming a new team in a city which did not have one. In this scenario, they appear to be more literally trying to expand the available space for play, by resurfacing Europa to make it viable for hockey-playing. (Although Europa is the {{w|Europa (moon)#Surface environment|smoothest known body}} in the solar system, it's probably not smooth enough for playing hockey. Yet.) Hockey in reduced gravity — Europa's gravity is less than 1/7 that of Earth — would be {{What If|124|an interesting idea}}.

The title text talks about finding hockey-playing life on Europa, which would be unlikely, as any life on Europa would exist underwater, where it's difficult to play hockey.{{cn}} In addition, any conceivable culture(s) there would almost certainly be extremely different from Earth's, so even if the lifeforms on Europa do have entertainment similar to sports, it's unlikely that they have even {{w|Convergent evolution|remotely similar}} rules or equipment. If, though, there were intelligent non-hockey-playing life on Europa, the NHL may consider them fair game as a virgin market for their product.

On top of that, making a spacecraft to send a Zamboni to Europa would be very difficult, as 14,000 m/s of delta-v (a measure of the total change in velocity required to transfer between orbital or 'ground' locations) is needed. With a typical Zamboni weighing five tons, a very heavy rocket would be needed. Europa clipper weighs about six tons, which is comparable to a heavy Zamboni. That particular spacecraft will not perform an orbital insertion or a landing, but only a fly-by to save fuel. Even then, it needs a fully expendable Falcon Heavy, the largest commercially available rocket (as of the comic being published), to achieve the fly-by. A landing would need much more available delta-v for the final approach.

If whoever was talking (e.g. NASA) tried to stop them, something like an SLS launch with more payload capacity may not even be possible. Even with an SLS, successfully achieving a propulsive landing would be very difficult, as demonstrated by {{w|IM-1}} and {{w|IM-2}}, which both failed to land on our own Moon. A normal Zamboni is probably not hardened against Jupiter’s intense radiation environment and, unless adapted for robotic remote control, the life support system for the operator would greatly increase the total weight of the mission. Also, the water in a Zamboni would freeze.

==Transcript==
:[Cueball's upper body is shown; he is in front of an image of a spacecraft.]
:Cueball: There are now three spacecraft headed to Europa:
:Cueball: NASA's ''Europa Clipper'', which investigate Europa's subsurface ocean,

:[In a longer shot, Cueball, Ponytail, and Hairy are all shown standing in front of another spacecraft image, with Cueball gesturing at it.]
:Cueball: ESA's ''Jupiter Icy Moons Explorer'', which will study the topography and chemistry of Europa and the other moons,

:[Another closeup on Cueball, who is in front of an image of a Zamboni with a firing rocket nozzle on its bottom.]
:Cueball: And the NHL's ''Zamboni Voyager'', which plans to resurface Europa.
:Voice out of frame: Oh no.
:Cueball: We tried to stop them, but the league is set on an expansion.

==Trivia==
* The [https://www.explainxkcd.com/wiki/images/archive/f/fd/20260418170145%21europa_missions_2x.png original version of the comic] incorrectly referred to the "Jupiter Icy Moons ''Orbiter''" rather than "Jupiter Icy Moons ''Explorer''."

* This comic was created at around the time of the start of the season's NHL playoffs.

* Kerbal Space Program is a great way to learn the basics of orbital mechanics.

* This comic was posted 10 days after April 7, 2026, the date on which humans stop dying, aging, or being born in ''{{w|17776}}'' — a space-probe related and sports-related webcomic which features the real-life space probe mentioned in this comic, Jupiter Icy Moons Explorer ("Juice"), as a main character.

{{comic discussion}}<noinclude>

[[Category:Comics edited after their publication]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Hairy]]
[[Category:Space probes]]
[[Category:Sport]]

1333: First Date

2026-04-08T00:39:57Z

PaintspotInfez: /* Explanation */ Glass.

{{comic
| number = 1333
| date = February 21, 2014
| title = First Date
| image = first_date.png
| titletext = I sympathize with the TPP protagonist because I, too, have progressed through a surprising number of stages of life despite spending entire days stuck against simple obstacles.
}}

==Explanation==
TPP, or {{w|Twitch Plays Pokémon}}, was the first of a creative and radical new variant of streaming gameplay videos created in early 2014 — a few days before this comic was released.

Some people enjoy watching video games being played by other people (usually 'popular' gamers known for entertaining gameplay), thus streaming sites dedicated to streaming gameplay were created. [http://twitch.tv/ Twitch.tv] was one such site.

Whereas traditional video game streams involved the channel broadcaster or another personality playing the game, the channel "Twitch Plays Pokémon" recorded a {{w|Internet bot|bot}} playing an emulated game of [http://bulbapedia.bulbagarden.net/wiki/Pok%C3%A9mon_Red_and_Blue_Versions Pokémon Red] for {{w|Game Boy}}. The game inputs given by the bot were based on players' messages in the video stream itself. Thus, the watchers of the stream were playing the game themselves using chat "commands." The Pokémon character behaved incredibly erratically, frequently getting "stuck against simple obstacles" (as mentioned in the title-text) and moving about in a strange manner ("Why are you up there?"/"Bye...Okay, coming back now").

Despite this, the character advanced surprisingly far in games. They have beaten the [http://bulbapedia.bulbagarden.net/wiki/Elite_Four Elite Four] and [http://bulbapedia.bulbagarden.net/wiki/Pok%C3%A9mon_Champion Champion] of generations [http://bulbapedia.bulbagarden.net/wiki/Generation_I I], [http://bulbapedia.bulbagarden.net/wiki/Generation_II II], [http://bulbapedia.bulbagarden.net/wiki/Generation_III III], [http://bulbapedia.bulbagarden.net/wiki/Generation_IV IV], [http://bulbapedia.bulbagarden.net/wiki/Generation_V V], and [http://bulbapedia.bulbagarden.net/wiki/Generation_VI VI]. Twitch Plays Pokémon has also completed various {{w|ROM hacking|ROM hacks}} and {{w|Spin-off (media)|Spin-off}} titles, establishing a seasonal format with multiple games each season. You can see the state of the player characters' Pokémon and inventory at game end in [http://bulbapedia.bulbagarden.net/wiki/Twitch_Plays_Pok%C3%A9mon this Bulbapedia article].

TPP surged in popularity rapidly since its inception, reaching 80,000 channel viewers within five days. Derivative channels (such as 'TwitchPlayers') soon arose, turning "Twitch Plays..." into an idea rather than a single channel; that of crowdsourcing a task, such as controlling a single person (as in the Pokémon games) for erratic and often hilarious results. The stream, which is still active as of this writing, has reached [http://knowyourmeme.com/memes/events/twitch-plays-pokemon memetic status].

In the above comic, [[Cueball]] and [[Megan]] are on a date. However, Megan is behaving very erratically. Cueball determines that Megan is being "controlled by Twitch," as her behavior matches well with that of the TPP protagonist (whose name, canonically, is [http://bulbapedia.bulbagarden.net/wiki/Red_(game) Red]).

Megan loudly declares at one point that she is "SAVING" her 'game progress', referencing the incessant saving in TPP via random button presses. The random ten-letter string she says is reminiscent of the [http://bulbapedia.bulbagarden.net/wiki/Nickname nicknames] that all of TPP's Pokémon end up with as the players move haphazardly across the game's keyboard.

Her fascination with the "cool spiral" is an allusion to TPP players' fascination with the [http://bulbapedia.bulbagarden.net/wiki/Dome_and_Helix_Fossils Helix Fossil], an in-game item. As user input often leads to checking of the in-game backpack followed by erratic commands to handle the items within, it was common for various valuable items to be haphazardly thrown away. However, as the Helix Fossil was a [http://bulbapedia.bulbagarden.net/wiki/Key_item key item], it could not be tossed. It was also the first item in the Bag due to this, leading to the players' continuously selecting it whenever accessing their Bag, eventually causing them to somewhat jokingly regard it as an object of religious reverence. "Check out this cool..." is also a phrase used in various XKCD comics, such as [[2703: Paper Title]], typically in a tongue-in-cheek context.

Additionally, Cueball's glass (presumably filled with wine) is significantly emptier in the third panel onwards, implying that (wihle Megan was away) Cueball presumably felt the need to drink to get through this date.

The title text, as explained above, simply is a light-hearted joke from [[Randall]], empathizing with TPP as he has also spent real-life days stuck against simple obstacles, and is surprised by how far he has gotten in life despite this fact.

==Transcript==
:[Cueball and Megan sit at an intimate dinner table. They have plates and glasses of wine in front of them.]
:Cueball: So, did you grow up around here?
:Megan: I love you.
:Cueball: ... huh?
:Megan: Waiter! One of everything on the menu.

:[Megan stands up. Standing on her chair, holding a plate.]
:Cueball: Why are you up there?
:Megan: I'm stuck.
:Megan: This plate looks delicious.
:Megan: Aaaoogaoag.

:[Megan has put the plate down and walked off-panel. Subtly, Cueball's glass is significantly emptier.]
:Megan: Bye.
:Megan: OK. Coming back now.

:[Megan is crouched on her chair, holding a spiral.]
:Cueball: You're being controlled by Twitch, aren't you?
:Megan: Check out this cool spiral!
:Cueball: It's—
:Megan: <big><big>'''SAVING.'''</big></big>

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Internet]]
[[Category:Pokémon]]

1333: First Date

2026-04-08T00:36:54Z

PaintspotInfez: /* Transcript */ Note.

{{comic
| number = 1333
| date = February 21, 2014
| title = First Date
| image = first_date.png
| titletext = I sympathize with the TPP protagonist because I, too, have progressed through a surprising number of stages of life despite spending entire days stuck against simple obstacles.
}}

==Explanation==
TPP, or {{w|Twitch Plays Pokémon}}, was the first of a creative and radical new variant of streaming gameplay videos created in early 2014 — a few days before this comic was released.

Some people enjoy watching video games being played by other people (usually 'popular' gamers known for entertaining gameplay), thus streaming sites dedicated to streaming gameplay were created. [http://twitch.tv/ Twitch.tv] was one such site.

Whereas traditional video game streams involved the channel broadcaster or another personality playing the game, the channel "Twitch Plays Pokémon" recorded a {{w|Internet bot|bot}} playing an emulated game of [http://bulbapedia.bulbagarden.net/wiki/Pok%C3%A9mon_Red_and_Blue_Versions Pokémon Red] for {{w|Game Boy}}. The game inputs given by the bot were based on players' messages in the video stream itself. Thus, the watchers of the stream were playing the game themselves using chat "commands." The Pokémon character behaved incredibly erratically, frequently getting "stuck against simple obstacles" (as mentioned in the title-text) and moving about in a strange manner ("Why are you up there?"/"Bye...Okay, coming back now").

Despite this, the character advanced surprisingly far in games. They have beaten the [http://bulbapedia.bulbagarden.net/wiki/Elite_Four Elite Four] and [http://bulbapedia.bulbagarden.net/wiki/Pok%C3%A9mon_Champion Champion] of generations [http://bulbapedia.bulbagarden.net/wiki/Generation_I I], [http://bulbapedia.bulbagarden.net/wiki/Generation_II II], [http://bulbapedia.bulbagarden.net/wiki/Generation_III III], [http://bulbapedia.bulbagarden.net/wiki/Generation_IV IV], [http://bulbapedia.bulbagarden.net/wiki/Generation_V V], and [http://bulbapedia.bulbagarden.net/wiki/Generation_VI VI]. Twitch Plays Pokémon has also completed various {{w|ROM hacking|ROM hacks}} and {{w|Spin-off (media)|Spin-off}} titles, establishing a seasonal format with multiple games each season. You can see the state of the player characters' Pokémon and inventory at game end in [http://bulbapedia.bulbagarden.net/wiki/Twitch_Plays_Pok%C3%A9mon this Bulbapedia article].

TPP surged in popularity rapidly since its inception, reaching 80,000 channel viewers within five days. Derivative channels (such as 'TwitchPlayers') soon arose, turning "Twitch Plays..." into an idea rather than a single channel; that of crowdsourcing a task, such as controlling a single person (as in the Pokémon games) for erratic and often hilarious results. The stream, which is still active as of this writing, has reached [http://knowyourmeme.com/memes/events/twitch-plays-pokemon memetic status].

In the above comic, [[Cueball]] and [[Megan]] are on a date. However, Megan is behaving very erratically. Cueball determines that Megan is being "controlled by Twitch," as her behavior matches well with that of the TPP protagonist (whose name, canonically, is [http://bulbapedia.bulbagarden.net/wiki/Red_(game) Red]).

Megan loudly declares at one point that she is "SAVING" her 'game progress', referencing the incessant saving in TPP via random button presses. The random ten-letter string she says is reminiscent of the [http://bulbapedia.bulbagarden.net/wiki/Nickname nicknames] that all of TPP's Pokémon end up with as the players move haphazardly across the game's keyboard.

Her fascination with the "cool spiral" is an allusion to TPP players' fascination with the [http://bulbapedia.bulbagarden.net/wiki/Dome_and_Helix_Fossils Helix Fossil], an in-game item. As user input often leads to checking of the in-game backpack followed by erratic commands to handle the items within, it was common for various valuable items to be haphazardly thrown away. However, as the Helix Fossil was a [http://bulbapedia.bulbagarden.net/wiki/Key_item key item], it could not be tossed. It was also the first item in the Bag due to this, leading to the players' continuously selecting it whenever accessing their Bag, eventually causing them to somewhat jokingly regard it as an object of religious reverence. "Check out this cool..." is also a phrase used in various XKCD comics, such as [[2703: Paper Title]], typically in a tongue-in-cheek context.

The title text, as explained above, simply is a light-hearted joke from [[Randall]], empathizing with TPP as he has also spent real-life days stuck against simple obstacles, and is surprised by how far he has gotten in life despite this fact.

==Transcript==
:[Cueball and Megan sit at an intimate dinner table. They have plates and glasses of wine in front of them.]
:Cueball: So, did you grow up around here?
:Megan: I love you.
:Cueball: ... huh?
:Megan: Waiter! One of everything on the menu.

:[Megan stands up. Standing on her chair, holding a plate.]
:Cueball: Why are you up there?
:Megan: I'm stuck.
:Megan: This plate looks delicious.
:Megan: Aaaoogaoag.

:[Megan has put the plate down and walked off-panel. Subtly, Cueball's glass is significantly emptier.]
:Megan: Bye.
:Megan: OK. Coming back now.

:[Megan is crouched on her chair, holding a spiral.]
:Cueball: You're being controlled by Twitch, aren't you?
:Megan: Check out this cool spiral!
:Cueball: It's—
:Megan: <big><big>'''SAVING.'''</big></big>

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Internet]]
[[Category:Pokémon]]

75: Curse Levels

2026-04-08T00:05:33Z

PaintspotInfez: /* Explanation */ Other than slurs.

{{comic
| number = 75
| date = March 13, 2006
| title = Curse Levels
| image = curse levels.jpg
| titletext = I find so much fun in language.
}}

==Explanation==
This is the fourth comic in the [[:Category:My Hobby|My Hobby series]]. Curse words (aka: swear words/profanities) are disrespectful words that are typically impolite to use in public. As noted in the strip, there are "levels" of curse words ranging from those "mild" words that are more acceptable to use, to those "severe" words that are considered very impolite (the milder curse words can be used on network television in the US, for example, while severe ones can not). One usually uses milder cursing because either they personally don't feel comfortable using the more severe words, or because it would not be appropriate in the context (such as on network television, in the presence of children, etc). Thus, mixing mild and severe curses in one usage does not usually occur, as the effect achieved by keeping the one curse word mild is negated by using another that is severe.

In a mild curse, "gosh-darned" is typically used as a {{w|minced oath}} of "God-damned" when the latter would be inappropriate. This is mixed with "{{w|cunt}}" — a vulgar term for the female genitalia, considered the most offensive non-slur swear word in many English-speaking countries.

==Transcript==
:My hobby: mixing curse levels
:Cueball: What a gosh-darned cunt.

{{Comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:My Hobby]]
[[Category:Language]]
[[Category:Comics with lowercase text]]

3175: Website Task Flowchart

2026-04-08T00:02:45Z

PaintspotInfez: /* Explanation */ +1.

{{comic
| number = 3175
| date = December 1, 2025
| title = Website Task Flowchart
| image = website_task_flowchart_2x.png
| imagesize = 333x683px
| noexpand = true
| titletext = Tired of waiting on hold? Use our website to chat with one of our live agents, who are available to produce words at you 24/7!
}}

==Explanation==
This is a flowchart comic. It ostensibly shows how to accomplish a task on a generic website. With the improvements to web infrastructure, {{w|accessibility}}, and {{w|user experience}} research over the decades, one might think that this would be simple. And sometimes, indeed, everything just works as expected. However, the flowchart indicates that this system often fails to handle error states gracefully and can {{wiktionary|a chain is only as strong as its weakest link|completely shut down}} when the smallest [[2347: Dependency|dependency]] breaks.

The first step is to try to access the website. This includes {{w|Loading (computing)|pulling it up}}, and possibly {{w|Login|signing into an account}}. Websites may have legitimate or [[792: Password Reuse|nefarious]] reasons to profile their users. Either way, it is often another step in the way of the user's goals.

The very start of the process can already fail if the website doesn't load, you enter an incorrect username or password, or the website's {{w|authentication}} service is having problems and rejecting legitimate credentials, for example. Issues at this stage are often out of the user's control, and can kneecap your productivity if you rely on that website, as was recently discussed in [[3170: Service Outage]]. The flowchart provides no specific {{w|troubleshooting}} guidance, as the exact steps will vary greatly depending on the specific problem, and readers may have their own troubleshooting process similar to [[627: Tech Support Cheat Sheet]]. It could involve visiting another website like "[https://www.isitdownrightnow.com Is It Down Right Now?]" to see if others are having the same issue, double-checking your login information, or looking up any specific error messages the site gives. You may simply have to wait until the broken service is restored.

If you can enter the website, the next part of the flowchart asks if you finished your task successfully. If you have managed to both log in and do your work (perhaps eventually), it simply congratulates you for finishing your task. Failure here could be because of other issues with the website, such as {{w|Software bug|bugs}}, or [[3170: Service Outage|service outages]] in the middle of your work, or simply because the site doesn't have the tools to accomplish your specific task. You may have to use tools that ''are'' available in alternative or creative ways to accomplish what you need to. This might not be an option if your data or workflow relies on a specific site, or if alternatives are sketchy or paywalled.

As the flowchart suggests, troubleshooting a website can be a major deviation from your goals, and can involve following many false leads for hours on end. There's a chance that the issue resolves, putting you back on track. But in the meantime, you're trying to find a solution on your own. According to the chart, talking to tech support is a last resort.

If your troubleshooting fails at either stage, the chart guides you to call the website's {{w|customer service}} line, which is framed as admitting defeat. The flowchart reckons that an {{w|Automated attendant|automated}} phone system will put you {{w|Hold (telephone)|on hold}} and a {{w|On hold messaging|prerecorded message}} will then suggest trying to use the website ''instead'' of calling directly. While this would be helpful for someone calling the support line ''before'' trying the website, it assumes that the site is working properly and that the task can actually be accomplished there. It's like kicking you when you're already down to hear that "advice" after spending hours trying to use a website that simply would not work like you need it to. (Additionally, the voice reading out the website's URL is reading out the "www." before the URL, which is usually unnecessary in the modern day, possibly implying that the voice on the other end belongs to someone who's slightly technologically inept.)

From there, the flowchart predicts that you will be so frustrated, you'll throw away both your computer and your phone into the sea before even listening to the rest of the on-hold message. This would be a drastic and non-trivial way of responding to the situation, as it would destroy those devices. (It would, at least, formally end your attempt to use the website.) The flowchart presents this as an inevitability as a form of {{w|hyperbole}}.

The title text is another part of the presumed hold message, perhaps for anyone who had not followed the flowchart as faithfully. It encourages the caller to visit the website's {{w|live chat}} function, a fairly recent development that combines the best and worst aspects of both online and phone-line support. It can be ambiguous whether the "live agent" is zero, one, or many people. You may reach a qualified staff member with all the answers to your questions; or, the conversation may be passed around between various less-than-knowledgeable staff who are merely following a ''script'' with a flowchart process (hopefully more useful than this one) to let them give more expert advice than they might be capable of; or, increasingly, you may connect to a {{w|chatbot}} that processes your queries, follows a similar script, and may be more difficult to reason with or escalate the issue. It may {{wiktionary|triage}} your initial responses before 'bothering' a real human who can help you with your request, if it is able to transfer you to a human at all.

The claim that the agent can "produce words at you" (rather than "talk", "speak", or "communicate") implies that their responses won't convey any information, or perhaps even basic understanding of the problem. If the live chat is open 24/7, you may reach a human agent elsewhere in the world who {{w|English as a second or foreign language|doesn't speak English natively}} and struggles to understand you. This could also be a blatantly honest admission that you will converse with a potentially inexhaustible {{w|large language model}} AI, where the words you receive might demonstrate {{w|Markov chain|even less understanding}} of your problem, as merely being able to send even [[1068: Swiftkey|vaguely logical sequences of words]] might be worse than useless. Additionally, giving random vague sequences of words would add to the user's frustration, strengthening their urge to throw their laptop into the ocean.

==Transcript==
[Caption above the panel:]
Doing a task using a company or organization's website:

[Below this is a flowchart, starting with "Go to website, try to log in"]

[Box 1 (start):] Go to website, try to log in (go to to box 2)

[Box 2:] Did it work? (Yes/No)
*Yes: Go to box 3
*No: Go to box 6

[Box 3:] Try to do your task (go to box 4)

[Box 4:] Did it work? (Yes/No)
*Yes: Go to box 5
*No: Go to box 8

[Box 5 (end):] Nice! Done!

[Box 6:] Spend hours troubleshooting account/login (go to box 7)

[Box 7:] Did it work? (Yes/No)
*Yes: Go to box 3
*No: Go to box 10

[Box 8:] Spend hours troubleshooting website (go to box 9)

[Box 9:] Did it work? (Yes/No)
*Yes: Go to box 5
*No: Go to box 10

[Box 10:] Give up and call customer service (go to box 11)

[Box 11:] Hold message: "Did you know you could do all of this more quickly and easily on our website? Just go to W-W-W dot..." (go to box 12)

[Box 12 (end):] Throw phone and laptop into the sea
{{comic discussion}}

[[Category:Flowcharts]]
[[Category:Internet]]

2996: CIDABM

2026-04-07T01:27:17Z

PaintspotInfez: /* Explanation */ lands.

{{comic
| number = 2996
| date = October 9, 2024
| title = CIDABM
| image = cidabm_2x.png
| imagesize = 423x480px
| noexpand = true
| titletext = There's a heated debate over whether the big island of Tierra del Fuego should qualify for membership.
}}

==Explanation==
This is one of the [[:Category:News|News]] comics, delivering geopolitical news.

The comic parodies intergovernmental cooperations, such as the {{w|G7}} "group of seven" (Canada, France, Germany, Italy, Japan, the United Kingdom and the United States) or the {{w|BRICS}} group (originally '''B'''razil, '''R'''ussia, '''I'''ndia and '''C'''hina, with '''S'''outh Africa soon after rounding off the acronym before further nations attained membership). Such treaties, and other more casual associations between nations, can be based upon some close association in geographical, political, cultural and/or economic terms (or even, in some cases, by little more than sharing a common opposition to a ''different'' {{w|Trade bloc|bloc}} of nations).

The "CIDABM" group, named for the very specific membership criteria, has been formed on a rather more abstract basis than most geographically-focused groupings (e.g. {{w|NATO}} or the {{w|Pacific Islands Forum}}) and (currently) consists of four otherwise disparate islands:
*{{w|Sicily}} is an autonomous region of {{w|Italy}}, which is on the south eastern edge of the {{w|Eurasia}}n mainland.
*{{w|Sri Lanka}} is a nation in its own right, south of {{w|India}}, which is on the southern edge of the Eurasian mainland.
*{{w|Hainan}} is a province of {{w|China}}, which is on the south eastern edge of the Eurasian mainland.
*{{w|Tasmania}} is a state of the nation of {{w|Australia}}, south of the eastern side of {{w|Australia (continent)|continental Australia}} mainland.

These four islands 'dangle below' their mainlands only because of the convention of having north at the top of maps. If the mapmaking convention had instead been to have south at the top, the islands might have been described as floating above their continents. Conversely, {{w|Madagascar}}, {{w|Newfoundland (island)|Newfoundland}} or {{w|Adelaide Island}} might have been applicable members of similar 'dangling' alliances where the basic premise might come from one or other different map orientations.

The big island of Tierra del Fuego ({{w|Isla Grande de Tierra del Fuego}}), mentioned in the title text, is off the southern tip of the {{w|Chile}}an mainland (as well as a small bit of {{w|Argentina}}). Unlike the others in the comic, it doesn't prominently 'dangle' south of a mainland: it has narrow channels separating its northern and northwestern sides from the mainland, and other parts of the {{w|Tierra del Fuego}} archipelago surround its southwestern side and make it appear well-connected to the mainland. In addition, it isn't a single political entity: the island is split between Chile to the west and Argentina to the east. The 'heated debate' mentioned in the title text may be a play on ''Tierra del Fuego'' being Spanish for ''Land of Fire''.

While the banner on stage depicts each of the islands with approximately the same size, Tasmania (68,400 km²) and Sri Lanka (65,600 km²) are much larger than Hainan (35,200 km²) and Sicily (25,800 km²). Isla Grande de Tierra del Fuego is in the middle sizewise (48,000 km²).

Here is a list of islands that clearly do not belong to this club:
*{{w|Corsica}} (8,700 km², south of France's mainland) but clearly not dangling beneath the tip of a land mass like Sicily but on the side of Italy.
*{{w|Cyprus}} (9,300 km², south of Turkey) but also to the west of Syria thus not dangling beneath a land mass.
*{{w|Kyushu}} (36,800 km²) and {{w|Shikoku}} (18,800 km²) that are very close and south of the Japanese mainland of Honshu but this is an island state so island beneath island kind of makes no sense here.
*The same problem with {{w|Stewart Island}}/Rakiura (1,746 km²), which dangles south of the South Island of New Zealand again an island state so island beneath island kind of makes no sense here.
*The {{w|Isle of Wight}} (merely 380 km²) is not really beneath the UK as part of the mainland goes more to the south and again an island state so island beneath island kind of makes no sense here.
*{{w|Gotland}} (3,200 km²) and {{w|Long Island}} (3,600 km²) are even smaller and, like {{w|Taiwan}} (36,200 km²), are not even close to being south of their respective mainlands.
*{{w|Cuba}} (105,800 km²) which "dangles" south of Florida seems to also not quite fit the theme as it is much larger and longer than the part that is "dangles" beneath and thus would not be considered dangling from Florida, rather supporting Florida.
*{{w|Sumatra}} (482,300 km²), is not dangling south of the Malay peninsula as it goes much higher up and is also much larger than the part of the mainland it should dangle beneath so makes no sense to look as it as dangling.

==Transcript==
:[A banner hangs at the top of the frame with a large acronym written above four map segments. The map segments show a landmass in grey with an island at the bottom drawn in black. Beneath the banner are four people. Hairbun and Cueball to the left are shaking hands while looking at each other, Megan is looking towards the unseen crowd, arms spread out, and Hairy to the right is waving with one arm.]
:Banner: C.I.D.A.B.M.

:[Caption below the panel:]
:Geopolitical news: Sicily, Sri Lanka, Hainan, and Tasmania have joined together to form the Coalition of Islands that Dangle Awkwardly from the Bottom of a Mainland.

{{comic discussion}}

[[Category:News]]
[[Category:Comics featuring Hairbun]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Hairy]]
[[Category:Geography]]
[[Category:Maps]]

1653: United States Map

2026-04-07T00:15:27Z

PaintspotInfez: /* Table */ no spce

{{comic
| number = 1653
| date = March 9, 2016
| title = United States Map
| image = united_states_map.png
| titletext = It would be pretty unfair to give to someone a blank version of this map as a 'how many states can you name?' quiz. (If you include Alaska and Hawaii, you should swap the Aleutian Islands with the Hawaiian ones.)
}}

==Explanation==
The comic is a map with the (rough) outline of the {{w|Contiguous United States|mainland}} of the {{w|United States of America}}. At first it looks like the real map, but actually all the states have been shuffled around in it. It seems that [[Randall]] took all of the states (minus {{w|Alaska}} and {{w|Hawaii}}, the two states that are not part of this map and are only mentioned in the title text, see below), and then reassembled them in the style of a jigsaw puzzle, with the end result being a map with a similar outline to the original [https://upload.wikimedia.org/wikipedia/commons/d/d5/National-atlas-blank-state-outlines.png unaltered mainland state map]. They can thus be reassembled into the real map as can be seen [http://www.explainxkcd.com/wiki/images/8/88/1653-rearranged.png here] (see also the [[#Trivia|trivia section]]).

Previously Randall has played with the shapes of the United States in [[1079: United Shapes]]. In that map he did two separate drawings for {{w|Michigan}} with a mitten in the {{w|Lower Peninsula of Michigan|lower part}} and an eagle in the {{w|Upper Peninsula of Michigan|upper part}}. Once again in this version he has split Michigan in two, the lower main part, the mitten just labeled ''Michigan'', is on the west coast on part of {{w|California|California's}} location, but the upper part is located on the east coast over {{w|New York|New York's}} location and has been labeled ''MI (upper)''. So even without Hawaii and Alaska, there are 49 "states" in this map, consisting of 47 states plus the two halves of Michigan. In the [[#Table|table]] below all 49 states in the map have been listed to indicate where the puzzle pieces have been moved to.

It seems at a first glance that the names have been written on the states as they would appear in a normal map, and that they have all then been rotated with the rotation of the states. But this is not the case for all states. For instance it seems like {{w|Utah}} has hardly been moved at all, and with the name written normally this may be intentionally to deceive the readers. Because Utah has been turned upside down, and according to how for instance {{w|Texas}}, clearly turned upside down, has its name written upside down as well, Utah should thus also have been written like that.

California has only been pushed down the length of the west border of the US (and thus rotated accordingly) so the top part still overlaps with the bottom part California, but also covers the bottom part of {{w|Arizona}} and {{w|New Mexico}}. Other states that likewise haven't been moved a lot include {{w|Maine}} which has only been rolled left (i.e. turned upside down) to just outside its normal position. {{w|Colorado}} has been moved up a state to where {{w|Wyoming}} usually is, and Wyoming has then just been shifted right, still covering part of its original position. But both have been turned 90 degrees, whichever way would be impossible to say for these rectangular states, but the text, if you dare believe in that, seems to indicate they have been turned counter clockwise. {{w|Wisconsin}} has only been shifted down below its usual position but then turned upside down.

The title text mentions how it would be unfair to use a [http://i.imgur.com/Mvi8j9s.jpg blank version] of this shuffled-up map as a quiz for knowledge of U.S. geography (the link is to such a map created by a user of this site); most people recognize states primarily by their relative locations, not their shape (and especially not their shape after being rotated). It also suggests a corresponding mean trick to play if you include Alaska and Hawaii, which are not present in the comic itself, namely to interchange the volcanic island of Hawaii (consisting of 8 main islands and hundreds of smaller ones) with those of the {{w|Aleutian Islands}}, also a chain of volcanic islands (14 large and 55 small) that partly belongs to the US and partly to Russia. The island extends from the {{w|Alaska Peninsula}}. It would thus be possible to even make it difficult to correctly name these last two states, even though it would be obvious to begin with that it must be the two not belonging to the mainland.

===Table===
This table lists all states in the order of the transcript, but it can be sorted alphabetically. Its purpose is twofold: to list the rotation of the state compared to the real orientation of the state in the real world map, and to list which state/states the states, in this comics map, have been moved over/inside.
{| class="wikitable sortable"
|-
! State
! Rotation
! Moved to
! Explanation
|-
! {{w|Ohio}}
| Upside down
| Washington
|
|-
! {{w|Georgia (U.S. state)|Georgia}}
| Upside down
| Oregon
|
|-
! {{w|Lower Peninsula of Michigan|Michigan (lower part)}} (as {{w|Michigan}})
| Upside down
| Northern California
| Michigan is the only state split in two, as it is also split in two peninsulas in real life. In real life these two parts lie very close on the shores of the {{w|Great Lakes region|Great Lakes}}, and not as here, with one on each coast of the US. But at least they still both lie on a shore.
|-
! {{w|Maryland}} (as MD)
| Upside down
| Central California (Southern Bay Area)
|
|-
! {{w|California}}
| Rotated counter clockwise
| Southern California, Southern Arizona, Southern New Mexico
|
|-
! {{w|Kansas}}
| Upside down
| Eastern Washington, Northern Idaho, Western Montana
|
|-
! {{w|Pennsylvania}}
| Rotated clockwise
| Eastern Oregon, Idaho
|
|-
! {{w|Oklahoma}}
| Rotated clockwise
| Idaho, Montana
|
|-
! {{w|New Mexico}}
| None
| Nevada, Northern California
|
|-
! {{w|Nebraska}}
| Upside down
| Northern New Mexico, Northern Arizona
|
|-
! {{w|South Dakota}}
| None
| Montana
|
|-
! {{w|Colorado}}
| Rotated clockwise
| Western Wyoming
|
|-
! {{w|Wyoming}}
| Rotated counter clockwise
| Eastern Wyoming
| Stays mostly in place.
|-
! {{w|Utah}}
| Upside down
| Utah, Northern Arizona
| The text has been written upside down on the state, so in a correct map using this state the text would be upside down. Only other state this has happened with is Montana. Stays mostly in place.
|-
! {{w|Alabama}}
| None
| Western Colorado
|
|-
! {{w|Massachusetts}} (as MA)
| Rotated counter clockwise
| Central New Mexico
|
|-
! {{w|Virginia}}
| Rotated counter clockwise
| Western New Mexico
|
|-
! {{w|Arizona}}
| Rotated counter clockwise
| North Dakota
|
|-
! {{w|Washington (state)|Washington}}
| Rotated counter clockwise
| Western Iowa, Eastern South Dakota, Eastern Nebraska
|
|-
! {{w|Montana}}
| Rotated counter clockwise
| Colorado, New Mexico and Texas
| The text has been written upside down on the state, so in a correct map using this state the text would be upside down. Only other state this has happened with is Utah.
|-
! {{w|New York}}
| None
| Westernmost tip of Texas
| Missing Long Island.
|-
! {{w|Minnesota}}
| Upside down
| Minnesota
| Stays mostly in place.
Horribly deformed, especially on the eastern border.
|-
! {{w|Texas}}
| Upside down
| Missouri, Arkansas, Western Kansas, Iowa, Southern Illinois
|
|-
! {{w|Connecticut}} (as CT)
| Rotated clockwise
| Texas and New Mexico border
|
|-
! {{w|Mississippi}} (as Missi-ssippi)
| Rotated clockwise
| Texas and Oklahoma border
|
|-
! {{w|Nevada}}
| None
| South Western Texas
|
|-
! {{w|Idaho}}
| Rotated clockwise
| Eastern Texas, Southern Louisiana
|
|-
! {{w|South Carolina}}
| Rotated counter clockwise
| Southernmost Texas
|
|-
! {{w|Missouri}}
| Upside down
| Eastern Minnesota, Northern Wisconsin, Michigan's upper peninsula, Lake Superior
|
|-
! {{w|Wisconsin}}
| Upside down
| Illinois
| Very deformed, loses its Western indentation
|-
! {{w|Kentucky }}
| Rotated clockwise
| Western Wisconsin, Western Illinois
|
|-
! {{w|North Dakota}}
| Rotated clockwise
| Mississippi
|
|-
! {{w|Florida}}
| Rotated counter clockwise
| Southern Michigan, Northern Ohio
|
|-
! {{w|North Carolina}}
| Rotated clockwise
| Southern Michigan, Eastern Indiana
| Missing Outer Banks.
|-
! {{w|Indiana}}
| None
| Alabama
|
|-
! {{w|Rhode Island}} (as RI)
| Unclear rotation, perhaps counter clockwise
| Louisiana (New Orleans area)
|
|-
! {{w|Oregon}}
| Rotated clockwise
| Ohio, West Virginia
|
|-
! {{w|Iowa}}
| None
| Western North Carolina, South Carolina
|
|-
! {{w|Tennessee}}
| Upside down
| Northern Florida (Panhandle), Southern Alabama, Southern Georgia
|
|-
! {{w|Illinois}}
| None
| Florida
|
|-
! {{w|Maine}}
| Upside down
| Northern New York, Vermont
|
|-
! {{w|New Hampshire}} (as NH)
| None
| Western Pennsylvania
|
|-
! {{w|Lower Peninsula of Michigan|Michigan (upper part)}} (as MI (upper))
| Rotated 45 degree counter clockwise
| Pennsylvania and New York
| Michigan is the only state split in two, as it is also split in two peninsulas in real life. In real life these two parts lie very close on the shores of the {{w|Great Lakes region|Great Lakes}}, and not as here, with one at each coast of the US. But at least they still both lie on a shore.
|-
! {{w|Arkansas}}
| None
| Eastern Maryland, Eastern Virginia
|
|-
! {{w|New Jersey}} (as NJ)
| None
| Eastern South Carolina
|
|-
! {{w|Louisiana}}
| Rotated counter clockwise
| Vermont, New Hampshire, Maine
|
|-
! {{w|West Virginia}}
| Rotated 45 degree clockwise
| Connecticut, Rhode Island, Massachusetts
|
|-
! {{w|Delaware}} (as DE)
| Rotated counter clockwise
| New York (Long Island)
|
|-
! {{w|Vermont}} (as VT)
| Upside down
| Either New Jersey or Delaware (unclear)
|
|}

==Transcript==
:[A white map with an outline that closely resembles that of the mainland of the United States of America with gray all around the black border. But on closer inspection most of the states do not look right. The 48 mainland states are all there, however, with their name or abbreviations written on them as a label in gray text. But they have all been shuffled around and then reassembled as a jigsaw puzzle in the same shape as USA. The name labels for most of the states have been rotated, often to follow the new rotation of the state in the map. So some are written upside down or have been rotated 90 degrees clockwise or counter clockwise or even somewhere in between. One state, Michigan, has even been split up in two so there are 49 instead of 48 labels. For the states that have been named only with state abbreviations the full name is written in brackets behind the transcript of the abbreviation. Here below all the states are listed approximately in columns going from the top left and down and then moving right to the next column across the map. Any rotation of the text from normal is noted in brackets behind the name.]
:Ohio [Upside down]
:Georgia [Upside down]
:Michigan [Upside down – but only bottom part]
:MD [Upside down - Maryland]
:California [Text not rotated, but state is rotated counter-clockwise]
:Kansas [Upside down]
:Pennsylvania [Rotated clockwise]
:Oklahoma [Rotated clockwise]
:New Mexico
:Nebraska [Upside down]
:South Dakota
:Colorado [Rotated counter clockwise]
:Wyoming [Rotated counter clockwise]
:Utah [Text normal, but state is upside down, i.e. the text is upside down in the state]
:Alabama
:MA [Rotated counter clockwise – Massachusetts]
:Virginia [Rotated counter clockwise]
:Arizona [Rotated counter clockwise]
:Washington [Rotated counter clockwise]
:Montana [Rotated clockwise - but the state is rotated counter clockwise, i.e. the text is upside down in the state]
:New York
:Minnesota [Upside down]
:Texas [Upside down]
:CT [Rotated clockwise –Connecticut]
:Missi-
::ssippi [Rotated clockwise - text split with hyphen]
:Nevada
:Idaho [Rotated clockwise]
:South Carolina [Rotated counter clockwise, by more than 90 degrees, but the state is rotated exactly 90 degrees]
:Missouri [Upside down]
:Wisconsin [Upside down]
:Kentucky [Rotated clockwise]
:North Dakota [Rotated clockwise]
:Florida [Rotated counter clockwise, by more than 90 degrees, but the state is rotated exactly 90 degrees]
:North Carolina [Rotated clockwise]
:Indiana
:RI [Label below in the ocean –Rhode Island]
:Oregon [Rotated clockwise]
:Iowa
:Tennessee [Upside down]
:Illinois
:Maine [Upside down]
:NH [New Hampshire]
:MI (upper) [Rotated 45 degree counter clockwise – Michigan but only upper part]
:Arkansas
:NJ [New Jersey]
:Louisiana [Rotated 45 degree counter clockwise - but the state is rotated exactly 90 degrees]
:West Virginia [Rotated 45 degree clockwise]
:DE [Rotated counter clockwise – label to the right in the ocean – Delaware]
:VT [Upside down –Vermont]

==Trivia==
*Here the pieces have been shifted around:
[[File:1653-rearranged.png]]
*And this [http://i.imgur.com/dsLPc4s.png opposite map] shows to what extend the states fit in Randall's layout when using the real borders.
*Using two A3 printouts of both the [https://upload.wikimedia.org/wikipedia/commons/d/d5/National-atlas-blank-state-outlines.png real map] from Wikipedia and this comic, is approximately the same scale it was possible to reassemble US putting the states in their correct place.
**The result displayed surprisingly accurate drawings of the states, although it is clear that on the borders between states that are not drawn by a ruler, they cannot be correct for both states in all cases.
**From this map it becomes clear that not only Utah but also Montana has the text written upside down according to the correct position of the state. The former could have followed the rules of other inverted states, and having been inverted ''only'' in the rearrangement. The latter is sideways (as rearranged), with no apparent rotation convention amongst other sideways-aligned state labels, so could easily have been turned 180°. With all other states generally conforming to real-world expectations (or, having enough rotational symmetry to be ambiguously correct), the conclusion may therefore be that the intention was to represent a re-arrangement of a correctly labeled correct map, but these particular exceptions were (trivial) errors in the process of creation.
[[File:1653_United_States_Map_49_piece_jigsaw_solved.jpg]]
*This comic may be an input to the way the {{w|voting districts}} in the US are so random that you can not guess where your vote will count.
**In this video ''[https://www.youtube.com/watch?v=90RajY2nrgk Electoral College Ruins Democracy]'' (by {{w|Adam Ruins Everything}} from November 2015), a map of the US is split up, much like this comic has done.
***In this case though the states do not move to a new location, but rather move apart to show the size of the state depending on how much your vote would count.
***The video is about how the {{w|Electoral College (United States)|Electoral College}} is assembled in order to elect the President and Vice President of the United States.
**At the time of this comics release (2016-03-09) the {{w|United States presidential primary}} elections to determine the candidates for the {{w|United States presidential election, 2016}} was in full progress and not at all determined yet.
* This raises an interesting math problem: How many colors (see the four color theorem) are needed to color the normal US map and the xkcd map so that the states under the same name should be in the same color (e. g. the two Washingtons should be in the same color. The four Michigans should also be in the same color. However, the North Dakota and South Dakota are considered different.) while different states that share borders on either map should be in different colors? (Detail needed)

{{comic discussion}}
[[Category:US maps]]

1653: United States Map

2026-04-07T00:14:44Z

PaintspotInfez: /* Explanation */ have.

{{comic
| number = 1653
| date = March 9, 2016
| title = United States Map
| image = united_states_map.png
| titletext = It would be pretty unfair to give to someone a blank version of this map as a 'how many states can you name?' quiz. (If you include Alaska and Hawaii, you should swap the Aleutian Islands with the Hawaiian ones.)
}}

==Explanation==
The comic is a map with the (rough) outline of the {{w|Contiguous United States|mainland}} of the {{w|United States of America}}. At first it looks like the real map, but actually all the states have been shuffled around in it. It seems that [[Randall]] took all of the states (minus {{w|Alaska}} and {{w|Hawaii}}, the two states that are not part of this map and are only mentioned in the title text, see below), and then reassembled them in the style of a jigsaw puzzle, with the end result being a map with a similar outline to the original [https://upload.wikimedia.org/wikipedia/commons/d/d5/National-atlas-blank-state-outlines.png unaltered mainland state map]. They can thus be reassembled into the real map as can be seen [http://www.explainxkcd.com/wiki/images/8/88/1653-rearranged.png here] (see also the [[#Trivia|trivia section]]).

Previously Randall has played with the shapes of the United States in [[1079: United Shapes]]. In that map he did two separate drawings for {{w|Michigan}} with a mitten in the {{w|Lower Peninsula of Michigan|lower part}} and an eagle in the {{w|Upper Peninsula of Michigan|upper part}}. Once again in this version he has split Michigan in two, the lower main part, the mitten just labeled ''Michigan'', is on the west coast on part of {{w|California|California's}} location, but the upper part is located on the east coast over {{w|New York|New York's}} location and has been labeled ''MI (upper)''. So even without Hawaii and Alaska, there are 49 "states" in this map, consisting of 47 states plus the two halves of Michigan. In the [[#Table|table]] below all 49 states in the map have been listed to indicate where the puzzle pieces have been moved to.

It seems at a first glance that the names have been written on the states as they would appear in a normal map, and that they have all then been rotated with the rotation of the states. But this is not the case for all states. For instance it seems like {{w|Utah}} has hardly been moved at all, and with the name written normally this may be intentionally to deceive the readers. Because Utah has been turned upside down, and according to how for instance {{w|Texas}}, clearly turned upside down, has its name written upside down as well, Utah should thus also have been written like that.

California has only been pushed down the length of the west border of the US (and thus rotated accordingly) so the top part still overlaps with the bottom part California, but also covers the bottom part of {{w|Arizona}} and {{w|New Mexico}}. Other states that likewise haven't been moved a lot include {{w|Maine}} which has only been rolled left (i.e. turned upside down) to just outside its normal position. {{w|Colorado}} has been moved up a state to where {{w|Wyoming}} usually is, and Wyoming has then just been shifted right, still covering part of its original position. But both have been turned 90 degrees, whichever way would be impossible to say for these rectangular states, but the text, if you dare believe in that, seems to indicate they have been turned counter clockwise. {{w|Wisconsin}} has only been shifted down below its usual position but then turned upside down.

The title text mentions how it would be unfair to use a [http://i.imgur.com/Mvi8j9s.jpg blank version] of this shuffled-up map as a quiz for knowledge of U.S. geography (the link is to such a map created by a user of this site); most people recognize states primarily by their relative locations, not their shape (and especially not their shape after being rotated). It also suggests a corresponding mean trick to play if you include Alaska and Hawaii, which are not present in the comic itself, namely to interchange the volcanic island of Hawaii (consisting of 8 main islands and hundreds of smaller ones) with those of the {{w|Aleutian Islands}}, also a chain of volcanic islands (14 large and 55 small) that partly belongs to the US and partly to Russia. The island extends from the {{w|Alaska Peninsula}}. It would thus be possible to even make it difficult to correctly name these last two states, even though it would be obvious to begin with that it must be the two not belonging to the mainland.

===Table===
This table lists all states in the order of the transcript, but it can be sorted alphabetically. Its purpose is twofold: to list the rotation of the state compared to the real orientation of the state in the real world map, and to list which state/states the states, in this comics map, have been moved over/inside.
{| class="wikitable sortable"
|-
! State
! Rotation
! Moved to
! Explanation
|-
! {{w|Ohio}}
| Upside down
| Washington
|
|-
! {{w|Georgia (U.S. state)|Georgia}}
| Upside down
| Oregon
|
|-
! {{w|Lower Peninsula of Michigan|Michigan (lower part)}} (as {{w|Michigan}})
| Upside down
| Northern California
| Michigan is the only state split in two, as it is also split in two peninsulas in real life. In real life these two parts lie very close on the shores of the {{w|Great Lakes region|Great Lakes}}, and not as here, with one on each coast of the US. But at least they still both lie on a shore.
|-
! {{w|Maryland}} (as MD)
| Upside down
| Central California (Southern Bay Area)
|
|-
! {{w|California}}
| Rotated counter clockwise
| Southern California, Southern Arizona, Southern New Mexico
|
|-
! {{w|Kansas}}
| Upside down
| Eastern Washington, Northern Idaho, Western Montana
|
|-
! {{w|Pennsylvania}}
| Rotated clockwise
| Eastern Oregon, Idaho
|
|-
! {{w|Oklahoma}}
| Rotated clockwise
| Idaho, Montana
|
|-
! {{w|New Mexico}}
| None
| Nevada, Northern California
|
|-
! {{w|Nebraska}}
| Upside down
| Northern New Mexico, Northern Arizona
|
|-
! {{w|South Dakota}}
| None
| Montana
|
|-
! {{w|Colorado}}
| Rotated clockwise
| Western Wyoming
|
|-
! {{w|Wyoming}}
| Rotated counter clockwise
| Eastern Wyoming
| Stays mostly in place.
|-
! {{w|Utah}}
| Upside down
| Utah, Northern Arizona
| The text has been written upside down on the state, so in a correct map using this state the text would be upside down. Only other state this has happened with is Montana. Stays mostly in place.
|-
! {{w|Alabama}}
| None
| Western Colorado
|
|-
! {{w|Massachusetts}} (as MA)
| Rotated counter clockwise
| Central New Mexico
|
|-
! {{w|Virginia}}
| Rotated counter clockwise
| Western New Mexico
|
|-
! {{w|Arizona}}
| Rotated counter clockwise
| North Dakota
|
|-
! {{w|Washington (state)|Washington}}
| Rotated counter clockwise
| Western Iowa, Eastern South Dakota, Eastern Nebraska
|
|-
! {{w|Montana}}
| Rotated counter clockwise
| Colorado, New Mexico and Texas
| The text has been written upside down on the state, so in a correct map using this state the text would be upside down. Only other state this has happened with is Utah.
|-
! {{w|New York}}
| None
| Westernmost tip of Texas
| Missing Long Island.
|-
! {{w|Minnesota}}
| Upside down
| Minnesota
| Stays mostly in place.
Horribly deformed, especially on the eastern border.
|-
! {{w|Texas}}
| Upside down
| Missouri, Arkansas, Western Kansas, Iowa, Southern Illinois
|
|-
! {{w|Connecticut}} (as CT)
| Rotated clockwise
| Texas and New Mexico border
|
|-
! {{w|Mississippi}} (as Missi-ssippi)
| Rotated clockwise
| Texas and Oklahoma border
|
|-
! {{w|Nevada}}
| None
| South Western Texas
|
|-
! {{w|Idaho}}
| Rotated clockwise
| Eastern Texas, Southern Louisiana
|
|-
! {{w|South Carolina}}
| Rotated counter clockwise
| Southernmost Texas
|
|-
! {{w|Missouri}}
| Upside down
| Eastern Minnesota, Northern Wisconsin, Michigan's upper peninsula, Lake Superior
|
|-
! {{w|Wisconsin}}
| Upside down
| Illinois
| Very deformed, loses its Western indentation
|-
! {{w|Kentucky }}
| Rotated clockwise
| Western Wisconsin, Western Illinois
|
|-
! {{w|North Dakota}}
| Rotated clockwise
| Mississippi
|
|-
! {{w|Florida}}
| Rotated counter clockwise
| Southern Michigan, Northern Ohio
|
|-
! {{w|North Carolina}}
| Rotated clockwise
| Southern Michigan, Eastern Indiana
| Missing Outer Banks.
|-
! {{w|Indiana}}
| None
| Alabama
|
|-
! {{w|Rhode Island}} (as RI )
| Unclear rotation, perhaps counter clockwise
| Louisiana (New Orleans area)
|
|-
! {{w|Oregon}}
| Rotated clockwise
| Ohio, West Virginia
|
|-
! {{w|Iowa}}
| None
| Western North Carolina, South Carolina
|
|-
! {{w|Tennessee}}
| Upside down
| Northern Florida (Panhandle), Southern Alabama, Southern Georgia
|
|-
! {{w|Illinois}}
| None
| Florida
|
|-
! {{w|Maine}}
| Upside down
| Northern New York, Vermont
|
|-
! {{w|New Hampshire}} (as NH)
| None
| Western Pennsylvania
|
|-
! {{w|Lower Peninsula of Michigan|Michigan (upper part)}} (as MI (upper))
| Rotated 45 degree counter clockwise
| Pennsylvania and New York
| Michigan is the only state split in two, as it is also split in two peninsulas in real life. In real life these two parts lie very close on the shores of the {{w|Great Lakes region|Great Lakes}}, and not as here, with one at each coast of the US. But at least they still both lie on a shore.
|-
! {{w|Arkansas}}
| None
| Eastern Maryland, Eastern Virginia
|
|-
! {{w|New Jersey}} (as NJ)
| None
| Eastern South Carolina
|
|-
! {{w|Louisiana}}
| Rotated counter clockwise
| Vermont, New Hampshire, Maine
|
|-
! {{w|West Virginia}}
| Rotated 45 degree clockwise
| Connecticut, Rhode Island, Massachusetts
|
|-
! {{w|Delaware}} (as DE)
| Rotated counter clockwise
| New York (Long Island)
|
|-
! {{w|Vermont}} (as VT)
| Upside down
| Either New Jersey or Delaware (unclear)
|
|}

==Transcript==
:[A white map with an outline that closely resembles that of the mainland of the United States of America with gray all around the black border. But on closer inspection most of the states do not look right. The 48 mainland states are all there, however, with their name or abbreviations written on them as a label in gray text. But they have all been shuffled around and then reassembled as a jigsaw puzzle in the same shape as USA. The name labels for most of the states have been rotated, often to follow the new rotation of the state in the map. So some are written upside down or have been rotated 90 degrees clockwise or counter clockwise or even somewhere in between. One state, Michigan, has even been split up in two so there are 49 instead of 48 labels. For the states that have been named only with state abbreviations the full name is written in brackets behind the transcript of the abbreviation. Here below all the states are listed approximately in columns going from the top left and down and then moving right to the next column across the map. Any rotation of the text from normal is noted in brackets behind the name.]
:Ohio [Upside down]
:Georgia [Upside down]
:Michigan [Upside down – but only bottom part]
:MD [Upside down - Maryland]
:California [Text not rotated, but state is rotated counter-clockwise]
:Kansas [Upside down]
:Pennsylvania [Rotated clockwise]
:Oklahoma [Rotated clockwise]
:New Mexico
:Nebraska [Upside down]
:South Dakota
:Colorado [Rotated counter clockwise]
:Wyoming [Rotated counter clockwise]
:Utah [Text normal, but state is upside down, i.e. the text is upside down in the state]
:Alabama
:MA [Rotated counter clockwise – Massachusetts]
:Virginia [Rotated counter clockwise]
:Arizona [Rotated counter clockwise]
:Washington [Rotated counter clockwise]
:Montana [Rotated clockwise - but the state is rotated counter clockwise, i.e. the text is upside down in the state]
:New York
:Minnesota [Upside down]
:Texas [Upside down]
:CT [Rotated clockwise –Connecticut]
:Missi-
::ssippi [Rotated clockwise - text split with hyphen]
:Nevada
:Idaho [Rotated clockwise]
:South Carolina [Rotated counter clockwise, by more than 90 degrees, but the state is rotated exactly 90 degrees]
:Missouri [Upside down]
:Wisconsin [Upside down]
:Kentucky [Rotated clockwise]
:North Dakota [Rotated clockwise]
:Florida [Rotated counter clockwise, by more than 90 degrees, but the state is rotated exactly 90 degrees]
:North Carolina [Rotated clockwise]
:Indiana
:RI [Label below in the ocean –Rhode Island]
:Oregon [Rotated clockwise]
:Iowa
:Tennessee [Upside down]
:Illinois
:Maine [Upside down]
:NH [New Hampshire]
:MI (upper) [Rotated 45 degree counter clockwise – Michigan but only upper part]
:Arkansas
:NJ [New Jersey]
:Louisiana [Rotated 45 degree counter clockwise - but the state is rotated exactly 90 degrees]
:West Virginia [Rotated 45 degree clockwise]
:DE [Rotated counter clockwise – label to the right in the ocean – Delaware]
:VT [Upside down –Vermont]

==Trivia==
*Here the pieces have been shifted around:
[[File:1653-rearranged.png]]
*And this [http://i.imgur.com/dsLPc4s.png opposite map] shows to what extend the states fit in Randall's layout when using the real borders.
*Using two A3 printouts of both the [https://upload.wikimedia.org/wikipedia/commons/d/d5/National-atlas-blank-state-outlines.png real map] from Wikipedia and this comic, is approximately the same scale it was possible to reassemble US putting the states in their correct place.
**The result displayed surprisingly accurate drawings of the states, although it is clear that on the borders between states that are not drawn by a ruler, they cannot be correct for both states in all cases.
**From this map it becomes clear that not only Utah but also Montana has the text written upside down according to the correct position of the state. The former could have followed the rules of other inverted states, and having been inverted ''only'' in the rearrangement. The latter is sideways (as rearranged), with no apparent rotation convention amongst other sideways-aligned state labels, so could easily have been turned 180°. With all other states generally conforming to real-world expectations (or, having enough rotational symmetry to be ambiguously correct), the conclusion may therefore be that the intention was to represent a re-arrangement of a correctly labeled correct map, but these particular exceptions were (trivial) errors in the process of creation.
[[File:1653_United_States_Map_49_piece_jigsaw_solved.jpg]]
*This comic may be an input to the way the {{w|voting districts}} in the US are so random that you can not guess where your vote will count.
**In this video ''[https://www.youtube.com/watch?v=90RajY2nrgk Electoral College Ruins Democracy]'' (by {{w|Adam Ruins Everything}} from November 2015), a map of the US is split up, much like this comic has done.
***In this case though the states do not move to a new location, but rather move apart to show the size of the state depending on how much your vote would count.
***The video is about how the {{w|Electoral College (United States)|Electoral College}} is assembled in order to elect the President and Vice President of the United States.
**At the time of this comics release (2016-03-09) the {{w|United States presidential primary}} elections to determine the candidates for the {{w|United States presidential election, 2016}} was in full progress and not at all determined yet.
* This raises an interesting math problem: How many colors (see the four color theorem) are needed to color the normal US map and the xkcd map so that the states under the same name should be in the same color (e. g. the two Washingtons should be in the same color. The four Michigans should also be in the same color. However, the North Dakota and South Dakota are considered different.) while different states that share borders on either map should be in different colors? (Detail needed)

{{comic discussion}}
[[Category:US maps]]

2868: Label the States

2026-04-06T23:49:20Z

PaintspotInfez: /* Transcript */ Missing.

{{comic
| number = 2868
| date = December 15, 2023
| title = Label the States
| image = label_the_states_2x.png
| imagesize = 740x500px
| noexpand = true
| titletext = Even with a blank map, a lot of people can only name 45-50 of the 64 states.
}}

==Explanation==
[[File:label the states 2x highlighted.png|thumb|301px|The map with the extra states highlighted.]]
[[File:Blank US Map (white on gray and black).svg|thumb|301px|A real map of the United States for comparison.]]
This is a blank map of the United States. At first glance, it looks correct, because all the large states with distinct shapes are correctly represented, but some states have been added. For example:

* On the west coast, Washington, Oregon, and California all have their normal shapes, but there is a new rectangular state south of Oregon and north of California.
* East of this, two more nearly rectangular states have been added between Idaho, Wyoming, Nevada, and Utah.
* A column of five rectangular states has been inserted between Montana/Wyoming/Utah/Arizona and the Dakotas/Nebraska/Colorado/New Mexico.
* Another somewhat rectangular state has been added between South Dakota and Nebraska.
* Ohio and Indiana have been narrowed with a new state being created between them.
* New states shaped like Arkansas, Tennessee, and North Carolina have been added directly south of those states.
* New Hampshire now has a state that looks like its reflection between itself and Maine.

In summary, a (disjointed) row and a whole (slightly staggered) column of states have been added, and two new states have been added between Indiana and Ohio and between New Hampshire and Maine. The external shape of the United States ends up slightly modified to accommodate the new states with generic coastlines or borders contrived to resemble or reflect the actual adjacent ones, at least to the casual glance, as also with the new internal borderlines. As the title text says, there are now 64 states on Randall's map, not 50.

In comic [[2394: Contiguous 41 States]] (with label), the opposite has been done, removing states so that there are 41 states instead of 50 or 64.

The title text comments on the cliché that Americans are bad at civics and geography, parodying comments that Americans cannot name many of the US states. A statistic is mentioned saying that most people can only name 45-50 states, which is almost all of the actual states, but looks poor in comparison to the 64 states in the comic's map. Since the extra fourteen states are made up and do not have names,{{cn}} people will not be able to name them and get a perfect 64/64 score. The cliché is also parodied in [[850|850: World According to Americans]].

Being mean to people by asking them to name states on bad maps was also mentioned in the title text of [[1653: United States Map]].

==Transcript==
{{incomplete transcript|Missing descriptions of literally any of the locations or details of the 14 additional states.}}
:Geography Challenge: Can you label all the states?

:[An unlabeled map of the United States, but instead of 50 states, there are borders for 64.]

{{comic discussion}}

[[Category:US maps]]

2653: Omnitaur

2025-12-23T22:38:56Z

PaintspotInfez: /* Explanation */ The obvious.

{{comic
| number = 2653
| date = August 1, 2022
| title = Omnitaur
| image = omnitaur.png
| titletext = "My parents were both omnitaurs, which is how I got interested in recombination," said the normal human.
}}

==Explanation==

Omnitaur is an {{w|anagram}} of {{w|minotaur}}, a mythical creature that was part man, part bull. "{{wiktionary|Omni}}-" is a prefix that means "all" that is, for instance, known from the word {{w|omnivore}}, meaning 'all eating' as compared to {{w|carnivore}} or {{w|herbivore}} — only eating meat or plant respectively. Given the combination of animals used to create the omnitaur, it could be expected that it was also an omnivore. The "-taur" part often means "bull," but it also appears in "{{w|centaur}}" via Latin from Greek ''kentauros'' (the name for a Thessalonian tribe of expert horsemen), meaning a different mythical creature which has the upper body of a human and the lower body and legs of a horse. So "-taur" could here be used to mean any creature made up of parts of different animals. An "omnitaur" would suggest that it would encompass all real and mythical creatures, or perhaps some random assortment of such. In this instance, it appears to be a hybrid, or {{w|Chimera (genetics)|genetic chimera}}, combined from eleven different creatures: {{w|fish}}, {{w|lion}}, {{w|snake}}, {{w|shark}}, {{w|bull}}, {{w|dragon}} (a mythical and often chimeric creature in its own right), {{w|horse}}, {{w|leopard}}, {{w|Sheep|ram}} (male sheep), {{w|human}} and {{w|bird}}.

Chimerism is not uncommon at the genetic level; for example, humans have about 145 genes (out of around 30,000) originating from bacteria, other single-celled organisms, and viruses.[https://www.science.org/content/article/humans-may-harbor-more-100-genes-other-organisms] {{w|Mitochondria}}, the powerhouses of the cell, were originally chimeric bacterial {{w|symbiosis|symbionts}}. But chimeras of larger organisms are rare, usually involving fraternal twins whose {{w|zygote}}s, {{w|blastocyst}}s, or {{w|embryo}}s combined, as in {{w|conjoined twins}}, but resulting in less distinct {{w|phenotype|phenotypical}} expression. Artificial human chimeras with viruses, mice, pigs, and monkeys have been the subject of ethics controversies in recent years.[https://www.theguardian.com/technology/2019/aug/11/the-five-chimeras-human-monkey-hybrid-genetic][https://jme.bmj.com/content/45/7/440.abstract] [https://journals.biologists.com/dev/article/148/12/dev195792/269139/The-road-to-generating-transplantable-organs-from Interspecies blastocyst complementation,] used to create human chimera organs and cell lines in other animals, is usually limited to combining two organisms into one whose offspring are not hybridized if they are even viable, and usually without human {{w|germline}}s or reproductive organs (or human central nervous systems, assuaging a major ethical concern).

The title text is a comment by a human whose parents were both omnitaurs. It would be funny that such parents would not produce offspring that were also omnitaurs. It suggests that this may be the result of {{w|genetic recombination}}, which is the exchange of genetic material between different organisms, most often two parents, leading to offspring with combinations of traits that differ from those found in either parent. In this case, they inherited ''only'' the human elements of each parent, apparently sufficient to develop into a whole human with no missing or chimeric elements. Both omnitaur parents likely had human germlines and compatible reproductive organs. Since the example depicted seems to be only 1/11 human, the odds of two parents as mentioned in the title text having fully human offspring would simplistically appear to be (1/11)11, or one chance in 285 billion. In reality, each physical part could not be the result of an equal recombinant genetic contribution, because the eleven animal chromosomes vary widely in number and size. Moreover, chimeras composed of multiple animals do not have chimeric children, because even with multiple sets of reproductive organs, the germlines are not combined.{{Actual citation needed}} Additionally, the title text may be a reference to the semi-jocular fantasy character concept of a normal-looking human with a minotaur and merfolk as parents who "inhabited the human half of both".

===Chimeras in folklore===
In addition to the minotaur and centaur, many other potential inspirations can be found in mythology, like the {{w|manticore}}, with a body of a lion and human face; a {{w|griffin}}, with a lion's body and a eagle's head; a {{w|mermaid}}, with a lower body of a fish and upper body of a human; a {{w|Hippocampus (mythology)|hippocampus}}, with the upper body of a horse and a lower body of a fish; a {{w|qilin}}, with a body that resembles both a horse and a dragon; or the mythological {{w|chimera (mythology)|chimera}}, for which the genetic chimera is named, which has lion, snake, and goat body parts. Ultimately, there are {{w|List of hybrid creatures in folklore|lots of hybrid creatures in mythology}} with {{w|phenotype}}s combined from multiple animals. Usually, genetic hybridization produces much more smoothly blended phenotypes instead of dividing the body into large distinctly chimeric regions, although {{w|Mosaic (genetics)|mosaicism}} of fur, skin or {{w|Heterochromia iridum|eyes}} can produce notable differences of hue or shade.

In {{w|C. S. Lewis}}' {{w|The Chronicles of Narnia}}, the {{w|Magical_creatures_in_The_Chronicles_of_Narnia#Centaurs|centaurs}} are described as eating two meals — a huge roast meal "to satisfy the man stomach," and a meal of grass, "to satisfy the horse stomach," making it take quite some time for them to eat every morning. Since the omnitaur also has herbivore, carnivore, and omnivore parts, this could further support the supposition that it is an omnivore, and it may similarly need multiple stomachs for these multiple appetites. It is unclear how compatible the various diets of its components would be (not least because 'fish,' 'snake' and 'bird' are quite unspecific, and it's hard to know what a dragon would eat) but it would likely need several meals, taking even longer to eat than the centaur (plus the bird beak may slow the process down quite a bit). In any case, a chimera of both {{w|endotherm|warm-}} and {{w|ectotherm|cold-blooded}} organisms seems unlikely to be viable,{{cn}} even at the organ level, let alone with combined surface phenotypes.

Dragons in Chinese folklore are often chimeras, [https://www.worldhistory.org/article/1125/the-dragon-in-ancient-china/ described for example] as having, "the head of a camel, the horns of a stag, the eyes of a demon, the ears of a cow, the neck of a snake, the belly of a clam, the scales of a carp, the claws of an eagle and the paws of a tiger." The Chimera monster in {{w|Dungeons and Dragons}} is a "vile combination of goat, lion, and dragon, and features the heads of all three,"[https://www.dndbeyond.com/monsters/16823-chimera] with similar depictions being common across fantasy media. The Aztec god {{w|Quetzalcoatl}} ("the feathered serpent") inspired the {{w|Discworld}} god/demon Quezovercoatl ("the {{w|Boa (clothing accessory)|feathered boa}}") ...being an analogue and mish-mash of various South American cultural and wildlife totems and described more fully as "as half-man, half-chicken, half-jaguar, half-serpent, half-scorpion and half-mad (a total of three homicidal maniacs)" with the small disadvantage of manifesting as only six inches high and being stepped on.

While chimeras occur in fantasy fiction, they also occur in science fiction, for example as {{w|cyborg}}s.{{cn}} The ''{{w|The Restaurant at the End of the Universe}}'', the sequel to Douglas Adams' ''The Hitchhiker's Guide to the Galaxy'', had a large fat meaty bovine dairy quadruped "with large watery eyes, small horns and what might almost have been an ingratiating smile on its lips." This "Ameglian Major Cow" seemingly had the mind and vocal tract of a human, so it could articulate how much it wanted to be eaten.

The omni- prefix was later used in [[2738: Omniknot]] and [[3060: Omniroll]].

==Transcript==
:[A creature, the Omnitaur, is shown. It is a four legged animal divided into 11 segments, each segment is from a different animal. An arrow goes from a label to each section; most of the labels are above the animal, but four labels are below the animal. The animal has a fish tail and cat-like hind legs. The torso is divided into four segments, the first and last of these with scales, but only the last of these also with sharp scales at the top. The second torso segment is white and smooth, the third also white but with hair both above and below, those above merges with the sharp scales of the fourth torso segment. The front legs are horse-like, the lower neck is from an animal with dark spots, the upper neck has ram's horns, which goes over in the central part of a human head, with ears and hair (drawn like a real human, not like an xkcd stick figure) and finally the front of the face is a bird with its eyes and a beak shown. The labels are given here in the order of the segment of the animal from the back to the front (disregarding whether the label is written above or below the animal). The label "Shark" is below the animal's torso, the label "Horse" is below its front left leg, and the labels "Leopard" and "Ram" are below its neck.]
:Fish
:Lion
:Snake
:Shark
:Bull
:Dragon
:Horse
:Leopard
:Ram
:Human
:Bird

:[Caption below the panel:]
:The Omnitaur

{{comic discussion}}

[[Category:Animals]]
[[Category:Biology]]
[[Category:Portmanteau]]

2929: Good and Bad Ideas

2025-10-24T02:52:52Z

PaintspotInfez: Clarified Laser eye surgery.

{{comic
| number = 2929
| date = May 6, 2024
| title = Good and Bad Ideas
| image = good_and_bad_ideas_2x.png
| imagesize = 595x522px
| noexpand = true
| titletext = While it seemed like a fun prank at the time, I realize my prank fire extinguishers full of leaded gasoline were a mistake.
}}

==Explanation==
This is a scatter plot comparing how good an idea sounds to how good the idea is. For example, leaded gasoline sounded like a good idea due to its anti-knocking effects, but is a bad idea due to lead toxicity. Fake prank fire extinguishers both sound bad and ''are'' bad, as they can make a dangerous situation worse. Putting mold on infections sounds like a bad idea, but some molds, like ones containing penicillin, have helpful antibiotic effects.

The title text combines leaded gasoline and a fake prank fire extinguisher into something worse than either. The fire extinguisher is fake and releases flammable material onto the fire, and there is additional lead toxicity.

===Table of the entries===
{| class="wikitable sortable"

|-
! Idea !! What it means !! How good it sounds !! How good it actually is !! Explanation
|-
|{{w|Leaded gasoline}}||Adding {{w|Tetraethyllead|tetraethyl lead}} as an antiknocking agent to allow for increased performance||data-sort-value="+65%"|65%||data-sort-value="-95%"|-95%||Leaded gasoline was introduced in the early 1920s to allow higher pressures and temperatures in an engine without causing {{w|Engine_knocking|detonation (knocking)}}, allowing for increased fuel efficiency and engine performance; it also works to prevent engine valve wear. In essence, it artificially raises the {{w|octane rating}} of the fuel, reducing the need for fuel refinement, thus reducing waste and/or expense. Lead, however, is both toxic and bioaccumulative, meaning that lead released into the air over decades built up to harmful levels in people (as well as other animals) and almost certainly contributed to a host of health issues. Some scientists even hypothesise that {{w|Lead–crime hypothesis|crime levels are influenced by lead exposure}}. (It should be noted that this only "[sounded] like a good idea" due to deliberate campaigns to obscure the known dangers).
|-
|{{w|Bloodletting}}||Releasing "bad blood" from the veins||data-sort-value="-90%"|-90%||data-sort-value="-100%"|-100%||You need (most of) your blood. Losing [https://www.ncbi.nlm.nih.gov/books/NBK542273/ more than 15%] of a person's total blood volume results in adverse effects. Bloodletting was performed as a medical procedure for at least 2000 years until the 19th century. The idea was to withdraw blood to balance the body's "humors". Despite this long history, the notion that bleeding someone is bad now seems like basic common sense, and it's now well-understood that blood-letting (outside of {{what if|98|certain rare and specific cases}}) does no good, causes significant harm and quite certainly causes many deaths.
|-
|{{w|Asbestos}}||Mineral which does not burn, tolerates extremely high temperatures and forms small fibers. These qualities make it excellent for insulation and fire protection||data-sort-value="+90%"|90%||data-sort-value="-80%"|-80%||Asbestos was used extensively in ships and buildings throughout most of the 20th century. Unfortunately, the microscopic fibers that make up asbestos greatly increase the risk of {{w|Asbestosis|lung disease}} and cancer when inhaled, causing its use to be banned in most countries.
|-
|Extension cords with prongs on both ends||allows easy connection between 2 female connectors||data-sort-value="+5%"|~0%||data-sort-value="-80%"|-80%||Prongs on both ends would make it easier to plug the extension cord in on either side. But once plugged into an outlet, the other end becomes a serious shock hazard, as seen in [https://www.youtube.com/watch?v=L08LjkN1k70 this Backyard Scientist video]. Short circuits (both ends connected to outlets supplying power) would be much more likely, resulting in more sparks, fires and damage to wiring. Double-ended cords are also sometimes used as an especially dangerous way to feed power from a generator into an outlet, introducing a shock hazard to any utility workers attempting to restore power.
|-
|Stair kayaking||Riding down a flight of stairs in a {{w|kayak}}||data-sort-value="-60%"|-60%||data-sort-value="-75%"|-75%|| Stair kayaking is a stunt where a person positions a kayak at the top of a flight of stairs and then, using their paddle to push off, [https://youtu.be/46BjHAxgddU?t=154 rides the kayak down the stairs]. This poses significant easily foreseeable risks of injury or death, as well as being very bad for the kayak, which is designed to ride on {{w|Kayak|water}}, not stairs.{{Citation needed}}
|-
|Fake prank fire extinguishers||A “fake prank” fire extinguisher would be something that appears to be a prank fire extinguisher, but is actually a real fire extinguisher. However, Randall appears to mean using a fake fire extinguisher as a prank. Intentionally placing empty or otherwise non-functional {{w|fire extinguisher|fire extinguishers}} as a {{w|practical joke}}.||data-sort-value="-105%"|-100%||data-sort-value="-85%"|-85%|| The idea of placing fake fire extinguishers as a prank, presumably so that a person who thinks they are grabbing a real fire extinguisher will instead find a decoy, sounds, and indeed would be, very dangerous and potentially life-threatening for many people. In the United States, (and presumably most countries), this would also be a felony in most, if not all, jurisdictions. This exact scenario was depicted in the 2001/Season 3 Christmas episode of Family Guy, where Brian failed to put out a fire because the fire extinguisher shot fake snakes instead, acting as further fuel to the fire. An example of a similar situation, although not intended as a prank, can be found [https://twitter.com/ThatSamWinkler/status/1657154071051239424 here].
The title text expands this idea by having the prank fire extinguishers filled with (leaded) gasoline. This is literally adding fuel to the fire.
|-
|Always saying what you think||...regardless of the feelings of others or other considerations||data-sort-value="+65%"|65%||data-sort-value="-60%"|-60%||Openness and honesty are seen as positive character traits in people. Taking it to the extreme of ''always'' telling people what you think has been {{w|Radical_honesty|espoused by some}}, but can lead to awkward, unpleasant or dangerous situations. It may harm your relationship with the other person if they don't like what you think, or they may reply without concern for ''your'' feelings or other considerations. Keeping negative thoughts to yourself or telling "white lies" can be considered a better alternative in some situations.
Unrestrictively saying what you think to somebody in power (a boss, soldier, dictator, drunk) can negatively impact your earning potential, health or freedom, even if you have a point. Or else, on the offchance that your (first) thoughts are less correct, [https://quoteinvestigator.com/2010/05/17/remain-silent/ "Better to remain silent and be thought a fool than to speak and to remove all doubt."]
|-
|Replying to spammers||Clicking on the "Reply" button from {{w|spam email}}s and writing (and sending) a reply (or worse, clicking on the links in these emails)||data-sort-value="-50%"|-50%||data-sort-value="-50%"|-50%||At best, you confirm your email address and identify yourself as someone likely to respond to such messages and so encourage the spammers to deluge you with more messages. At worst, the spammer may extract sensitive information about you, make you a victim of a scam or gain control of your computer.
|-
|{{w|Solar car}}s||Having {{w|Solar panel|solar panels}} on the car's surface (mostly hood and roof) for power generation||data-sort-value="+95%"|95%||data-sort-value="-35%"|-35%||Powering electric vehicles with solar panels seems like an excellent idea: it would provide power with no increased land use, and theoretically could allow a vehicle to operate indefinitely without being fueled or charged. However, such vehicles would require power storage (due to power requirements, weather conditions, shade from roadside features and nighttime driving), adding significant weight. Adding solar panels to a plug-in or hybrid vehicle would add cost, weight, manufacturing complexity and maintenance requirements. Solar panels on moving cars are less efficient than in stationary installations, where they can be aimed at the Sun, and subject to damage from both collisions and road debris; even without these problems, the size of automobiles relative to their power requirements would sharply limit the car's range (unless it was a normal electric vehicle with supplemental solar panels). Solar cars do exist (the {{w|World Solar Challenge}} is a competition for such cars), but as a practical form of transportation, the negatives likely outweigh the positives. See also [[1924: Solar Panels]].
|-
|{{w|Heelys|Heelies}}[sic]||Heelys are shoes with an inline skate wheel built in the sole, at the heel. ||data-sort-value="+25%"|25%||data-sort-value="-40%"|-40%||Heelys allow the wearer (usually children) to shift between normal walking and rolling like being on skates. This sounds like fun but [https://abcnews.go.com/Health/Exercise/story?id=3242181&page=1 has been suggested] to be a potentially significant injury risk.
|-
|{{w|Prequel|Prequels}}||A work of fiction (often a movie) telling the "story before the story" of another work.||data-sort-value="+75%"|75%||data-sort-value="-15%"|-15%||More of a good story sounds great on the surface, and audiences who are invested in a set of characters and/or a setting often love the idea of finding out what led up to certain events. But there are several pitfalls. Spin-offs of a popular property are often low-quality cash grabs. Prequels, specifically, are constrained by the fact that they have to lead to the story that's already been released, which can lead to contrived storytelling. There's less room for suspense, since the future of the storyline has already been established. There's a tendency to invent or fill in detailed backstories, which can undermine character arcs and/or destroy the mystery and nuance of certain characters. And, since they tend only to be made where the original is already well-received, regression to the mean tends to mean they are more likely than not to fail to live up to expectations. Prequels can be good, but there are a lot of ways they can go wrong.
|-
|Transitions® lenses||A brand name for {{w|Photochromic_lens|photochromic lenses}} in glasses or contacts, which get darker (like sunglasses) in bright light.||data-sort-value="+30%"|30%||data-sort-value="-20%"|-20%||Photochromic lenses are clear lenses that darken when exposed to UV light, then turn clear again when the UV is removed. The advantage is that wearers of glasses don't need to have separate (prescription) sunglasses or contacts. However, the process is relatively slow (about a minute) so not so useful when there is a quick succession of shade and bright light, as in a forest or when driving. If used in a car, the windscreen filters out UV light to some degree, which prevents the glasses from darkening as required. Finally, the process is temperature dependent, so in hot weather the glasses don't become as dark, and in cold weather they might stay dark for too long.

Additionally, the following should be considered. UV-conscious people protect their face against UV light, so the skin doesn't form wrinkles and ages slower. Sunscreen is difficult to apply around eyes without getting the substance on eyeballs (cosmetic substances should not get there{{Citation needed}}). One of the reasons behind wearing sunglasses may be to protect skin around eyes from forming so called crow's feet. Under UV-filtering sunglasses, UV-activated transitions contact lenses will not darken defeating their purpose. At the same time transitions contacts are typically at least twice as expensive as the regular ones.
|-
|Cutting pizza in squares||Cutting (a presumably round) pizza in squares||data-sort-value="-25%"|-25%||data-sort-value="-20%"|-20%||Most people cut pizza into wedges and hold it by the crust. Cutting it into squares could allow for more pieces to be shared, if the resulting wedges would be too thin to be practical. However, pieces near the center will have no crust to hold it by, getting cheese and sauce all over your fingers. Cuts around the edge will probably leave smaller leftover scraps which are mostly crust. While hardly a disaster like the other items in its quadrant, square pizza pieces are just not very useful and rather inefficient. Cutting a rectangular pizza into squares might not suffer from the problems above, but, unless the pizza itself is square and cut only into four squares, some people will end up with a higher crust-to-topping ratio than others. Cutting a round pizza into squares is popular in Chicago and is sometimes called tavern-style or party-cut and some<nowiki>[</nowiki>''{{w|Wikipedia:Manual_of_Style/Words_to_watch#Unsupported_attributions|who?}}''<nowiki>]</nowiki> [https://www.bonappetit.com/story/real-chicago-pizza-tavern-style consider it the real Chicago style pizza] [https://destinationeatdrink.com/the-real-chicago-style-pizza-isnt-deep-dish/ rather than deep dish pizza].{{Dubious}} St. Louis Style Pizza is also cut into squares.
|-
|{{w|Project Orion (nuclear propulsion)|Project Orion}}||Study by the U.S. government looking into nuclear pulse propulsion for spacecraft.||data-sort-value="-95%"|-95%||data-sort-value="-25%"|-25%||Using repeated nuclear explosions to generate motion sounds bad for both the spacecraft and everything else, especially with a ground launch, but there are ways to address a lot of the concerns, so it isn't as bad as it sounds. Project Orion's theorized specific impulse and thrust would also be far higher than anything chemical rockets can accomplish. The efficiency of Project Orion is extremely low, however, and the {{w|ablation}} issues are extremely difficult to overcome.

See also [[2423: Project Orion]].
|-
|{{w|Soup}}||Soup||data-sort-value="0%"|~0%||data-sort-value="0%"|~0%||Soup is probably one of the oldest foods created by prehistoric cooks. Many people enjoy it, though some consider many soups somewhat lacking as a meal on their own, or boring.
|-
|{{w|Washer-dryer|Combo washer dryers}}||A device that combines a washing machine and laundry dryer||data-sort-value="+80%"|80%||data-sort-value="+20%"|20%||Better at space efficiency, but worse at each task than separate devices and unable to do both tasks in parallel (useful when you have more than one batch of laundry).
|-
|Cutting sandwiches diagonally||Cutting sandwiches made with rectangular sliced bread diagonally||data-sort-value="+30%"|30%||data-sort-value="+20%"|20%||[https://www.popularmechanics.com/science/math/a32690399/triangles-rectangles-best-way-cut-sandwich-math/ Generally] [https://www.npr.org/2009/11/28/120914097/rectangles-vs-triangles-the-great-sandwich-debate regarded] as the superior way to slice a sandwich, providing more aesthetically pleasing display of the contents, better support in the hand and fewer all-crust bites.
|-
|{{w|Diverging diamond interchange}}s||Road junction where the two (sets of) lanes cross over to switch sides (so if you normally drive on the right, now you drive on the left), then switch back to normal after the junction||data-sort-value="-30%"|-30%||data-sort-value="+15%"|15%||Highway engineers believe the shape improves safety and traffic flow through the interchange because switching to the other side facilitates merging to and from the other road in the junction. However, the shape appears to be insanity to an unfamiliar driver, who may assume that driver confusion would lead to increased accidents.
|-
|Toasting sandwiches||Making a sandwich first and then cooking it, as in a dedicated {{w|Pie_iron|sandwich toaster}}, a {{w|toaster oven|toaster oven}}, frying pan or under a grill.||data-sort-value="+45%"|45%||data-sort-value="+50%"|50%||The grilled cheese sandwich is a familiar form to most people, and many other sandwiches are improved by toasting as a final step. Doing so makes the sandwich warm, while also making the bread crisp and crunchy, while often melting or softening the fillings, which provides contrasting textures that many find pleasing. Other sandwiches, such as the {{w|western sandwich|Western}} or {{w|club sandwich|club}} are prepared using toast. The {{w|peanut butter, banana and bacon sandwich|Elvis}} is a specific case of a sandwich that normally wouldn't be toasted, but is improved by it - peanut butter, bacon, banana and jelly, with the assembly lightly fried.
|-
|{{w|Crumple zone}}s||Areas of a car that are designed to deform in a controlled way in case of a crash. ||data-sort-value="-55%"|-55%||data-sort-value="+55%"|55%||Most people's intuition would be that stronger cars are safer, and intending parts of a vehicle to collapse ''by design'' might seem crazy. But engineered crumple zones are designed to gradually absorb the kinetic energy in a vehicle collision and protect the passenger cabin. The result is that the occupants experience less intense deceleration and ideally without the damage significantly compressing the shell around them. This significantly reduces the danger of injury or death from higher speed crashes.
|-
|{{w|Sliced bread}}||Bread, sliced by the baker before packaging for sale||data-sort-value="+95%"|95%||data-sort-value="+65%"|65%||It's far more convenient for making sandwiches or toast, but unfortunately pre-sliced bread will go stale faster and some applications may be better off thicker or thinner than the slices provided. Sliced bread is often used as a comparator for how good something is, using the phrase 'the best thing since sliced bread'.
|-
|{{w|Pizza}}||Pizza - a dish made by arranging ingredients on thin dough and cooking it, usually cut radially||data-sort-value="+55%"|55%||data-sort-value="+75%"|75%||Pizza is a widely popular dish throughout much of the world, uncontroversial {{w|Anchovies_as_food|except}} {{w|Pineapple|certain}} [https://www.taste.com.au/recipes/nutty-choc-pizza-fresh-berries/2c0220a4-8463-45ff-b2ba-ac7e5012a006 toppings].
|-
|Eating citrus fruit while at sea||Having a supply of {{w|citrus fruit}} on long sea journeys, especially during the {{w|Age of Sail}} ||data-sort-value="0%"|~0%||data-sort-value="+75%"|75%||For a long time, {{w|Scurvy|scurvy}} was a danger to sailors, who generally subsisted on a monotonous diet of shelf-stable foods with low vitamin content while on long voyages. Most citrus fruits are rich in vitamin C, which prevents scurvy. Eating orange or lemons doesn't seem like a significant activity one way or the other, but it's an easy way to prevent a disease that causes serious ill-health and possibly a painful death.
|-
|Putting mold on infections||Seemingly a reference to the ancient practice of pressing moldy bread against infected wounds||data-sort-value="-110%"|-100%||data-sort-value="+60%"|60%||While this sounds like a good way to get a fungal infection, with the correct mold this is a primitive way to obtain an antibiotic. Certain fungi naturally produce antibiotic substances, and this is where humans discovered {{w|penicillin}}.
|-
|Wheels on luggage||Some luggage bags have small wheels inset on their frame and a carrying handle.||data-sort-value="+100%"|100%||data-sort-value="+90%"|90%||A relatively simple fitting for rigid or semi-rigid luggage that substantially eases its transport over long distances on flat surfaces such as travel terminals.
|-
|{{w|Heat pump}}s||A technology that moves heat energy from a cold area to a warm area, most familiar as the technology that keeps a refrigerator cold. It can be used to heat a home interior in winter or cool it in summer.||data-sort-value="+55%"|55%||data-sort-value="+95%"|95%||Unlike traditional furnaces, heat pumps do not generate heat (beyond a small overhead). Instead, they move existing thermal energy from a coolable environment across to a warmable one. This allows a space to be heated with significantly less energy use than a furnace or resistance heater that generates heat directly from chemical or electrical energy. Because these units are usually operated by electricity, they can provide heating with renewable energy (potentially using {{w|thermal energy storage}} for load-shifting), reduce or eliminate the need for natural gas connections and prevent several risks that come with traditional furnaces (such a carbon monoxide leaks and fires). In addition, heat pumps can operate in the reverse direction as air conditioners, so a single unit can be designed to both heat and cool a building. It sounds like a good idea and works out better than expected in real life.
According to [https://www.technologyreview.com/2023/02/14/1068582/everything-you-need-to-know-about-heat-pumps/ MIT Technology review]:
<blockquote>Heat pumps today can reach 300% to 400% efficiency or even higher, meaning they’re putting out three to four times as much energy in the form of heat as they’re using in electricity. For a space heater, the theoretical maximum would be 100% efficiency, and the best models today reach around 95% efficiency.</blockquote>

See also [[2790: Heat Pump]].
|-
|{{w|Laser eye surgery}}||Surgical techniques using lasers for precision cutting in the eyeball.||data-sort-value="-60%"|-60%||data-sort-value="+90%"|90%||In the popular imagination, lasers are often thought of as something used for destroying their target. In fact, laser pointers commonly include warnings about how and when they should be used. Firing them into people's eyes, then, does not sound like a great idea.{{Citation needed}} However, this technology has substantially improved the eyesight of millions of people worldwide by allowing the treatment of eye problems otherwise only corrected by lenses or entirely untreatable. Randall hasn't placed "Laser eye surgery" ''exactly'' at the edge of the good-idea axis, however, perhaps because of the genuine chance that a laser-eye-surgery recipient's vision could become significantly damaged permanently during surgery. Randall has previously commented on laser eye surgery, amongst other ideas both good and bad, in [[1681: Laser Products]].
|-
|{{w|Fecal transplant}}s||Transfer of portions of the {{w|Gut microbiota|gut microbiome}} of a healthy person to the sterilized gut of an ill person.||data-sort-value="-110%"|-100%||data-sort-value="+95%"|95%||The gut microbiome is a collection of organisms that lives in our guts. It can influence our health. It is responsible for the last stages of digesting our food. It can also produce neurotransmitters that are carried by blood to our brain influencing our behavior, and play a role in disease immunity, among other systemic effects that are still not well understood. A healthy microbiome can be destroyed by bad eating habits, unhealthy lifestyles, infections or the use of antibiotics. Sometimes it may be beneficial to completely sterilize the gut and then take a sample of a healthy biome from another person. A sample is enough, as the organisms will multiply. As long as the patient eats correctly, the microbiome after transplant should develop correctly.

It sounds bad because we tend to think of our feces as something gross, to be discarded, and other people's bacteria as infectious. It is called fecal transplant as our feces contain about 50% of gut bacteria, but nowadays the sample usually takes the form of a coated pill that is applied rectally.
|-
|}

==Transcript==
:[Two axes with double arrows cross each other in the middle. At the end of each arrow, there are labels. Scattered over the chart are 28 entries. Below these entries are given for each of the four quadrants, plus three that are on the Y-axis. For each quadrant the entries are listed in reading order, top to bottom left to right.]

:[X axis from left to right:]
:Sounds like a good idea
:Sounds like a bad idea

:[Y axis from top to bottom:]
:Actually a bad idea
:Actually a good idea

:[Top left quadrant (sounds like a good idea, actually a bad idea):]
:Leaded gasoline
:Asbestos
:Always saying what you think
:Solar cars
:Heelies
:Prequels
:Transitions® lenses

:[Top middle (actually a bad idea):]
:Extension cords with prongs on both ends

:[Top right quadrant (sounds like a bad idea, actually a bad idea):]
:Bloodletting
:Fake prank fire extinguishers
:Stair kayaking
:Replying to spammers
:Cutting pizza in squares
:Project Orion

:[Center (neutral):]
:Soup

:[Bottom left quadrant (sounds like a good idea, actually a good idea):]
:Combo washer dryers
:Cutting sandwiches diagonally
:Toasting sandwiches
:Sliced bread
:Pizza
:Wheels on luggage
:Heat pumps

:[Bottom middle (actually a good idea):]
:Eating citrus fruit while at sea

:[Bottom right quadrant (sounds like a bad idea, actually a good idea):]
:Diverging diamond interchanges
:Crumple zones
:Putting mold on infections
:Laser eye surgery
:Fecal transplants

==Trivia==
*A much leaner version of this comic appeared in the first [[What If? (book) | "What If?" book]], chapter "Weird (and Worrying) Questions from the What If? Inbox, #9".

{{comic discussion}}

[[Category:Charts]]
[[Category:Scatter plots]]
[[Category:Rankings]]
[[Category:Food]]

2799: Frankenstein Claim Permutations

2023-10-24T18:00:29Z

PaintspotInfez: /* Transcript */ (with longer hair)

{{comic
| number = 2799
| date = July 7, 2023
| title = Frankenstein Claim Permutations
| image = frankenstein_claim_permutations_2x.png
| imagesize = 596x612px
| noexpand = true
| titletext = When I began trying to form a new claim by stitching together these parts in such an unnatural way, some called me mad.
}}

==Explanation==
''{{w|Frankenstein}}'' is an 1818 novel by Mary Shelley about a young scientist named Victor Frankenstein who creates a sapient, humanoid lifeform through an unorthodox experiment, and then rejects his creation, which eventually turns on him. The novel is a classic in both the horror and speculative fiction genres, and has been argued to represent the first major example of true science fiction in literature. The lifeform he creates is never named in the original novel, only being referred to as "the Creature".

In the two centuries since the novel's publication, the story and its characters have been adapted and reused in various forms, and the term "Frankenstein" has come to be commonly used to refer to the creature, rather than the scientist who created him. Literary didacts are often quick to point out this error, but are generally ignored, as the name has become accepted, common usage. The debate has become something of a meme. The Creature himself, at one point, refers to himself as effectively being Frankenstein's son, which could imply he wishes to carry the same name; at the same time, Doctor Frankenstein does not treat his creation with such a level of humanity and speaks as if the Creature is completely nameless. To this day the debate continues among literary analysts whether the Creature should remain nameless for these reasons. These disputes have previously been touched upon in [[1589: Frankenstein]] and [[2604: Frankenstein Captcha]]

The title text points out that he's "stitching together" various claims to create something new, and people consider him mad as a result. This refers to the notion of Frankenstein's creation having been stitched together from dead bodies, and Dr. Frankenstein himself being denounced as a madman. It should be noted that these perceptions come from later adaptations (most notably {{w|Frankenstein_(1931_film)|the 1931 film}}) rather than the original novel, but have become closely associated with the Frankenstein mythos. Following similar meta-textual logic, the title "Frankenstein Claim Permutations" is a double entendre, meaning both (1) permutations of claims regarding the novel ''Frankenstein'' and (2) permutations of claims of a Frankenstein nature (i.e. a franken-claim) in that they are formed by haphazardly joining together different parts.

This comic explores the possible [[wikipedia:Permutation|permutations]] that can be made by matching the names of Mary Shelley, Frankenstein, and '?' (for the unnamed monster) to the positions of author, creator, and monster. The positions are indicated in the drawing by a circle to the left of the book for the author, a box on the left-hand page for the creator, and a labeled picture of the monster lying under a sheet (the traditional image of the monster before being animated) for the monster. Three elements can be arranged in six different ways, as the first element can be placed in any of the three positions, the second in either of the two remaining, and the last in the only remaining space, giving 3 x 2 x 1 options. The same concept was used in [[1613: The Three Laws of Robotics]], where Randall depicted six possible permutations of the {{w|Three Laws of Robotics}}.

{| class="wikitable"
|- style = "text-align: center;"
!Claim!!Notes!!Permutation!!Explanation
|-
|"No, the monster in Mary Shelley's book is unnamed. Frankenstein is the doctor who created him."||This is the normal claim||MS-F-?||This is the claim that is generally considered correct. The POV character of the novel is, in fact, Victor Frankenstein. The monster is never given a name, although some fans name him Adam because of a line he speaks to Victor: "'I ought to be thy Adam, but I am rather the fallen angel, whom thou drivest from joy". The only error in this claim is referring to Victor as a doctor. (In the novel, Victor has not finished his schooling, returning home before finishing his education at the University of Ingolstadt.)
|-
|"No, the monster in Mary Shelley's novel is named Frankenstein."||Also common, and not worth getting mad about IMO||MS-?-F||This is a common misconception, but Randall believes it's not something to get upset about, either because he has decided it's not {{wiktionary|hill to die on|a hill worth dying on}} or that, since everyone calls the monster "Frankenstein", it is ''de facto'' for all intents and purposes his name.
Randall has previously touched upon this in comics [[1589: Frankenstein]] and [[2604: Frankenstein Captcha]]. This permutation places the '?' in the creator position, and so avoids talking about the doctor's name at all.
Alternatively, the statement could be taken as an argument that Frankenstein should be considered the "monster" because he created and then abandoned a sentient being.
|-
|"No, Frankenstein is the name of the author. The monster Mary Shelley created is unnamed."||At a glance this could pass for one of the normal claims||F-MS-?||This statement, Randal says, is so much like the first two that he says it could pass for one of the normal claims. He could also mean that while slightly stretching the meaning of those words, Mary Shelley did "create" the monster (as it's a character in the book she wrote) and Frankenstein is the "author" (creator) of the monster. Alternately, one can consider the story a mostly first hand account of Victor's exploits, as it is initially told to the book's opening narrator (the otherwise sidelined Captain Robert Walton), with Mary having created Monster, Victor, the Captain and all others within the novel (of the Captain's tale of Victor's tale of the apparent nature of the Monster).
This could also be a reference to a tweet[https://twitter.com/MedCrisis/status/1511644464544104452] featuring a photo of a collection of classic books[https://i.redd.it/bnab4cu39dqa1.jpg] in which "Frankenstein" is printed in the position and format of the author's name for the other books of the collection, while "Mary Shelley" is printed in the title position.
|-
|"No one knows who wrote the novel about Doctor Mary Shelley creating the monster Frankenstein."||I would read this book||?-MS-F|| This statement combines the second claim (that Frankenstein is the monster's name) with the third claim (that Mary Shelley created the monster). This time, however, it is claimed that the ''author'' is unknown, while the monster is named. A novel about author Mary Shelley getting a doctorate and actually creating the creature she wrote about could be an interesting twist on the story, hence Randall's comment that he would read this book.
|-
|"No, Frankenstein is the name of the doctor. The monster he created is Mary Shelley."||rowspan=2|Fully chaotic||?-F-MS|| This claim is similar to the others, in that it twists the ordering of the components (author, doctor, monster), but this time it gets the doctor's name correct whilst insinuating that Mary Shelley was the monster he created. This is described as "fully chaotic", likely because the idea of the real-life human author being created by a doctor in the story that was written by her is much more absurd and much further from any solid literary footing than the others.
|-
|"No, the doctor who creates Mary Shelley in Frankenstein's novel doesn't have a name."||F-?-MS||Possible Doctor Who reference.
|}

==Transcript==
[A two-column table.]
{| class="wikitable"
|- style = "text-align: center;"
|Claim||Notes
|-
|[Open book. Left page says "F", right page shows the monster labeled "?". Arrow pointing to book says "by MS".] "No, the monster in Mary Shelley's book is unnamed. Frankenstein is the doctor who created him."||This is the normal claim
|-
|[Open book. Left page says "?", right page shows the monster labeled "F". Arrow pointing to book says "by MS".] "No, the monster in Mary Shelley's novel is named Frankenstein."||Also common, and not worth getting mad about IMO
|-
|[Open book. Left page says "MS", right page shows the monster labeled "?". Arrow pointing to book says "by F".] "No, Frankenstein is the name of the author. The monster Mary Shelley created is unnamed."||At a glance this could pass for one of the normal claims
|-
|[Open book. Left page says "MS", right page shows the monster labeled "F". Arrow pointing to book says "by ?".] "No one knows who wrote the novel about Doctor Mary Shelley creating the monster Frankenstein."||I would read this book
|-
|[Open book. Left page says "F", right page shows the monster (with longer hair) labeled "MS". Arrow pointing to book says "by ?".] "No, Frankenstein is the name of the doctor. The monster he created is Mary Shelley."||rowspan=2|Fully chaotic
|-
|[Open book. Left page says "?", right page shows the monster (with longer hair) labeled "MS". Arrow pointing to book says "by F".] "No, the doctor who creates Mary Shelley in Frankenstein's novel doesn't have a name."
|}
[[Category:Frankenstein]]
[[Category:Fiction]]
{{comic discussion}}

2825: Autumn and Fall

2023-10-24T17:43:11Z

PaintspotInfez: /* Explanation */ Well, often...

{{comic
| number = 2825
| date = September 6, 2023
| title = Autumn and Fall
| image = autumn_and_fall_2x.png
| imagesize = 392x212px
| noexpand = true
| titletext = Of course in reality this is just a US/UK thing; in British English, 'fall' is the brief period in between and 'autumn' is the main season.
}}

==Explanation==

{{w|Autumn}}, also known as "fall" in the United States (short for 'fall of the leaf'), is the season between the end of summer and the beginning of winter. These terms are used interchangeably, but Randall in this comic treats them as separate seasons. His timeline uses "autumn" as the season between the end of summer and the "{{w|September equinox|fall equinox}}", and the season of "fall" as the period after that until winter. While many different parts of the world use different ways of reckoning the {{w|seasons}} (eg, a two-season system in the tropics or a six-season system in South Asia), nowhere uses the type of five-season system shown in the comic, nor the extrapolated eight-season system it may even imply.

The comic depicts two of the commonly used boundaries, for any given hemisphere, for the recognized end of summer. While other cultures have adopted yet other dates, according to their own calendars or local experience, [[Randall]] may have encountered several other 'standard' methods of dividing the year.
* Some treatments of the seasons (not shown) treat the summer solstice very much as "midsummer", and all other seasons also more or less equally straddling their own equinoxes/remaining solstice, putting the seasonal boundaries half way between each of these astronomically significant points.
* For others, the equinoctial/solstitial dates are used for the changeover time, so that autumn/fall starts upon the equinox (shown) and ends at the astronomically shortest day which is then the start of winter. This system tends to be traditional where the annual warming and cooling of the climate significantly 'lags' the solar calendar.
* Meteorological seasons are handily aligned to months, for administrative reasons. Spring (short for 'spring of the leaf') is March through May, summer across June to August, the September start (to the close of November) is as illustrated, leaving winter to be covered by December and on until the end of the following February. Or shifted round by two of the triples for the southern hemisphere.
* For practical purposes, many in the U.S. treat {{w|Labor Day}} as the unofficial end of summer: this is the day many local pools close for the winter, people start watching football rather than baseball, have their last picnic of the year, etc.

The joke here is that, because Americans do not use the term "autumn" very often in normal communication, someone might be led to believe that it had a special unusual scientific meaning.

The title text makes fun of the transatlantic difference in terms, as it claims one must ''reverse'' these two distinct season names. The term "autumn" is, in reality, the word overwhelmingly used in the UK for the season commonly (but not exclusively) referred to as "the fall" in the US, regardless of which of the calendar offsets is to be assumed, and the equinox is, accordingly, called the autumn equinox. "Fall" is rarely used 'natively' in the UK (although it will usually be understood), with the main exception being that it handily allows for the mnemonic of "spring forward, fall back", which uses wordplay to refer to how and roughly when British Summer Time (UTC+1) takes over from the default Greenwich Mean Time (UTC±0).

==Transcript==

:[A monthly time track, showing the stretch of August, September, and October. The date of September 6th is marked now, with September 23rd marked as the Fall Equinox. September 1st is marked as the Meteorological End of Summer. Underneath the track there are labels for the seasons - Summer ends at September 1st, which is then labelled as Autumn until the Equinox wherein a separate season labelled as Fall is from the Equinox onwards.]

:[Caption below the panel:]
:Now that summer is over, the first day of fall is just a few weeks away!

{{comic discussion}}

[[Category:Calendar]]
[[Category:Timelines]]

2839: Language Acquisition

2023-10-24T17:33:43Z

PaintspotInfez: /* Explanation */ exposuRe typo fix, and a more smooth chain of sentences

{{comic
| number = 2839
| date = October 9, 2023
| title = Language Acquisition
| image = language_acquisition_2x.png
| imagesize = 193x239px
| noexpand = true
| titletext = My first words were 'These were my first words; what were yours?'
}}

==Explanation==

{{w|Language acquisition}} is the process by which humans, generally infants, learn a language. There are many theories as to how this process works, but Randall humorously conflates an infant's language acquisition process to an adult's , saying that infants learn languages one new word at a time. This could be equated to how app-based language learning works, at least at certain stages of vocabulary expansion. This is typically not true{{Citation needed}} for infants learning the native language(s) that they will consider as their mother tongue.

The child's sentence says that he has acquired another word, bringing his total to twelve words, all unique. This is conveyed in the twelve unique words spoken, thus indicating (if true) that these are the very (and only) words the infant has acquired up to this point. These would be a very unusual set of words to be the first ones learned for an infant (and even for an adult, deliberately acquiring a new language). Furthermore, the child appears to have learned some fairly advanced grammatical concepts in order to construct this fairly complex sentence, similar to how adults may start with somewhat advanced grammar rules as they start to assemble the knowledge of a new language. Learning grammar typically takes much longer, and only occurs makes sense once sufficient vocabulary has been learnt to recognise the patterns in how the words are used.

Interestingly if this sentence is true, the child has learned the word "twelve" before learning the words for any other numbers, and so could not have given a quantitative update on previous days. However, this would also imply that their counting is not yet as advanced as their language acquisition, which may mean that they are simply wrong about the number of words they have learned.

In fact, it is possible to create a "learning sequence" based on these twelve words to somewhat make a little sense if the words are acquired in a word-after-word basis. An example is shown below:
* Word.
* Word: "today".
* Learned word today.
* Learned another word today.
* I learned another word today.
* Update: I learned another word today.
* Update: I learned another word today: "my".
* My update: I learned another word today: "bringing".
* Bringing my update: I learned another word today: "to".
* Bringing to my update: I learned another word today: "total".
* Bringing to my total vocabulary update: I learned another word today.
* Vocabulary update: I learned another word today, bringing my total to twelve.

Two letter-blocks on the ground next to the child show capitals 'A' and 'B', and a third has an upside-down lowercase 'e'. The block with the 'e' may indeed be upside-down, but it could also be a block with the phonetic symbol {{w|schwa}} on it. As phonetics are generally used by lay-people when they start to learn how different sounds in their target language is pronounced, this would suggest the parents are teaching their child advanced linguistic concepts before they've fully learned to speak their first language, which might explain why the child's language acquisition is so unusual.

The title text makes a self-referential joke about the concept of "first words", where a supposed child discusses one's own first words in a complete sentence. There are seven unique words in the title text, most of which do not appear in the comic image, suggesting the title text and comic image referred to two different children. It is a common milestone to celebrate a child's "[https://www.parents.com/baby/development/talking/baby-talk-a-month-by-month-timeline1/ first word]", but typically these would be less advanced words, such as "mama" or "dada".

This seems to be another indication that [[Randall]] is conflating adult language acquisition and infant language acquisition, because such moderately-complex sentences are usually a beginner's first attempt in a new target language, by the way of learning set phrases by rote (for concepts they can already voice in another language). Examples might include standard greetings, such as "Hello, my name is [...]", and various questions and answers related to their exposure to the foreign language concerned.

[[2567: Language Development]] has had a similarly obscure take on language acquisition.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[A child, drawn as a smaller Hairy. He stands amongst three blocks with letters on them, showing faces with A, B and an upside-down lowercase e. Megan and Cueball stand to the right of him.]
:Child: Vocabulary update: I learned another word today, bringing my total to twelve.

{{comic discussion}}
[[Category:Language]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Cueball]]
[[Category:Comics with babies]]

2790: Heat Pump

2023-06-17T19:35:28Z

PaintspotInfez: No comma.

{{comic
| number = 2790
| date = June 16, 2023
| title = Heat Pump
| image = heat_pump_2x.png
| imagesize = 740x400px
| noexpand = true
| titletext = If I'm not going to upgrade to a powered one, I should at LEAST stop leaving the door open so often.
}}

==Explanation==
{{incomplete|Created by a BIG CHUNGUS HEAT PUMPER. Do NOT delete this tag too soon.}}

This comic appearing on 16 June 2023 could be in reference to the conversation in German media and politics about a [https://www.theguardian.com/world/2023/jun/14/germany-coalition-staves-off-implosion-with-11th-hour-heating-law-amendment controversially drafted law] to regulate heating systems in homes and buildings.

A {{w|heat pump}} is a system which applies the {{w|ideal gas law}} to transfer heat from a relatively cold area to a relatively hot area, i.e. to heat an insufficiently warm room/building or to cool an insufficiently chilled room/building, even if the outside air is at the opposite heat-gradient for the purpose. The extra energy used to achieve this prevents the {{w|second law of thermodynamics}} from being violated, and is usually assumed to be added to the warmer side of the system. This is why the back of a refrigerator will feel hot, as it maintains the cooler internal temperature (and why leaving its door open does not cool down the room that it is in, just heats it up as it fruitlessly attempts to both heat and cool the same air-mass).

In this comic, [[Cueball]] has a ''manual'' heat pump, and he is manually heating an area by walking from the warm area (colored in ''red'') to a colder area (colored in ''blue''), and "drawing" residual heat into the "bellows" (accordion-shaped device) by expanding them to cool them below the outside air temperature (more intense blue). He then returns back to the warm area and compresses the bellows to concentrate heat above the sustained room-temperature (more intense red), then letting it radiate away and increasing room temperature before going back outside to repeat the process of drawing heat out of the cooler air. As expected, this is a laborious process, as captioned in the text below the panel. Manual heat pumps of this kind do not exist in real life{{cn}}, but are partly emulated by devices such as {{w|fire piston}}s. The {{w|air source heat pump}} effectively does the same thing as this comic, but by using components installed across a wall (letting fluids/vapors flow between the two sides) rather than moving physical components through doors.

The title text refers to the problem of having to open the door to carry the device in and out. This would let the warmed air flow out, and cool air flow in, to undo some of the effort used to attempt to increase the difference. In lieu of some device that does not require the door to be opened at all, he should at least promptly close it between each passage through it.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Cueball indoors (light red background) holding a (matchingly light red) accordion-shaped device in his hands and walking towards an open door.]

:[Cueball outdoors (light blue background) with the door closed, the device is still light red.]

:[Cueball extends the device and it turns blue.]
:''Release''

:[Cueball looks behind while the device has turned light blue to match the area it is in.]

:[Cueball walking back inside through an open door, the device is still light blue.]

:[Cueball indoors with the door closed. He squeezes the device and it turns red.]
:''Squeeze''

:[Cueball looks at the door while the device is glowing in bright red.]
:''Radiate''

:[Cueball is leaving the indoors area (now having a slightly more intense red background, to closely match the now less bright red of the device) through an open door.]

:[Caption below the panel:]
:Manual heat pumps are such a pain.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics with color]]
[[Category:Physics]]

2771: College Knowledge

2023-06-17T08:28:13Z

PaintspotInfez: /* Notes */ Only the final syllable. They would both need to rhyme with "-amplemousse" to rhyme.

{{comic
| number = 2771
| date = May 3, 2023
| title = College Knowledge
| image = college_knowledge_2x.png
| imagesize = 649x266px
| noexpand = true
| titletext = 'Your chitin armor is no match for our iron-tipped stingers! Better go hide in your jars!' --common playground taunt
}}

==Explanation==
{{incomplete|Created by a BOT GOING TO IO TO GET MORE DIODES - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
A common playground rhyme which children will often recite when divided by gender is that "girls go to college to get more knowledge; boys go to {{w|Jupiter}} to get more stupider," with the genders being interchangeable depending on the rhyme's singer.

Starting out with this cadence, three characters (or child versions) {{w|Skipping rope|jump rope}} and explore parts of the solar system and beyond by taking it in turns to provide the rhythm's tempo. First [[Science Girl]] (who is turning the left end of the rope), then a [[Cueball]] (at the right), followed by a [[Ponytail]] (doing the jumping), before returning to Science Girl. As they concentrate on various stellar bodies that are harder and harder to rhyme, their chants become increasingly hesitant and obscure, ruining the rhythm and resulting in ever more contrived "rhymes", to the point where they eventually seem compelled to abandon the whole game.

The title text refers back to some of the rhymes the characters mention, making sure to stay consistent with whichever gender acquires which object. Speaking from the perspective of the college-bound gender, who had acquired {{w|ferrous}} iron from {{w|Eris}} (or perhaps {{wiktionary|ferrous|become more composed of it}}, by {{w|Dark They Were, and Golden-Eyed|bodily transformation}}), the girls playfully threaten the boys with iron-tipped {{w|stinger}}s, for which the boys' acquired armor of {{w|chitin}} (a material commonly found on the exoskeletons of various insects, including in any stings these might normally have) from {{w|Triton}} is purportedly no match. The girls then also refer to the jars which the boys had acquired from {{w|Mars}}, telling the boys that they'd better hide in them if they wanted any sort of protection from the iron-tipped stingers. To top it all off, the title text finally claims that this is supposedly a "common playground taunt" among children, which implies the unlikely outcome that the bizarre and unwieldy rhymes which the characters in the comic created have somehow persisted and passed into common usage enough to be generally recognizable.

In [[1202: Girls and Boys]], boys and girls both go to college ''and'' to Jupiter, both to get more knowledge.

==Notes==
*Going to Mars to get more jars may be a reference to a 1955 {{w|Burma-Shave}} campaign promising a free trip to Mars for whoever sent in 900 empty jars. The joking offer was accepted by a Wisconsin shopkeeper named Arliss French. The company enjoyed the publicity, and sent him and his wife to {{w|Moers}}.
*{{w|Ceres (dwarf planet)|Ceres}} is a dwarf planet in the asteroid belt, between the orbits of Mars and Jupiter.
*{{w|Chitin}} is a polysaccharide found in the exoskeletons of insects and cell walls of fungi.
*{{w|Tim Berners-Lee}} is the inventor of the World Wide Web.
*{{w|Pamplemousse}} is the French word for grapefruit or pomelo, depending on dialect. Note that it does not actually rhyme with Betelgeuse for {{w|Betelgeuse#Spelling and pronunciation|most pronunciations}}, only when pronounced along the lines of ''Beetlejuice'' does this line's final syllable rhyme.
*It could be debated whether these are three children, and thus not Cueball and Ponytail, who are adult, but there is nothing to compare them to, and Science Girl has also been drawn as an adult. So for ease of naming them, it is easier to keep the names even if these are children.

==Transcript==
:[Science Girl, Ponytail and Cueball are jumping rope while singing a common playground song. Science Girl and Cueball are swinging the ends of the rope, Ponytail is jumping in the middle facing Cueball on the right. The rope is going so fast around her that it is drawn with four thin gray lines, one over and one below her and two in between, so they form a kind of 3D ellipsoid shape around her. Small lines indicate the movement of the rope and the hands that hold it.]
:Science Girl: Girls go to college to get more knowledge
:Science Girl: Boys go to Jupiter to get more stupider

:[Same scene but Ponytail is at a different moment in her jumping.]
:Cueball: Girls go to Ceres to get more theories
:Cueball: Boys go to Mars to get more jars

:[Same scene but Ponytail is at a different moment in her jumping.]
:Ponytail: Girls go to Eris to get more ferrous
:Ponytail: Boys go to Triton to get more chitin

:[The three have stopped playing so the rope is hanging from the hands of Science Girl and Cueball, running along the ground beneath Ponytail's feet. She is now just standing but has turned towards Science Girl.]
:Science Girl: Girls go to...Mercury...to...meet Tim Berners-Lee
:Science Girl: Boys go to... ...Betelgeuse...to get more... ...pamplemousse
:Cueball: I think we're done.

{{comic discussion}}

[[Category:Comics featuring Science Girl]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring real people]] 
[[Category:Games]]
[[Category:Astronomy]]
[[Category:Food]]

112: Baring My Heart

2023-06-01T05:29:22Z

PaintspotInfez: ...Just say white.

{{comic
| number = 112
| date = June 7, 2006
| title = Baring My Heart
| image = baring_my_heart.png
| titletext = I'm just trying to explain, please don't be jealous! Man, why are all my relationships ruined by early 90's rappers?
}}

==Explanation==
[[Randall Munroe|Randall]] presents a logical diagram known as a {{w|Venn diagram}}, which illustrates the relationship between multiple sets. The diagram is usually used to illustrate the overlap between various sets. For example, a Venn diagram of "even numbers" and "numbers divisible by 5" would have 2, 4, 6, 8, 12… in one circle, 5, 15, 25… in another circle, and 10, 20, 30… in the intersection of the circles (as those numbers fit into both sets).

Here we have a three-set diagram that Randall has purportedly created to explain his feelings to his love interest. The three sets are:
# People who can always make him smile
# People he wants to spend the rest of his life with
# People who constantly show him new things to love about the world.

In the intersection of these three sets is "you" – his love interest; all three of these statements apply to them. Normally, this might be a cute way of simply implying that he has these three feelings about them, without including any other elements in any of the sets.

Here, however, Randall has included one other element: {{w|Vanilla Ice}} is shown to also constantly show Randall new things to love about the world, and to be someone Randall wants to spend the rest of his life with (although Vanilla Ice doesn't always make him smile).

{{w|Vanilla Ice}} is a {{w|White Americans|white}} {{w|United States|American}} {{w|Rapping|rapper}} who was most popular in the early {{w|1990s}} with his song "{{w|Ice Ice Baby}}." He was frequently mocked as a very "white" rapper. He is obviously an unexpected name to turn up in this diagram.

Apparently, Randall's love interest didn't take too well to Randall professing similar feelings for Vanilla Ice as he did for them, causing some friction in their relationship. The title text suggests that other '90s rappers have similarly affected Randall's past relationships.

Vanilla Ice also appears as an element of a romantic situation in [[159: Boombox]].

==Transcript==
:[A Venn diagram with three sets]
:Description of set 1: People who can always make me smile
:Description of set 2: People who constantly show me new things about the world
:Description of set 3: People I want to spend the rest of my life with
:Intersection point: YOU.
:Intersection of sets 2 and 3: Vanilla Ice
{{comic discussion}}
[[Category:Venn diagrams]]
[[Category:Romance]]
[[Category:Comics featuring real people]]

2661: Age Milestone Privileges

2022-08-27T06:18:22Z

PaintspotInfez: /* Explanation */ {{Citation needed}} on whether age rolls over.

{{comic
| number = 2661
| date = August 19, 2022
| title = Age Milestone Privileges
| image = age_milestone_privileges.png
| titletext = If you reach 122, you get complete unrevertible editorial control over Jeanne Calment's Wikipedia article.
}}

==Explanation==
{{incomplete|Created by a BABY GOD-EMPRESS MAKING THE PRESIDENT'S LETTER R-RATED - Please change this comment when editing this page. Do NOT delete this tag too soon.}}

This is a list of "age milestones" in the United States. As usual for Randall, he has added many fictional entries to supplement some real life ones. The real milestones are the ages at which Americans are generally allowed to do certain things for the first time. These are a mix of legal restrictions (such as the age for driving and voting), rules from private companies (such as movie theaters and car rental companies) and medical guidance (like the shingles vaccine).

{| class="wikitable"
! Age || Privilege || Real? || Description
|-
| 16 || Drive || Yes || Legal driving age in the US is set by the individual states, but the general rule is that Americans are allowed to begin driving on public roads at age 16. There are various levels of restrictions on this privilege, however. In Randall's state of {{w|Driver's licenses in the United States#Licenses for adults and minors; GDL laws|Massachusetts, and in 8 other states}}, 16 is the minimum age to apply for a learner's permit. {{w|Driver's licenses in the United States#/media/File:Restricted license age requirements by US state.svg|In most of the country, 16 years is the minimum age for a restricted driver's license.}}
|-
| 17 || Attend R-Rated movies alone || Yes || In the US, the Motion Picture Association assigns {{w|Motion_Picture_Association_film_rating_system|ratings}} to movies based on whether they consider the film's content to be suitable for children. In this classification, "R" stands for "restricted", and the guidance from the MPAA is that no one under the age of 17 should be allowed to see it if not accompanied by a parent or legal guardian. It should be noted that this guidance does not have force of law, but is sufficiently accepted that nearly all US theaters adopt it as a policy.
|-
| 18 || Vote || Yes || The Twenty-sixth Amendment to the United States Constitution prevents a minimum age of voting from being set above eighteen, meaning that eighteen-year-olds are old enough to legally vote anywhere in the country. Some states allow 17-year-olds to vote in primaries if they will turn 18 before the general election, but Randall's state of Massachusetts is not one of them.
|-
| 21 || Buy alcohol || Yes || While individual states have official power over the drinking age, the {{w|National Minimum Drinking Age Act}} restricts federal funding from states that do not enforce a drinking age of 21 years. This has resulted in a ''de facto'' national drinking age of 21 in the US, which is higher than most countries. It should be noted that some states allow minors to drink alcohol under certain circumstances, but no state allows anyone under 21 to buy alcohol.
|-
| 25 || Rent a car || Generally || Car rental companies set their own age restrictions on renting cars. The industry standard in the US is to charge a higher rate for drivers under the age of 25. Thus, there was not a "prohibition" per se, but 25 is a milestone for "regular" rates and fees on car rentals.
|-
| 30 || Run for Senate || Almost || This entry is slightly incorrect: According to {{w|Article_One_of_the_United_States_Constitution#Clause 3: Qualifications of senators|Article 1, Section 3, Clause 3 of the U.S. Constitution}}, one must be at least 30 years old in order to ''become'' Senator, not ''run'' for Senate. For example, Joe Biden was 29 years old when he was first elected to Senate but turned 30 before being sworn in.
|-
| 32 || Rent a Senator's car || No || This is the first joke entry in the table. For one thing, most Senators do not rent out their cars, which they probably need to use regularly themselves because they have jobs{{Citation needed}} to commute to, and it would be a security hazard to allow random strangers access to their vehicle.

This could also be a reference to the Ambassador, a now defunct car brand.
|-
| 35 || Run for president || Almost || In the United States, according to {{w|Article Two of the United States Constitution#Clause 5: Qualifications for office|Article 2, Section 1, Clause 5 of the U.S. Constitution}}, a person must be at least 35 years old to be eligible to hold the Office of President. Similar to the age 30 entry, this is slightly incorrect. However, unlike the Senate case, this technicality has not been relevant for anyone elected as United States president—at least not yet (as of 2022).
|-
| 40 || Rent a flying car || No || A 25-year-old might be able to rent a non-flying car today, but not a flying car, because the technology is not mature enough to the point where they're available to rent. The joke is that by the time a 25-year-old reader becomes 40, the technology will exist and they'll be able to rent a flying car. Unlike the earlier lines, the limitation has nothing to do with their age, just technological development.
Alternatively, even once flying cars are developed, their usage will be more restricted. For example, young people are perceived to be more reckless and/or otherwise dangerous.

This whole issue may be virtually negated if the newly developed flying cars are introduced only as ''self-''flying cars (an off-shoot of self-driving technology but devoid of many of the dangers of navigating roads, i.e. person-controlled vehicles, pedestrians and other ground-based hazards), in which case the age (or even presence) of the renter may be very much more irrelevant than the nature of any route/destination the guidance computer is tasked to fulfill. The question would then be how much a potential passenger would trust pure electronics to avoid all the actual dangers for what is essentially a flying taxi, compared to a human controller who may be fallible but presumably at least has their own fully developed common sense and a degree of self-preservation as well as any requisite training.
|-
| 45 || Learn about the God-Empress || No || Obviously, the God-Empress does not actually exist because this comic is visible to people under 45 years old.{{Citation needed}} According to [[1413]], she will be public knowledge by 2040 anyway.
|-
| 50 || Join AARP || Yes || Full {{w|AARP}} (formerly called the American Association of Retired Persons) membership is available to anyone age 50 and over. Officially, there are no age restrictions to membership, but members under the age of 50 do not have access to full benefits.
|-
| 50 || Get a shingles vaccine || Recommendation || At the time of the comic, the [https://www.cdc.gov/vaccines/vpd/shingles/public/shingrix/index.html CDC recommended] that adults 50 years and older get the shingles vaccine called Shingrix (this line was not in the original version of the comic, corrected later)
|-
| 52 || Click to skip captchas || No || Older people might have more difficulty understanding [[:Category:CAPTCHA|captchas]]. Also, they could be more inconvenienced because some older people move more slowly, so it would take them longer to move the mouse, and people would care more about older people anyway. However, this would be impractical to implement because if the computer knew the person's age, it would know that the user is a person, not a bot, so there would be no point in a captcha anyway.
|-
| 55 || Vote for God-Empress || No || It appears that a person must have knowledge of the existence of the God-Empress for ten years before they are sufficiently qualified to elect a new one. Since the God-Empress is (presumably) in power for life, it is likely that most people would have to wait much longer than ten years.
|-
| 62 || $80 national parks lifetime pass || Yes || The US National Parks Service has a [https://www.nps.gov/planyourvisit/passes.htm lifetime membership pass] for Americans ages 62 and over, which allows access to national parks and other areas managed by the NPS.
|-
| 65 || Eligible for Medicare || Yes || {{w|Medicare (United States)|Medicare}} is a US government-run health insurance for older people, and indeed begins eligibility at age 65 for the general public.
|-
| 67 || Collect Social Security || Yes || {{w|Social Security (United States)|Social Security}} is a system of benefits for retired individuals, disabled persons and widows/widowers. U.S. individuals may collect reduced Social Security benefits starting at age 62, and they can collect increased Social Security benefits if they wait until age 70. 67 is considered "Full Retirement Age." There is some debate about whether one would be better off waiting or taking it right away, but for most people Full Retirement Age (67) is at least close to optimal.
|-
| 68 || See "Skip ads" button on live TV|| No || Some DVRs and streaming applications have a feature to skip over commercial breaks in recorded programs, but this could not be available in live TV, since it would require jumping forward in time. Time travel is currently impossible.{{citation needed}}
|-
| 70 || Run for God-Empress || No || The name suggests that this would also only be available to women.
|-
| 75 || Ride any animal in a national park || No || The National Parks Service probably could institute this relatively safely because most people over 75 would not be able to run fast enough to outrun/catch up to an animal and mount it{{Citation needed}} and would not have the rebellious/risk-taking/adventurous streak that would incline them to try.{{Citation needed}}
|-
| 80 || Eligible for Megacare || No || This is based on becoming eligible for Medicare at age 65.
|-
| 85 || Click to toggle whether an ad is positive or negative about the product || No || In line with previous milestones regarding advertisements, this implies the ability to control reality and change the mood of the ad one is watching as it is running. Obviously, this is impossible, but could potentially be pulled off by adding an option to change the ad to another ad about the same product, but with the opposite viewpoint of the product. Ignoring the issue that ads that are just negative about a specific target don't tend to be commissioned. Except perhaps in certain areas of political campaigning. Furthermore, the wording appears to imply the new ad is the same as the one you were watching previously, ie. same actors, rather than a different ad about the same product.
|-
| 90 || Click to make any movie R-rated || No || It is unclear whether this would actually make the movie less appropriate or change the Motion Picture Association's rating to be erroneous. Also, what if the rating was previously NC-17?
|-
| 100 || Get a letter from the president || No || In the US (which other milestones, such as running for president starting at age 35, indicate is the country being referred to), you can instead get [https://www.today.com/series/today-celebrates/celebrate-today-ask-al-roker-wish-your-loved-ones-happy-t69606 congratulated] by the weatherman ({{w|Al Roker}}) on the {{w|Today (American TV program)|Today Show}}. However, the United Kingdom is much closer. People there can [https://www.royal.uk/anniversary-messages-0 apply to receive a card] (formerly a telegram, later a TeleMessage) from the Queen on their 100th birthday.
|-
| 102 || (35+67) Collect a presidential pension || No || The idea behind this joke is that it is the minimum age of presidency plus the minimal age to collect Social Security. There are several reasons why this must be a joke. Two are that Social Security begins 67 years after the person was born, not 67 years after the person's job started, and that the United States government would not bother to set up such a system because the vast majority of people, including former presidents, do not live to 102 years old. In fact, as of 2022, no former United States president has ever lived to 102 years old. The current oldest former U.S. President is Jimmy Carter at 97. Good luck Jimmy, only 5 more years!
|-
| 105 || Get a birthday card from the God-Empress || No || Being a God-Empress would be more important than being the leader of a single country. This would make the God-Empress's time more valuable, so she only has to send a birthday card to the few people who reach the age of 105. Contrariwise, the God-Empress is presumptively all-powerful and furthermore capable of delegation of ministerial tasks such as card transmission, so the utilitarian fact that the scarcity of 105-year-old people reduces workload is not a plausible justification.
|-
| 111 || Leave your own birthday party early by putting on a magic ring || No || This is a reference to the Lord of the Rings where Bilbo leaves his eleventy-first birthday party (the Bilbo Baggins Farewell Birthday Party) invisibly by using The One Ring.
|-
| 118 || Vote 100 times || No || Presumably a joke meaning the person can now cast 100 votes, for each election issue that a younger person can only vote for once, giving their opinion a vastly increased personal weight (or subtlety, if they vote more across the board than merely grant 100 votes to the same outcome), although it may not greatly change the result unless sufficient voters exist (of a like mind) to disproportionately swing the result towards the result desired more by these elder voters than their one-vote juniors.
It is the 100th anniversary of their having (potentially) first voted, and as such is a century milestone. But if there were exactly one election at the same time each year, the first vote on or after their birthday would actually be the 101st vote the person has been eligible to cast in their lifetime. If the sole election of each year were held at a different time of each year, someone who voted in every election might vote for the 100th time at either age 116, 117, or 118. However this milestone would happen earlier because there are often multiple elections per year, e.g., primaries, general elections and possibly runoffs. There may also be several reasons why the person may not have been given the opportunity to vote every year since they were 18, e.g. prior to the {{w|Nineteenth Amendment to the United States Constitution|women's suffrage}} being officially ratified barely 100 years ago, but most importantly that the mandated minimum voting age was 21 until {{w|Twenty-sixth Amendment to the United States Constitution|much more recently}}.
|-
| 120 || Collect the pensions of all elected officials || No ||
|-
| 125 || Drink alcohol in an R-rated movie while getting a shingles vaccine from the president || No || This entry references four earlier milestones (attending an R-rated movie, drinking alcohol, becoming President, and getting the shingles vaccine) whose corresponding ages (17, 21, 35, and 50) sum to 123. While not exactly 125, this may have contributed to the inspiration or age selection of this milestone.
|-
| 128 || Age rolls over, become a baby again || No{{Citation needed}} || {{w|Integer overflow}} happens in computers when there are not enough bits (binary digits) to store the result of a calculation, and typically happens in computers at a given power of two, such as 128. An unsigned 7-bit number can hold the values 0 to 127 (127 being 27 - 1) and an attempt to go beyond 127 will overflow, also called rollover, back to zero. 7-bit numbers are not common native values in today's computers. For the more usual integers of one byte (8 bits), while a signed byte would roll over after 127, it would typically rollover to -128 rather than to zero, whereas an unsigned byte would rollover to zero but not until after 255.

A signed 8-bit number uses the first bit to allow the value from the remaining seven to be negative, the value 128 would become either -128 or -0, depending upon implementation. In its most practical form, a signed 8-bit number can hold values from -128 to 127 and when calculating 127+1 (the binary value 01111111 changing to 10000000) the value is -128 due to the {{w|Two's Complement}} method of having the sign-bit represent the most negative value possible, which is generally a more utilitarian method than the 'simpler' method of using it to indicate the positivity/negativity of the value. Either way, though, this means you could have a weird experience of your next phase of life, as your age now is interpreted as successive negative values if the incrementing algorithm and the interpreting algorithm are not thinking about the raw bits in the same way, or at least flagging up the overflow as having happened.

However, maybe the system uses just 7 bits (the 8th bit often used to be reserved for parity, or other flagging purposes, and otherwise stripped/ignored) if it has never before needed an eighth bit and this had once seemed like a sufficient form of data-packing with no expectation that this limit would be reached. Computers using such systems would have a Y2K-analogous bug once someone actually reached 128 years old, where anomalous processing might indicate the person to be a baby (or fail in other ways). But that would not have happened yet.

|}

The title text mentions {{w|Jeanne Calment}}, who holds the record for the oldest person ever (there are biblical references to older people, such as {{w|Methuselah}}, who supposedly lived to 969, but their ages haven't been verified). She reportedly was age 122 when she died in 1997. There's some controversy whether Calment actually claimed her mother's records, including birth certificate, as her own. "Editing wars" have been fought over her Wikipedia page. Randall claims that if you match her age you get sole editorial control over that article. However, if anyone managed to exceed her achieved age, presumably they would get their own page (albeit that they should not be encouraged to {{w|Wikipedia:Editing Your Own Page|edit it}} themselves) and hers would cease to be as interesting - although that might depend on what use is made of the unparalleled editorial control now granted.

==Transcript==

<big>Age Milestones</big> 
and associated privileges

16  Drive 
17  Attend R-rated movies alone 
18  Vote 
21  Buy alcohol 
25  Rent a car 
32  Run for senate 
35  Run for president 
40  Rent a flying car 
45  Learn about the God-Empress 
50  Join AARP 
50  Get a shingles vaccine 
52  Click to skip captchas 
55  Vote for God-Empress 
62  $80 National parks lifetime pass 
65  Eligible for Medicare 
67  Collect Social Security 
68  See "Skip Ads" button on live TV 
70  Run for God-Empress 
75  Ride any animal in a national park 
80  Eligible for MegaCare 
85  Click to toggle whether any ad is positive or negative about the product 
90  Click to make any movie R-rated 
100  Get a letter from the president 
102  (35+67) Collect a presidential pension 
105  Get a birthday card from the God-Empress 
111  Leave your own birthday party early by putting on a magic ring 
118  Vote 100 times 
120  Collect the pensions of all elected officials 
125  Drink alcohol in an R-rated movie while getting a shingles vaccine from the president 
128  Age rolls over, become a baby again

{{comic discussion}}
[[Category:CAPTCHA]]
[[Category:Politics]]
[[Category:Comics featuring real people]] 
[[Category:Wikipedia]]

2299: Coronavirus Genome 2

2022-05-24T17:19:15Z

PaintspotInfez: For some reason, this page (after the vandalism's been reverted) still doesn't appear in the category — a null edit should fix this.

{{comic
| number = 2299
| date = April 27, 2020
| title = Coronavirus Genome 2
| image = coronavirus_genome_2.png
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.
}}

==Explanation==
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|COVID-19 pandemic}}.

It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].

[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].) If his post catches on and is widely shared, it might be described as "going viral".(This "virtually" spreading the {{w|COVID-19|coronavirus}}, would be a prank).
Additionally while exchanging research data generally is as good an idea as using readymade tools for science publishing the genome of a dangerous virus actually might cause the virus to spread further: There are specialized manufacturers that can mail you arbitrary DNA snippets if you send them their sequence as an ASCII file. That actually can work in the other direction, too: Some of the machines used by such firms in order to save space stored a base pair in 4 bits of memory and could (using a buffer overrun) be convinced to actually try to execute instead of manufacturing the DNA code.

In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but is able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).

This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically. Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves). It could also be a reference to the ''{{w|The Hitchhiker's Guide to the Galaxy|Hitchhiker's Guide to the Galaxy}}'' series, in which humanity is revealed to possibly be the descendants of the "useless" occupants of the planet Golgafrincham, including telephone sanitizers; unfortunately, after sending their useless members to the planet later called Earth, the remaining Golgafrinchans were subsequently wiped out by a plague caught from an unsanitized telephone. This may also be a reference to the concept of digital data sanitization (the screening of user inputs to prevent exploitation of security flaws) as in [[327: Exploits of a Mom]].

The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to "like" your friend's posts, even if you think they're strange. Alternately, the "like" button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting). When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might "like" the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself. (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger). In this case, Megan "like"ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.

==Transcript==
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?
:Megan: Sure.
:Megan: ...Why?

:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]
:Cueball (off-panel): Nothing.
:Megan: I ... see.
:Megan: Well, here you go.
:Laptop: Click

:[In "two" frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square "speech bubble" with a "speech line" going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]
:Phone:
::GAAAGGTAAGATGGAGAGGCCTTGTCCCTGGTTCAACGAGAA
::-29,602 (+) Tweet

:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.
:Megan: Unsettling that your first instinct is "share it online."
:Cueball: It's cool, I sanitized my phone before posting.

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Coronavirus Genome]]
[[Category:Comics sharing name|Coronavirus Genome]]
[[Category:COVID-19]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Biology]]
[[Category:Social networking]]

579: The Race: Part 3

2022-05-05T01:31:55Z

PaintspotInfez: Undo revision 264690 by 172.70.211.26 (talk) Stop.

{{comic
| number = 579
| date = May 6, 2009
| title = The Race: Part 3
| image = the_race_part_3.png
| titletext = No, the best things about The Sarah Connor Chronicles were: (1) watching Sarah and Cameron try to pass for normal, and (2) Cameron throwing people and things through walls. Everything else was pretty secondary.
}}

==Explanation==
''{{w|Firefly (TV series)|Firefly}}'' was a television series aired by Fox in 2002 that got cancelled midway through, but it has a large fan base nowadays (for a more comprehensive explanation, see the Wikipedia page). The star of the show was Captain Malcolm (or Mal) Reynolds, played by {{w|Nathan Fillion}}. Other members of his crew were Kaylee (played by {{w|Jewel Staite}}), the ship's mechanic, Inara Serra (played by {{w|Morena Baccarin}}) was a Companion (or, as Mal would say: whore) that helped ''Serenity'' (the spaceship) gain a landing on many planets that otherwise would have nothing to do with Mal. River Tam (played by {{w|Summer Glau}}) was the seemingly crazy younger sister of Dr. Simon Tam (played by {{w|Sean Maher}}), and due to her latent psionic powers and the damage from the experiments she had undergone, she was known for making odd, out-of-context statements.

When [[Cueball]] is introduced to the first two women, he learns that they behave in real life as on the Firefly show (Summer is strange and Jewel is a mechanical wiz) - this is why he begins to ask about Morena Baccarin, and also why the other two says '''no.''' before he can finish the question ''is she really a '''prostitute'''?''

In the last panel, Kaylee apparently wired up Mal's controller to broadcast on the frequency of Cueball's skateboard, so it took control of his board, where Mal's stood still. (Buy a few RC models ({{w|Radio-controlled model}}) to play with friends and inevitably this will happen. Where two controllers broadcast on the same frequency, so the two models are confused by the signals they receive.)

''{{w|Terminator: The Sarah Connor Chronicles}}'' was a television series aired by Fox from 2008-09. Summer Glau played the role of Cameron, a Terminator; Cameron was played in a distinctly "strange" manner as a humanoid robot who finds much about humanity puzzling. Combined with her role as River Tam, the joke is that it wasn't Summer's characters who were eccentric, but that Summer Glau ''herself'' is actually just as strange and eccentric as she is shown to be on screen.

All comics in "[[The Race]]" series:
*[[577: The Race: Part 1]]
*[[578: The Race: Part 2]]
*[[579: The Race: Part 3]]
*[[580: The Race: Part 4]]
*[[581: The Race: Part 5]]

This series was released on five consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.

Electric skateboards have been the subject of several other comics like [[139: I Have Owned Two Electric Skateboards]], [[409: Electric Skateboard (Double Comic)]] and a panel in [[442: xkcd Loves the Discovery Channel]].

==Transcript==
:[Nathan, Cueball, and Summer Glau standing around with electric skateboards.]
:Nathan: Meet a few of my friends. This is-
:Cueball: Summer Glau! You were the best part of ''Chronicles''.

:Summer: I eat my bodyweight in food every 31 days. That's slightly faster than the human average.

:[Summer stares off into space.]

:Nathan: Yeah, there's a reason she only plays strange roles.
:Cueball: Ah.
:Summer (from below): I'm part of the floor now.

:[They find Jewel Staite working on a skateboard's engine.]
:Nathan: And this is Kaylee.
:Jewel: My name is Jewel, Nathan.

:Nathan: Kaylee—
:Jewel: ''Jewel''.
:Nathan: —Jewel is fixin' up my new board.
:Jewel: Almost done!

:Cueball: So wait. Summer's actually weird, Jewel's actually a mechanical whiz...

:Cueball: ...will Morena Baccarin be here? Is she really a—
:Nathan and Jewel: No.

:The racers set up
:[Nathan and Jewel are to the far left of a full-width panel. Nathan is standing on his skateboard holding a controller. Cueball is on his skateboard which is careening out of control on the far right of the panel.]
:Nathan: Kaylee, I've been gunnin' the radio hand throttle thingy for a while, but it ain't movin'.
:Jewel: Oh, I must've set it to the wrong frequency!
:Cueball (riding around on haywire board): ''AAAAAAAA''

{{comic discussion}}

[[Category:The Race]]
[[Category:Comics sharing name|The Race]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Jewel Staite]]
[[Category:Comics featuring Nathan Fillion]]
[[Category:Comics featuring Summer Glau]]
[[Category:Firefly]]
[[Category:Electric skateboard]]

106: Wright Brothers

2022-05-05T01:31:45Z

PaintspotInfez: Undo revision 264689 by 172.70.211.26 (talk) Undid.

{{comic
| number = 106
| date = May 24, 2006
| title = Wright Brothers
| image = wright_brothers.png
| titletext = I'm not sure if this is actually true.
}}

==Explanation==
The {{w|Wright brothers}} are Orville and Wilbur Wright, who are credited with the invention of the {{w|airplane}} and the first "controlled, powered, and sustained heavier-than-air human flight" in 1903.

[[Cueball]] mentions to [[Megan]] that the Wright Brothers would sometimes argue each other's point during debates in order to "encourage a more balanced debate" – presumably so both brothers would explore all of the arguments on both sides. Megan is initially against the idea, stating that treating emotionally-charged personal issues as if they were academic debates would not work. Cueball argues that it would force each person to consider the other's point of view. However, when Megan reconsiders, accepts his argument, and appears to agree that they should try it, Cueball abruptly switches his position to thinking that it's a terrible idea. The joke is that once Megan agrees with him, he employs his Wright Brothers suggestion and takes her initial position that the idea was bad. Thus, the two have switched their arguments and are now exploring the other sides. They may continue in this way to form a well balanced conclusion on the proposal or continually switch sides without ever concluding the argument.

The title text suggests that [[Randall]] may either be misremembering the fact that the Wright brothers used this technique, or not be convinced that the source is reliable, but has decided to assume it is true just so that he could make the joke in this comic.

==Transcript==
:[Cueball and Megan are talking to each other.]
:Cueball: I've heard that when the Wright brothers argued, they periodically switched sides in the debate to try to encourage a more balanced conclusion.
:Cueball: We should try that in our relationship!

:Megan: It's a neat idea, but I think treating personal issues like a debate will only engender hostility and hurt feelings.

:Cueball: No, I think it would help, by forcing us to consider the other person's point of view.

:Megan: Hmm, maybe you're right.
:Cueball: Am not. It's a bad idea.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Romance]]

1792: Bird/Plane/Superman

2022-05-05T00:00:12Z

PaintspotInfez: Not sure why this comic isn't showing up in the category (and, thus, making the number of comics inaccurate), but I think a null edit like this would fix it

{{comic
| number = 1792
| date = January 30, 2017
| title = Bird/Plane/Superman
| image = bird_plane_superman.png
| titletext = You can apply special translucent films to your windows to help keep birds/Superman from accidentally flying into them.
}}

==Explanation==
This comic is a logical comparison of observations to resolve the [http://www.imdb.com/title/tt0034247/quotes?item=qt0317455 classic Superman catchphrase] of comic book bystanders: "Look, up in the sky... It's a {{w|Airplane|bird}}!... It's a {{w|Bird|plane}}!... It's {{w|Superman}}!", hence the title. Superman, a character originally created for comic books in the 1930s, is an alien with superpowers, including the power of unaided flight; hence the catchphrase exclaiming peoples' amazement.

At the correct distance both birds, planes and the fictional Superman could be mistaken for each other. So this comic aims to help people identify the airborne object by listing on which properties they are alike and on which they are different. This problem was also mentioned in the title text of [[1633: Possible Undiscovered Planets]], putting Superman near the bird/plane boundary explaining why all this confusion has arisen.

The observations compared range from the mundane to the bizarre and they are listed and explained below in the [[#Table|table]]. Here some highlights are mentioned, but for all these there are much more detail below.

Some of the mundane observations are that birds don't fly around with people, while Superman can do it, and planes are meant for it; and that the latter two are new "inventions", whereas birds have flown around for millions of years.

Interestingly enough there are actually two observations that have check mark for all three; the first being that there are enthusiasts for all three different flying objects. And these will obsess over small color details in otherwise similar looking objects. The other common thing is that they all may have sex in midair. The possibility of that happening for the all three are discussed in the table.

Three observations only counts for birds, where all those that do not count for birds do count for both planes and superman. Two of these relates to the fact that birds are eaten by cats and humans, the last is that birds flap their wings to fly, the others have other means of flight. There are observations that rules out only planes or only superman, but none that rules out only one of them at the same time as birds are ruled out.

There are also three direct jokes towards the bottom. The first is that {{w|David Attenborough}} may also have observed Superman's mating habits just like he has with birds in the documentary series {{w|The Life of Birds}}. The second is that not only birds poop in flight, but that Superman could and would also do so. And the third (and also final observation) is that not only birds chase insects to eat them, but Superman also chases them... though only when he is bored. These last three observations have that in common that the planes are left out of all of them, and the joke is always on Superman. As it has been before in [[1384: Krypton]] and [[1394: Superm*n]] (released just ten comics apart).

The title text refers to black stickers (decals) in the shape of an easily recognizable predatory bird, like {{w|falcons}}, to enhance the visibility of clear glass windows or doors and scare smaller birds away before they crash into the window. This may actually not work very well according to this article: [https://www.allaboutbirds.org/why-birds-hit-windows-and-how-you-can-help-prevent-it/ Why Birds Hit Windows], where a falcon decal is also shown. But they are meant to warn birds away and according to this comic they could also prevent Superman from flying through your window (and thus also stop him from possibly just continuing through the building). They are not known to affect the risk of airplanes flying into the building.{{Citation needed}}

===Table===
{| class="wikitable"
!style="width: style="width: 55%;"| !!style="width: style="width: 15%;"| Bird !!style="width: style="width: 15%;"| Plane !! Superman
|-
!colspan=4| Explanation
|-
! Carries people || || ✓ || ✓
|-
|colspan=4| Some birds are capable of flying off while carrying a small human away, but this happens extremely rarely (although hoax stories are often reported). An {{w|Ostrich}} can easily carry a human; and this happens regularly in arranged {{w|Common ostrich#Racing|races}}. The context of the strip implies that it's referring to birds in flight, so flightless birds like ostriches are ignored.

Most planes are specifically designed to carry human passengers, although many are cargo planes with humans only acting as crew, and autonomous drones without humans also exist.

Superman often carries other people with him, such as his {{w|Lois Lane|girlfriend}}, rescued victims or the various villains that people need to be rescued from.
|-
! Often flies in groups || ✓ || ✓ ||
|-
|colspan=4| Many types of birds fly in flocks, particularly during long-range {{w|Bird migration|migrations}}. Some birds often fly in the {{w|V formation}} which has also been {{w|V formation#Military flight missions|copied by planes}}. This formation has been used at least twice in xkcd in [[1440: Geese]] and recently in [[1729: Migrating Geese]] (notice the similarity in number of that bird comic compared to the one for this comic).

Planes sometimes fly in {{w|Formation flying|group formation}}, particularly when engaged in military operations where mutual support is tactically useful (or when conducting practice maneuvers for such operations). Though the people who would mistake those planes for birds will mainly see this at {{w|air show}}s.

Superman is a unique person, and thus does not fly in groups at all. While Superman occasionally operates alongside other flying superheroes, and in some stories is duplicated or split into multiple beings, Randall apparently considers these circumstances too unusual to meet the "often" qualifier.
|-
! Created in 20th century || || ✓ || ✓
|-
|colspan=4| Birds evolved from dinosaurs, appearing as early as the Late Jurassic period, roughly 150 million years ago. That birds evolved from dinosaur who also had wings with feathers before they evolved on to becoming birds has often been referenced by Randall in comics like [[1104: Feathers]], [[1211: Birds and Dinosaurs]] and the title texts of [[867: Herpetology]] and [[1527: Humans]].

The {{w|Wright Flyer#Flight trials at Kitty Hawk|first successful flight}} of a powered heavier-than-air craft took place on December 17, 1903 and was performed by the {{w|Wright brothers}}. There are several other claims for the first such flight, but few are from before the 20th century, and those are generally considered to be unreliable.

Superman first appeared in {{w|Action Comics 1|''Action Comics'' #1}}, published in June 1938.
|-
! Uses magnetic navigation || ✓ || ✓ ||
|-
|colspan=4| Some types of birds use {{w|magnetoreception}} to navigate using the earth's magnetic field as a guide.

Artificial {{w|Compass#Magnetic compass|magnetic compasses}}, along with other navigational equipment, are used by planes.

Superman, while possessing a {{w|Powers and abilities of Superman|plethora of super-senses/powers}}, does not appear to be particularly sensitive to {{w|magnetism}}.
|-
! Enthusiast community obsesses over small coloration details || ✓ || ✓ || ✓
|-
|colspan=4| {{w|Birdwatching|Birdwatchers}} identify bird species by a range of characteristics, including small details in the bird's color pattern which identify one species apart from another.

Similarly, airplane hobbyists and {{w|Aircraft spotting|plane spotters}} take note of the colors of a plane's paint job and insignia.

Comics fans can similarly identify the artist and date of a depiction of Superman by the coloration and configuration of his costume and be obsessed with their favorite coloration being the canon.
|-
! Preyed on by cats || ✓ || ||
|-
|colspan=4| {{w|Cats}} kill several billion birds a year, often - but not always - eating them.

There has never been a case of a cat successfully catching and eating a plane.{{Citation needed}}

As Superman is a fictional character the same goes for him, but also in the comics he has never been eaten by a cat, although he has been [http://www.themarysue.com/wp-content/uploads/2011/03/power-girl-22.jpg devoured by a dinosaur] although that (probably) did not kill him...
|-
! Occasional mid-air sex || ✓ || ✓ || ✓
|-
|colspan=4| Almost no bird species have sex in flight. Hummingbirds, for example, engage in courting behavior which one might falsely identify as sex (explained in this article [http://animals.howstuffworks.com/birds/hummingbird-sex1.htm Do hummingbirds have sex in midair?]). This article [http://www.livescience.com/38379-animal-sex-bird-sex.html Animal Sex: How Birds Do It] explains how birds in general have sex. However, this article [http://www.commonswift.org/Aerial-mating.html Aerial mating] points out that the common swift (Apus apus) engages in mid-air sex, an act presumably caught on video [https://vimeo.com/78453839 here].

{{w|Mile high club|Mid-air sex}} involving planes usually involves passengers (and potentially air crew), not the plane itself. However, this could also be a metaphorical reference to {{w|Aerial refueling|in-flight refueling}} (such as the depiction, set to romantic music, in [https://www.youtu.be/Qs7EikHQGlA the opening scene] of the movie ''{{w|Dr. Strangelove}}'', a movie Randall has referenced before for instance in [[Media:1608 1020x1083y Torpedoes two steps above Runner with Beret Guy.png|this scene]] from [[1608: Hoverboard]]) It could also refer to [http://avstop.com/news/plantcity.html this incident] where one plane landed atop another in mid-air.

As for Superman, there have been occasional moments in the comics which indicate or at least imply that he sometimes engages in mid-air sex.
|-
! Eaten during seasonal feasts || ✓ || ||
|-
|colspan=4| {{w|Turkey (bird)|Turkeys}}, a type of bird, are eaten by Americans during {{w|Thanksgiving}}, a "seasonal feast" held on the fourth Thursday of November of each year. Britons eat Turkey or {{w|Goose}} at {{w|Christmas}}, in other countries it may be {{w|ducks}} instead.

It is unlikely that normal humans would eat a plane, however it has been done by {{w|Michel Lotito}} who has digested an entire {{w|Cessna 150|Cessna}} aircraft. However he used two years to consume the plane, so although he may have eaten some parts during holidays, he did not do it because there was a seasonal feast.

Superman is too strong and "made of steel" for him to let any human eat him. But as also mentioned above he has been [http://www.themarysue.com/wp-content/uploads/2011/03/power-girl-22.jpg devoured by a dinosaur] although that probably did not kill him, and does not seem to be linked to a holiday.
|-
! Propelled by flapping || ✓ || ||
|-
|colspan=4| Birds fly by flapping their wings.{{Citation needed}}

Planes have fixed wings, and fly by maintaining forward velocity and exploiting the aerodynamic effects of air flowing over the upper and lower wing surfaces, which are shaped and angled to produce lift. However some experimental designs for some of the earlier planes made such as {{w|Leonardo Da Vinci}}'s Flying Machine that was propelled by flapping.

Superman flies using superpowers which require neither wings nor flapping.
|-
! Sometimes loses ability to fly, needs to sunbathe to regain it || ✓ || || ✓
|-
|colspan=4| Birds can "lose" the ability to fly, if their wings are weighed down by water from swimming. One way for birds to dry out their wings is to [http://birding.about.com/od/birdbehavior/a/Bird-Sunning.htm sunbathe].

An airplane can lose its ability to fly, but no issues occurring in modern aircraft can be fixed by sunbathing, except in some {{w|Solar Impulse|experimental solar-powered aircraft}}.

As for Superman, he is at risk of losing his superpowers, including flight, with prolonged exposure to {{w|Kryptonite}}, which makes him weak. Also the rays from the sun at his home planet {{w|Krypton (comics)|Krypton}} can {{w|Superman II#Plot|remove his super powers}} as it happened in ''{{w|Superman II}}''. Superman's ability to fly is a superpower caused by "electromagnetic radiation from the rays of a yellow sun", so he could regain his strength and superhuman abilities through sunbathing in the {{w|Sun|Sun's}} light here on Earth. Which was how he got his super powers in the first place.
|-
! Can take a punch || || ✓ || ✓
|-
|colspan=4| Many birds are small and fragile creatures, whose {{w|Bird anatomy#Skeletal system|bone structures}} are meant to be light in order to fly, and thus are not very durable. If a man punched, say, a {{w|pigeon}}, he could probably break/dislocate most of its bones, either killing it immediately or leaving it in a state from which it will probably never ever recover on its own. However, there are definitely some big, {{w|flightless birds}} that could take a punch from a human such as ostriches and {{w|emus}}, but since both are large creatures that would probably react by fighting back, it would not be wise to try. Also Randall is (again) plainly ignoring this type of birds as they cannot fly and this comic is about making mistakes regarding things flying through the air (typically far enough away from the observer to mistake a pigeon for a plane).

Planes are usually massive, or at least big enough to carry a human, and their structure is composed of fairly solid metals. A human punching an airplane is unlikely to result in significant damage (to the plane, at least, the human's hand is a different story.)

One of Superman's (the {{w|Man of Steel (film)|Man of Steel}}) trademark abilities is his near indestructibility; a punch from any regular human would not hurt him, but again hurt the hand.
|-
! Mating behavior often observed by a hidden David Attenborough || ✓ || || Not that we know of
|-
|colspan=4| {{w|David Attenborough}} is an English broadcaster and naturalist, who produced a documentary series ''{{w|The Life of Birds}}''. Included in the series is an episode entitled "Finding Partners", which discussed {{w|Bird#Breeding|mating rituals of birds}}. That these can be very strange has been mentioned in the title text of [[1747: Spider Paleontology]], of course in relation to Dinosaur behavior.

Planes are inanimate objects with no mating behavior.{{Citation needed}} However, referring back to the observations made under the ''Occasional mid-air sex'' explanation it could be discussed if this was mating behavior. Also there are movies like ''{{w|Planes (film)|Planes}}'' and its {{w|Planes: Fire & Rescue|sequel}} has living planes, which could mate. But Randall may know for sure that Attenborough is not interested in those.

The comic states that we don't know for sure if Attenborough has observed Superman's mating behavior. As Superman doesn't exist,{{Citation needed}} Attenborough has not seen Superman in reality (which would lead to a "No" response), but maybe Attenborough has watched all the movies or read all the comics in which Superman courts {{w|Lois Lane}} just to observe Superman's (made up) mating behavior (which would lead to a "Yes" response). Since we do not know Attenborough's habits, this leads to Randall giving the "Not that we know of" response.
|-
! Capable of ''intentionally'' releasing poop mid-flight || ✓ || || ✓
|-
|colspan=4| Birds often poop during flight, often enough that people regularly get hit in the head by the poop, which has caused the unlucky people to come up with the [http://thepetwiki.com/wiki/Pets_and_Superstitions superstition] that it brings good luck. For birds it is just economical to shed excess mass when they are going to fly, and many birds poop just at take off. But on long flights it the best use of resources to not carry extra weight along, that increases their efficiency. Unlike {{w|mammals}} who pee {{w|urea}}, {{w|Bird#Excretory system|bird poop}} is both pee and feces as birds only have one hole, a {{w|cloaca}}, and the black poop is surrounded by their pee which is the white stuff containing {{w|uric acid}}. Not peeing lots of water out reduces their water loss.

There have long existed urban myths about airplanes regularly discharging their septic tanks, resulting in blocks of blue ice crushing houses and people. This line refers to that myth, and the fact that it's untrue. A leaky septic disposal system can unintentionally discharge liquid waste while in flight, but this is not how the craft are designed.

As Superman's physiology is nearly identical to that of a human, he is in theory capable of voluntarily voiding his bowels at any time, including during flight. There would be little reason for him to do so, but he presumably has the ability to do so.
|-
! Chases and eats bugs || ✓ || || Only when bored
|-
|colspan=4| Many bird species prey on insects and similar-sized animals.

Planes often fly into and kill insects (as well as birds, and sometimes humans), but this is unintentional, planes never pursue the insects, and don't "eat" them any traditional sense.

Superman is not known for eating insects, but Randall implies that he may do so, but only when he's bored. This is a humorous suggestion that Superman engages in odd behavior for a lack of anything else to do.
|}

==Transcript==

{| class="wikitable"
! !! Bird !! Plane !! Superman
|-
| Carries people || || ✓ || ✓
|-
| Often flies in groups || ✓ || ✓ ||
|-
| Created in 20th century || || ✓ || ✓
|-
| Uses magnetic navigation || ✓ || ✓ ||
|-
| Enthusiast community obsesses over small coloration details || ✓ || ✓ || ✓
|-
| Preyed on by cats || ✓ || ||
|-
| Occasional mid-air sex || ✓ || ✓ || ✓
|-
| Eaten during seasonal feasts || ✓ || ||
|-
| Propelled by flapping || ✓ || ||
|-
| Sometimes loses ability to fly, needs to sunbathe to regain it || ✓ || || ✓
|-
| Can take a punch || || ✓ || ✓
|-
| Mating behaviour often observed by a hidden David Attenborough || ✓ || || Not that we know of
|-
| Capable of intentionally releasing poop mid-flight || ✓ || || ✓
|-
| Chases and eats bugs || ✓ || || Only when bored
|-
|}

{{comic discussion}}

[[Category:Charts]]
[[Category:Animals]]
[[Category:Comics featuring real people]]
[[Category:Sex]]
[[Category:Food]]
[[Category:Fiction]]

1752: Interplanetary Experience

2022-05-04T23:02:30Z

PaintspotInfez: Not sure why this comic isn't showing up in the category (and, thus, making the number of comics inaccurate), but I think a null edit like this would fix it

{{comic
| number = 1752
| date = October 28, 2016
| title = Interplanetary Experience
| image = interplanetary_experience.png
| titletext = But instead of hitting the ocean, you should land in an overheating hot tub on a sinking cruise ship, sending it crashing through the floor into the burning engine room as the ship goes under.
}}

==Explanation==
This comic lists ten {{w|celestial bodies}}: most other {{w|planets}}, the {{w|dwarf planet}} {{w|Pluto}}, as well as two {{w|moons}}, the Earth's {{w|Moon}} and {{w|Titan (moon)|Titan}} (the largest moon of {{w|Saturn}}). It then asks what places on Earth people could go to for a real '''Interplanetary Experience''', as if they were explorers on these planets. It turns out that none of these ten other worlds are very nice to visit...

This is a parody on organizations that in preparation for future planetary exploration organize half-realistic experiments in human behavior on other planets, trying to emulate or mock-up - often on low budget - the conditions in which future explorers are to live and work. For this purpose, they build mock-up bases, habitats etc. in places that ''look like'' other planets or have the environmental conditions ''somewhat'' similar to other celestial bodies' surfaces. They seek out desolate places like deserts or polar regions for this purpose.

In this comic [[Randall]] tries to identify places on Earth that ''actually'' have environmental conditions as close to these other worlds' as can be possible on the surface of the Earth. Some of the places suggested by Randall are borderline-survivable for a human, but most will kill you extremely quickly without a lot of high-tech gear - whether through {{w|hypothermia#severe|severe hypothermia}} (freezing), {{w|conflagration}} (fire), crushing (high pressure), or from violent winds.

Basically, nowhere in the {{w|solar system}}, except Earth, is even close to survivable (and there is actually only a very limited amount of Earth's surface where humans can actually live permanently). There is no planet or moon with a breathable atmosphere, or where the temperature stays within the human-tolerable range of roughly −20°C to 40°C (−5°F to 105°F, 250-310 K). It is also only with really good clothing and a place to stay at night that humans can live in a place much colder than 10°C for longer periods. The only place humans have so far ventured off-Earth is the Moon, and only during lunar morning while wearing thick pressurized spacesuits.

Some celestial bodies, like {{w|Venus}} and {{w|Jupiter}}, may ''never'' be visitable by humans without either huge advances in {{w|material science}} or full-scale {{w|terraforming}} (for Venus). Some places, like the centers of any planet (for example, the {{w|gas giants}} or even Earth itself), will probably never be visited, even by robots. (The title text suggests what happens when falling towards the center of a gas giant).

Below is a [[#Explanation of celestial bodies|list]] going through the seven suggested places on Earth. Due to the low pressure and temperature on the top of {{w|Mount Everest}} it is mentioned no less than three times, but using different time of day to represent different celestial bodies. In the first entry it even takes care of three in one go. Two of those are the Moon and Mercury, but for both only on their night side facing away from the sun. They are thus each mentioned twice, as there is a huge difference in environmental conditions between the sunlit faces of these two and their night sides. On the other end of the temperature scale are mentions of {{w|lava}} and a {{w|blast furnace}}; also high pressure environments are suggested to simulate other planets. The last goes for the gas giants, which are all mentioned together in the last entry.

The two groupings explains why there are only seven places mentioned for ten celestial bodies. The reason that the Moon is mentioned is of course that it is the closest companion to Earth and that we have actually visited it. That the only other moon mentioned is likely because it is the only really cold celestial body that actually has an atmosphere as well as a surface humans could stand on. But there are many other large moons that would be interesting to visit, like the {{w|Galilean moons}} especially {{w|Europa (moon)|Europa}}. But that could probably be compared to being on Pluto, except the sun is a bit larger. That Pluto is included as the only dwarf planet is probably because it was still a planet when Randall was a kid (see [[473: Still Raw]]) and is the most recent (new) celestial body visited by a space probe at the time of release of this comic. This was celebrated by Randall in [[1551: Pluto]].

The title text is just a continuation of the last entry about falling down through the atmosphere of a gas giant, and it is also explained in the table below. This was also explored in [[what if|What If?]] {{what if|138|Jupiter Submarine}}.

==Explanation of celestial bodies==
*{{w|Pluto}}, {{w|Moon}} (night), {{w|Mercury (planet)|Mercury}} (night): Mt. Everest at night
The {{w|dwarf planet}} Pluto is a small icy rock so far away from the {{w|Sun}} that it practically makes no difference if it is day or night, the Sun is just the brightest star in the sky of Pluto's "day" side. But for both the {{w|Earth|Earth's}} Moon and Mercury (the innermost and smallest {{w|planet}} of the {{w|solar system}}) it makes a huge difference, which is why there is both a day and a night experience mentioned for these two celestial bodies (see below). Although they are very much closer to the Sun than Pluto, this makes no difference during their night time (when they face away from Sun). They are both relatively small, rocky bodies with practically no atmosphere and relatively slow rotation. Therefore their surfaces not illuminated by the Sun will cool down to very low temperatures (around -170 °C, -290 °F, 100 K), making their nighttime hemispheres desolate, dark and cold places. Randall proposes the summit of {{w|Mount Everest}} (the tallest mountain on Earth) as the place that will emulate the conditions most closely. It is a rocky, desolate and cold place. Even though it is not the coldest place on Earth, it is the highest point on land, therefore it has the lowest atmospheric pressure. It cannot be compared to the near-zero pressure and 100 Kelvins conditions on the aforementioned bodies, but it is as close as you can get on Earth. The top of Mt. Everest has an air pressure just 1/3 of what it is at sea level, and the oxygen levels are so low that they are barely survivable, although a few people have [http://adventureblog.nationalgeographic.com/2016/04/21/how-climbing-everest-without-oxygen-can-go-very-wrong/ reached the top without oxygen tanks], but others have died after losing their oxygen supply, making it as close as you can get on Earth to the near-vacuum found on these worlds.

* {{w|Moon}} (day): Mt. Everest at noon under a tanning lamp
As explained above, Mount Everest is as good an emulation of the Moon surface at night as you can get on Earth. During the Moon's day, its surface gets about as much solar radiation as Earth at noon, because both bodies' distance from the Sun is almost the same. The Earth's atmosphere, however, stops most of the Sun's {{w|ultraviolet radiation}}. A {{w|tanning lamp}} is a device emitting mostly ultraviolet radiation for the purpose of artificial {{w|tanning}}; here it is used to augment the filtered Sun's radiation in an attempt to emulate the Moon's daytime conditions better. Since the Moon does not have any atmosphere it is hard to discuss the temperature experienced on the Moon, but still the [http://planetfacts.org/temperature-on-the-moon/ surface of the Moon reaches temperatures] above water's boiling point (100°C or 212 °F) during the day with an average daytime temperature of the Moon at 107°C (224.6 °F). This effect will not be very well emulated on top of Mount Everest or even in the hottest (non-volcanic) place on Earth's surface that reaches 53.9°C (129°F) — see the [[what if|what if?]] ''{{what if|152|Flood Death Valley}}''.

* {{w|Mercury (planet)|Mercury}} (day): A lava flow at a volcano at noon
Mercury's surface never quite reaches {{w|lava}} temperatures (if it did, it would be molten), but it gets close. At noon, Mercury's equator reaches 420°C (800°F, 700 K). Lava is a liquid usually at temperatures from 700 to 1,200 °C (1,300 to 2,200 °F, 970 K to 1470 K) but depending on what type of rock it's formed from, [http://hvo.wr.usgs.gov/volcanowatch/archive/2003/03_04_17.html lava can erupt] at temperatures as low as 500°C-600°C (930°F-1100°F, 770–870 K). Standing on a {{w|volcano}} on a partially solidified lava flow (which, it goes without saying, is incredibly dangerous) would expose you to similar temperatures.

Near the poles, Mercury's surface temperature is always very low as the axial tilt is almost zero, meaning that the poles do not get much direct sunlight and their temperature is constantly below −93 °C (−136 °F, 180 K).

* {{w|Venus}}: A heat-shrink wetsuit in a blast furnace
The average surface temperature on Venus is around 470°C (870°F, 740 K) (enough to melt {{w|lead}} at 327 °C (620°F, 600 K), which is the {{w|Atmosphere_of_Venus#Troposphere|usual comparison}}), and the pressure is 92 bar (by comparison, pressure on earth is only about 1 bar). A {{w|blast furnace}} is a bit too hot — the blast itself is 900 °C to 1300 °C (1600 °F to 2300 °F, 1170 K to 1570 K), and they can reach 2000 °C — but either temperature is enough to kill you in seconds. As the blast furnace would emulate Venus' temperature but not pressure, Randall proposes that a daring volunteer wear a hypothetical heat-shrink wetsuit. A {{w|wetsuit}} is an elastic garment worn mostly over the whole body by swimmers, divers etc. {{w|Heat-shrink tubing}} is an elastic tube made of a material that shrinks when heated, used to provide extra insulation and mechanical or environmental protection in electrical and electronics work — you put a length of tubing over your wire, connector, or a joint and heat it with a hot air gun, making it shrink and crimp over your device. A hypothetical heat-shrink wetsuit worn while sitting in a blast furnace supposedly would shrink rapidly in the extreme temperature, exerting great pressure on your body, thus emulating Venus' surface atmospheric pressure. In other words, do not go to Venus!

* {{w|Mars}}: Mt. Everest at sunset
Again use Mount Everest's thin atmosphere and very cold temperatures to emulate the planet, but Mars' dusty, greenhouse-gas-containing atmosphere means it's not as cold as Mercury at night, nor as hot as the Moon during the day. Also the sun is much farther from Mars than from the Earth/Moon system, but much, much closer than Pluto, so it should be colder than the day side of the Moon. But the Sun still looks like a sun rather than a star from Mars, unlike on Pluto. The sunset will also make the sky reddish-purple, similar to [https://commons.wikimedia.org/wiki/File:PIA17944-MarsCuriosityRover-AfterCrossingDingoGapSanddune-20140209.jpg the way the Martian sky often looks].

*{{w|Titan (moon)|Titan}}: Waist-deep in an outgassing Siberian swamp
Titan, the largest of {{w|Saturn}} moons (and one of the largest moons in the solar system) is one of the promising worlds for life. Given that its surface temperature is −180°C (−290°F, 95 K), that says a lot about how inhospitable the rest of the solar system is. The chemistry of the planet is interesting — there are lots of nitrogen compounds and hydrocarbons and the atmosphere is mostly nitrogen and methane. It has been confirmed that methane lakes exist on Titan's surface. It thus follows that there is likely also some precipitation of methane "snow", similarly to how water forms lakes and falls down as sleet on Earth. Similar compounds are produced by rotting material in {{w|swamps}}, hence the comparison to a cold {{w|Siberian}} swamp. Due to the global warming large area of the {{w|tundra}} in Siberia that used to be permanently locked in {{w|permafrost}} are now heating up enough to {{w|Arctic methane emissions|release these gases}}. It might thus be possible to end up waist deep in one of these "heated" swamp areas due to the resulting {{w|outgassing}}. Sadly for the global temperature this outgassing just increases the release of greenhouse gasses, making the global warming increase even faster. This may very well be the reason Randall chooses to mention it here, as another call back to recurring theme of [[:Category:Climate change|Climate change]] and to the recent comic [[1732: Earth Temperature Timeline]]. One key difference though is that on Earth, swamps are mostly water. On Titan — if they exist at all — they're liquid methane. Siberia also has some of the most extreme temperature differences on Earth, while Titan is just consistently cold. The coldest place in Siberia is the {{w|Pole of Cold}}, the coldest point in the {{w|Northern hemisphere}} having reached −71.2 °C (−96.2 °F, 202 K). Not quite Titan levels of cold, but certainly deadly enough. But in such cold places there would be no outgassing, so on Earth it is not possible to have both the cold and the outgassing.

*{{w|Jupiter}}-{{w|Neptune}}: Jumping from a high-altitude balloon over an Antarctic Ocean winter storm
Note that it is Jupiter to Neptune thus including also {{w|Saturn}} and {{w|Uranus}}. They are under one called {{w|gas giants}} for a reason. All the planets are very cold and have stormy weather (Uranus is the least active, and Neptune is the most active) and extreme temperature and pressure gradients. On the edge of the atmosphere, conditions aren't much different from space, but as you fall in, the temperature and pressure rapidly increase past the freezing point (allowing clouds of ice and water). This environment is simulated by jumping out of a {{w|high-altitude balloon}} (low pressure and cold) and falling down into an {{w|Antarctic Ocean}} winter storm, a very cold and violently windy place. The storms on the gas planets can be much more violent than any storm on Earth. On Neptune the storms can reach 2,100 km/h (580 m/s, 1,300 mph), whereas the {{w|Great Red Spot}} of Jupiter only reaches 430 km/h (120 m/s, 270 mph). The {{w|Wind_speed#Highest_speed|highest wind speed}} on Earth (outside {{w|tornadoes}}) has been measured at 408 km/h (113 m/s, 253 mph), and that was only the gusts.

The title text continues the last entry in the main comic, so this explanation is also a direct continuation of the above entry. The extreme temperature and pressure gradients mentioned do not stop when the atmospheric temperature and pressure increase beyond water's freezing point. Soon the temperature reaches past the boiling point, and on up to thousands of degrees and unimaginably high pressures, increasing further until reaching the central core. The cores of Neptune and Uranus most likely consist of rock (superheated silicates, iron and nickel) or in the case of Saturn and Jupiter of liquid {{w|metallic hydrogen}}, where the extreme high-pressure and temperature causes {{w|hydrogen}} to behave like a metal. The suggested simulation of this environment is to fall into a super hot bath tub that falls into the burning engine room of a ship that is sinking, and thus is about be crushed by the water pressure of the deep ocean. This is the closest representation of the pressure and temperature conditions of the inner parts of the gas giants that can be imagined on Earth, but of course the cores of these planets are far, far more inhospitable than the scenarios mentioned above. Descending into Jupiter was also explored in the [[what if|what if?]] {{what if|138|Jupiter Submarine}}.

==Transcript==
:[Caption above the panel:]
:<big>Where to go on Earth to get the Interplanetary Explorer Experience</big>

:[A chart with seven rows with celestial bodies on the left side of seven lines and a description on the right side. The first entry has three celestial bodies in two rows, the rest are in one row, although the last entry encompasses a list of planets. Four times the day/night side of the celestial bodies is mentioned in brackets.]
:{|class="wikitable"
|-
| Pluto, Moon (night)
|rowspan="2" | Mt. Everest at night
|-
| Mercury (night)
|-
| Moon (day) || Mt. Everest at noon under a tanning lamp
|-
| Mercury (day) || A lava flow on a volcano at noon
|-
| Venus || A heat-shrink wetsuit in a blast furnace
|-
| Mars || Mt. Everest at sunset
|-
| Titan || Waist-deep in an outgassing Siberian swamp
|-
| Jupiter-Neptune || Jumping from a high-altitude balloon over an Antarctic Ocean winter storm
|}

{{comic discussion}}

[[Category:Charts]]
[[Category:Space]]
[[Category:Volcanoes]]

1753: Thumb War

2022-05-04T23:00:38Z

PaintspotInfez: Quotation marks.

{{comic
| number = 1753
| date = October 31, 2016
| title = Thumb War
| image = thumb_war.png
| titletext = "Seventeen, eighteen, nineteen, twenty--" / "Can't we just read Pat the Bunny?"
}}

==Explanation==
Two small children, one a small [[Black Hat]], sitting among their toys are playing {{w|thumb war}}. This is a common game for children, in which two players hold hands and attempt to pin each other's thumb down. The game is often started with both players chanting "one, two three, four, I declare a thumb war." In some variations, the chant continues counting up by an additional set of four, with a rhyme. Once the opening chant is complete, the game consists of trying to pin the opponent's thumb down. A pinned thumb must be held down for long enough to complete a count of four, or to complete the closing chant, "one, two, three, four, I won the thumb war".

The standard concept is subverted here: Young Black Hat interprets the simulation of hand-to-hand combat with thumbs differently, comparing it with real conflict. He shows this in further lines, invented by himself.

The second rhyme, "finger guns proliferate," is a pun on the {{w|finger gun}} gesture and describes {{w|Small arms trade|small arms proliferation}} - the spread of black-market weapons which often comes with war as captured and smuggled guns make their way into the hands of paramilitary groups. Black Hat transfers this into the "thumb war universe", introducing finger guns into the thumb-to-thumb combat.

The third rhyme continues the counting until twelve and mentions {{w|Digit (anatomy)|digits}} as in fingers, and states that they cannot protect themselves. This may be implying an imposition of {{w|Gun control|firearms regulation}} or {{w|arms control}} as a response to the small-arms proliferation in the previous verse, or the defenseless nature of noncombatants in war.

In the last line Black Hat states that, even though this thumb war goes on and on, the "thumb U.N.", the thumb war universe equivalent of the {{w|United Nations}} (UN), won't intervene. In real life the UN would try to put an end to a given war by using diplomatic power and has the mandate of using (blue-helmet) peace forces in war zones to put an end to violence and give out a mandate to nations so that they can intervene in some crisis on their own behalf.

The thumb war game in Black Hat's version is instead a quite cynical portrayal of our world, criticizing the "might is right" mentality that is the sad reality of our globe, and the government of the world by the militarily strongest nations.

The other child, who will someday turn into [[Hairy]], meanwhile, is unnerved by all this and wants to stop playing. Since Hairy is just a normal child he is really not interested in Black Hat's realistic version of what a war really is.

In the title text it seems like Hairy interrupts Black Hat's last rhyme after twenty, and finishes with his own rhyme, with "Bunny" ending in the same sound if you pronounce twenty like "twunny" as in some parts of the world. So it goes like this:
:Black Hat: Seventeen, eighteen, nineteen, twenty
:Hairy: Can't we just read Pat the Bunny?
Thus Hairy requests that they do something more appropriate for children, like reading a picture book - specifically, the "touch and feel" book for small children and babies known as {{w|Pat the Bunny}}. It isn't clear what Black Hat would have said if not interrupted, but if twenty was indeed pronounced so as to slant-rhyme with bunny, one possibility is, "I'll annex your entire country," (which could conceivably be followed by, "Twenty-one, twenty-two, twenty-three, twenty-four. You're not sovereign anymore.").

This is the second time a young Black Hat has been used. The first was in [[1139: Rubber and Glue]]. Black Hat has continued to make Hairy uncomfortable even as an adult, for instance in [[1210: I'm So Random]].

==Transcript==
:[Two children are sitting on their knees between a toy truck to the left and five building blocks to the right; three square blocks are stacked in a precarious tower and to the right of the tower there is one more square block which has a rectangular block leaning on it. Both children have lots of hair but the child to the left has a black hat on, so they are possibly young versions of Black Hat and Hairy. They are sitting across from each other with one hand touching the other's hand. Their thumbs can be seen sticking up above their hands.]
:Black Hat: One, two, three, four, I declare a thumb war.
:Black Hat: Five, six, seven, eight, finger guns proliferate.
:Black Hat: Nine, ten, eleven, twelve, digits can't protect themselves.
:Black Hat: Thirteen, fourteen, fifteen, sixteen, thumb U.N. won't intervene.
:Hairy: I don't want to play with you anymore.

{{comic discussion}}

[[Category:Comics featuring Black Hat]]
[[Category:Comics featuring Hairy]]

1630: Quadcopter

2022-05-04T22:59:59Z

PaintspotInfez: A helpful comma, and a typo fix.

{{comic
| number = 1630
| date = January 15, 2016
| title = Quadcopter
| image = quadcopter.png
| titletext = I always have to turn off nature documentaries when they show these scenes.
}}

==Explanation==
There is large controversy over unmanned small-scale {{w|Quadcopter|quadcopters}}, which are a type of ''{{w|Unmanned aerial vehicle|radio-controlled helicopter}}''. Some people have objections towards the usage of quadcopters as, if equipped with cameras, they can potentially interfere with personal privacy and may pose a physical aerial hazard.

For this reason the US {{w|Federal Aviation Administration}} is now requiring any "drone" (unmanned aerial vehicle) to be registered so that it can find out whose fault it might be that a quadcopter interfered with commercial aircraft-or carried off a citizen to be devoured.

This comic takes place during such a lesson where [[Cueball]] is a teacher of such a class. He is standing in front of his students ([[Megan]], [[Ponytail]] and another Cueball-like guy), presenting the class. He has a quadcopter ready, lying on the ground behind him, and has already handed the remote control to the other guy so he can try it once the introduction is over.

But then the teacher is attacked by three rogue quadcopters flying in from behind him. They grab him and lift him off the ground (a very complicated maneuver) and fly away with him. Meanwhile, his students just stand there watching and do nothing to help him. Afterwards Megan asks if they should actually have tried to help him, but then Ponytail takes the view that now that the drones are sentient, they have become a part of nature, and that you should not interfere but just "let nature take its course". This is a common comment in nature programs about wildlife, where the speaker tries to explain why the team that was there to film the animals dying did nothing to help them - because they will not interfere with nature. This would not be possible in real life assuming they weren't using secret military technology as Cueball outweighs the drones by several factors. {{Citation needed}}

This comic shows how hypocritical that comment is, because if a lion decides to kill and eat humans, that would be natural, but we would do anything in our power to kill this lion, and not just let it run off with our children or the old and weak people. So in such a case with Cueball being taken by wild quadcopters we would not just let nature takes its course.

There is currently a drone called {{w|MQ-1 Predator}} which is used a lot by the {{w|CIA}} and {{w|USAF}}. Although it's not a quad-copter, the idea behind this comic could come from drone names just like this. Here the comic takes the name literally, giving drones predatory behavior. This comic thus takes people's worries to the extreme, suggesting that the drones become sentient and can cooperate together just like a {{w|Pack (canine)|pack}} of {{w|wolves}} and grab a human being and fly off with him like an {{w|eagle}} would do with a smaller animal.

The title text refers back to the above as [[Randall]] confesses that he has to turn off any nature documentaries which show scenes of animals killing their prey, while the speaker tells that this would be part of nature. This continues the theme of treating drones as an occasionally-ugly but accepted part of nature.

Sentient quadcopters were part of the game in [[1608: Hoverboard]], where [http://www.explainxkcd.com/wiki/images/7/7c/1608_0950x1084y_Quadcopters_over_lava_lake_right.png one quadcopter is speaking to the other] over the lava lake in the Mount Doom crater to the left. How to solve the problem of too many drones was mentioned in [[1523: Microdrones]]. Just over a week before this comic was released another comic also had as subject a situation where our technological inventions begins to take control over us, see [[1626: Judgment Day]]. Comparing drones to animals is also present in [[1881: Drone Training]], when Black Hat Guy asks for a spray bottle for his drone.

==Transcript==
:[Cueball to the left talks to Megan, Ponytail and a Cueball-like person, with a remote control. They are standing to the right. Behind Cueball, on the ground, there is a quadcopter.]
:Cueball: Welcome to Quadcopter-flying school.

:[Cueball looks over his shoulder as three other quadcopters fly in towards him from above and left. The other three people are in the same position.]
:Cueball: Today we'll be learning the basics of-
:Cueball: ...Uhh...

:[In this frameless image the three quadcopters all grabs hold of Cueball, two in each of his arms, one takes hold of his legs. And then they lift him up from the ground. He is thus hanging almost horizontally, with his head over Megan and his feet over the place where he stood before. The other three just stands there looking up at him.]
:Cueball: Um

:[Cueball is carried off by quadcopters, his head has already exited the top right corner, only his legs and the last quadcopter still in the frame. The other three have turned around looking up and right after him.]

:[Megan looks down again and the other two turns towards Megan. Cueball is gone and has only left his "tame" quadcopter behind on the ground.]
:Megan: Should we have helped?
:Ponytail: No. It's cruel, but we have to let nature take its course.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Multiple Cueballs]]
[[Category:Artificial Intelligence]]
[[Category:Drones]]

2614: 2

2022-05-04T22:54:54Z

PaintspotInfez: Undo revision 257657 by 162.158.203.76 (talk) Please don't. We have more important issues to deal with.

<noinclude>:''This page refers to the comic named "2". For comic #2, see [[2: Petit Trees (sketch)]].''</noinclude>
{{notice|1 = '''WARNING:''' A large percentage of explain xkcd's pages are currently vandalized. The vandal's script was previously stopped, but they have returned under a different account, and many pages have been vandalized again. {{#expr: {{LATESTCOMIC}} - {{PAGESINCAT:All comics|R}}}} pages out of {{LATESTCOMIC}} ({{#expr: 100 - ({{PAGESINCAT:All comics|R}} / {{LATESTCOMIC}} * 100 round 0)}}%) are currently vandalized, leaving {{PAGESINCAT:All comics|R}} ({{#expr: ({{PAGESINCAT:All comics|R}} / {{LATESTCOMIC}} * 100 round 0)}}%) unvandalized. [{{SERVER}}/wiki/index.php/Special:Contributions/Ex_Kay_Cee_Dee?limit=2000&topOnly=1 List of currently-vandalized pages] / [[explain xkcd:Crap|More information]] / [[explain xkcd:Community portal/Admin requests|Discussion]]}}
{{comic
| number = 2614
| date = May 2, 2022
| title = 2
| image = 2.png
| titletext = It's like sigma summation notation, except instead of summing the argument over all values of i, you 2 the argument over all values of 2.
}}

==Explanation==
{{incomplete|Created by A VERY JEALOUS NUMBER ₃½ⁿ₇₇₇ⅥⅣ₆⁸⁴⁴½⅔⅜ↆ↉↉∂, WHO DEMANDS TO HAVE THEIR OWN WEBCOMIC NEXT - Please change this comment when editing this page. Everything is in there but some categories might need explanation and examples.}}

This demonstrates the different ways in which the number 2 can be typeset in various scientific fields. While these ways of typesetting are used with any number, using the number 2 in this instance provides a clear illustration how adding numbers can signify either a feature of a concept (such as the number of electrons in an atom) or a mathematical operation on it (such as raising a value to its second power).

The dotted box represents any character (a number, letter, or bigram of letters, as appropriate to the various signifiers). All the other notation consists only of the digit 2, with occasional additional punctuation, in various locations in relation to this character. Each of these is labelled as to what its 'purpose' might normally be with respect to the general term:
;Regular Math
:Precedes the term. "2x" indicates two times the value of ''x'' in normal {{w|algebra|algebraic}} use that should be familiar for many people.
;Physics
:A preceding superscript. "2H" would indicate the particular {{w|isotope}} of hydrogen with the atomic weight of two, namely deuterium, which is most often encountered when working with the atomic level of matter where the total number of neutrons and protons in the atom is important. It can also represent {{w|tetration}}, which is iterated exponentiation.
;Chemical Physics
:A preceding subscript, as in "2He", indicates the atomic number of an atom, which is the number of protons it contains. It is thus a guide to the number of electrons its unionised form usually has and hence is meaningful for its potential chemical interactions with other atoms. This number of protons should be invariant for any particular named element, but is usually given simultaneously with the presuperscripted mass number for which it can indicate the applicable nuclear physics. {{w|Chemical Physics}} is a subdiscipline of physics and chemistry and **must never** be confused with {{w|Physical Chemistry}}. It can also represent {{w|pentation}}, which is iterated tetration.
;Regular Math or Footnotes
:A trailing superscript is typical of a {{w|Exponentiation|power value}}; in this case "x²" would be ''x'' multiplied by itself - a common mathematical standard.
:Additionally, superscripted numbers are one common way to mark words in a line of text in a way to refer to a {{w|Note (typography)|footnote}}, typically placed at the bottom of the page and containing additional information that would distract from the main text itself. The ambiguity between footnotes and exponents was used in [[1184: Circumference Formula]].
;Chemistry
:A trailing subscript is used in chemistry to indicate a multiple of the element (or group of elements, in brackets) in a {{w|chemical formula}}. "H2O" indicates two hydrogen atoms bond with a single oxygen atom in a molecule of water.
;Matrices! ("2,2")
:Extending the trailing subscript with a comma-separated value usually indicates a multidimensional array (e.g., establishing a 2-by-2 square of numbers, or this particular position in such an array), which is in the realm of {{w|Matrix (mathematics)|matrix mathematics}}. This is a little bit beyond 'everyday algebra' for many people, as seemingly indicated by the exclamation of the mere mention of matrices.
;The Physicists Are At It Again ("2;2")
:This label encompasses a mark that turns the prior comma into a semicolon, as part of the trailing subscript. This is a common notation for the {{w|Covariant derivative}} of a tensor field, which is commonly used in the mathematics of general relativity.
;Either High School Math Function or Incomprehensible Group Theory
:The number 2 in parentheses that follow a term would normally be the argument to a {{w|Function (mathematics)|function}}. For example, "f(2)" means that you should take the value 2, and find the result if manipulated by the predefined function ''f''. It is generally taught as part of algebraic mathematics in {{w|Secondary school|high school}}.
:In {{w|group theory}}, however, the number 2 in parentheses could indicate a special kind of group, such as an an element of a symmetry group that keeps 2 fixed, or some kind of group of 2x2 matrices. For instance, {{w|SU(2)}} is a 3-dimensional {{w|Lie group}} of {{w|unitary matrices}}. These concepts are taught in graduate or advanced undergraduate mathematics courses.
;Oh no. Whatever this is, it's cursed.
:A symbol centered underneath another symbol is normally reserved for doing summations, where the big symbol is Σ, or some other operation applied to a sequence of numbers. It does not make sense to have a single number there. As with [[2529: Unsolved Math Problems|other things]] where something appears to have gone wrong in Randall's comic universe, the explanation for this particular anomaly is that it is 'Cursed'.
:Two numbers may be stacked in parentheses in {{w|combination}} notation, but in that case the two numbers would both be 'small': (22)
:The usage mentioned in the alt text is an operation (Σ, summation) over a variable, usually indicated by a letter such as i, where the operation is performed over all values of the variable (i.e., you Σ (sum) the argument over all values of i). In the "2" case, the alt text says "you 2 the argument over all values of 2" (i.e., the Σ operation has been replaced by the "2" operation and the i variable has been replaced by the "2" variable). 2 is usually not an operation, though the definition of 2 under {{w|Church_encoding#Church_numerals|church encoding}} is a function that takes in and produces functions. However, 2 is not a variable (and definitely not both at the same time).
: Things being cursed is a common trope within recent XKCD comics, which have mentioned items including [[2332:_Cursed_Chair|Cursed chairs]] and [[:Category:Cursed_Connectors|cursed connectors]]. This notation is one of the few occasions where the supernatural has demonstrable implications for science and mathematics for those foolhardy enough to use it.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[An apparent generalisation of a scientific expression consisting of a dotted rectangular 'box' outline, left empty, and various commonly-themed symbology around it:]

:[as normal text, to the left of all the rest:] 2
:[superscript to the immediate left of the box:] 2
:[subscript also to the immediate left of the box:] 2
:[superscript to the immediate right of the box:] 2
:[subscript also to the immediate right of the box:] 2;2 [i.e. separated by a semicolon]
:[as normal text, to the right of almost all the rest:] (2) [i.e. enclosed in standard parentheses]
:[smaller subscript, centered immediately beneath the 2 within the parentheses:] 2

:[Further details are drawn in grey tone, around or near various of the elements of the expression:]
;[Captions above the numbers]
:[with an arrow pointing to the leftmost 2:] Regular Math
:[with an arrow pointing to the leftwards superscript 2:] Physics
:[with an arrow pointing to the rightwards superscript 2:] Regular math or footnotes
:[with an arrow pointing to the parenthetical 2 at the right:] Either high school math functions or incomprehensible group theory

;[Captions below the numbers]
:[with an arrow pointing to the leftwards subscript 2:] Chemical Physics
:[with an arrow pointing to just the rightwards subscript 2:] Chemistry
:[with an arrow pointing to a distorted grey ring snaking around only the comma of the semicolon and the following 2 of the rightmost subscript:] Matrices!
:[with an arrow pointing to a larger grey ring that passes fully around the whole semicolon and final 2 of the rightmost subscript:] The physicists are at it again
:[with an arrow pointing to the small 2 placed below the parenthetical 2:] Oh no. Whatever this is, it's cursed.

{{comic discussion}}
[[Category:Math]]
[[Category:Physics]]
[[Category:Chemistry]]
[[Category:Comics featuring Cursed Items]]

721: Flatland

2022-05-04T22:54:24Z

PaintspotInfez: Typo fix!

{{comic
| number = 721
| date = March 31, 2010
| title = Flatland
| image = flatland.png
| titletext = Also, I apologize for the time I climbed down into your world and everyone freaked out about the lesbian orgy overseen by a priest.
}}

==Explanation==
This comic is a reference to the satirical novel ''{{w|Flatland|Flatland: A Romance of Many Dimensions}}'', in which a society of flat shapes live in a {{w|Two-dimensional space|2D}} world. Half the book is a direct satire of {{w|Victorian era|Victorian}} society, and the other half explores the experience of discovering a new dimension, where a sphere introduces a square (named A. Square) to {{w|Three-dimensional space|3D}}. [[Cueball]] appears to have taken the place of this sphere, and the comic takes place after the square knows the third dimension exists.

Humans will never fully be able to fully grasp the concept of a fourth spatial dimension (at least not in the foreseeable future), but there are ways of squashing or slicing four dimensions to create partial visualizations of 4D space. ''{{w|Miegakure}}'' is a yet-to-be-released 4D game that uses cross-sections of 4D space. Cueball attempted to play a pre-release version of it, but after having his "mind blown", he gained more sympathy for A. Square, who'd had similar trouble understanding 3D. A. Square accepts his apology.

The joke here is that Cueball was being silly and drew lines on A. Square to make him look like {{w|SpongeBob SquarePants (character)|SpongeBob}}, which did not make the square happy. Cueball apologizes again.

The title text is a third apology for when Cueball crawled down into the second dimension. Being a stick figure, he is composed of a circle and straight lines. In Flatland, circles are priests (Flatland's highest social level), and all women are lines; thus, to a watcher in Flatland, Cueball would look very much like a priest above many connected women, which may look like a lesbian orgy.

==Transcript==
:[Cueball talks to a square on the ground.]
:Cueball: Hey, A. Square. How's Flatland?
:A. Square: Still flat. What's up?
:Cueball: I just spent an hour playing a demo of this 4D game called Miegakure.

:[In a frameless panel, a character in Miegakure jumps around the 4D landscape.]
:Caption above the panel: Trying to jump from block to block in four dimensions hurt my brain.

:[Cueball continues talking to A. Square on the ground.]
:Cueball: So I apologize for giving you a hard time when you were slow to understand 3D space. I sympathize now.
:A. Square: It's okay.

:[Zoom in on Cueball's head]
:Cueball: Also, I apologize for drawing arms, legs, and eyes on you to make you look like SpongeBob. That was out of line.
:A. Square: Yes, it was.

==Trivia==
*There is actually a SpongeBob episode featuring a flat creature that resembles a crude drawing of SpongeBob.

===UniXKCD===
*This comic was released on March 31, 2010 and was still up on April 1st, 2010.
**On {{w|April_Fools%27_Day|April Fools' Day}} in 2010 [[Randall]] altered the website to mimic a {{w|Unix}} command line interface.
**This interface is still available on [https://uni.xkcd.com uni.xkcd.com] and the source code is available on [https://github.com/chromakode/xkcdfools GitHub].
**See more on the [[UniXKCD]] April Fools' Day joke.

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Comics featuring Cueball]]
[[Category:Geometry]]
[[Category:Video games]]
[[Category:Homosexuality]]
[[Category:Sex]]

520: Cuttlefish

2022-05-04T22:50:24Z

PaintspotInfez: Not sure why this comic isn't showing up in the category (and, thus, making the number of comics inaccurate), but I think a null edit like this would fix it

{{comic
| number = 520
| date = December 22, 2008
| title = Cuttlefish
| image = cuttlefish.png
| titletext = Unless the CS students finish the robot revolution before you finish the cephalopod one.
}}

==Explanation==
It appears that [[Cueball]] and [[Megan]] are {{w|physicists}} visiting a biology lab. Their guide, a {{w|biologist}} looking like Cueball, gives them a description of the humble {{w|cuttlefish}} that is both accurate and makes them sound like other-worldly creatures with highly advanced capabilities.

The scene takes an unusual turn when the scientist implies that the cuttlefish have been easily trained to improve their capabilities. He then demonstrates this by giving a simple command, whereupon the cuttlefish rise out of the water, only to attack and kill both Cueball and Megan, demonstrating an ability to fly, talk, and discharge lethal electric shocks in the process. (See also [[35: Sheep]]).

This is all revealed to be a dream, but it has given Cueball a warning not to underestimate the biologists. Apparently, they can be just as crazy and dangerous as any other kind of scientist. Cueball (who represent [[Randall]] as it is xkcd that salutes in the final panel) offers a toast to all biologists everywhere and plans an alliance with them against the {{w|chemists}}, hoping to prevent further attacks on physicists. He is then shown drinking from a laboratory flask, something that any scientist would be wary of.

In the past, Randall has been somewhat dismissive of the non-math/non-physics scientific disciplines, so this comic may be trying to mend some bridges with biologists. But not with chemists.

In the title text, CS stands for {{w|Computer Science}}. The "robot revolution" references events in film and literature, wherein robots, having become commonplace in the workforce, achieve independent thought and declare war on humanity, like in ''{{w|The Terminator}}'', ''{{w|The Matrix}}'', or the movie ''{{w|I, Robot}}''. Randall implies that the physicists will switch sides if the robot revolution arrives first. {{w|Cephalopod}} is the class of animals that encompasses cuttlefish, as well as {{w|squids}} and {{w|octopodes}}.

==Transcript==
:[A scientist (looking like Cueball) is pointing into an aquarium tank with two small animals floating in the water. He explains that they are cuttlefish to Cueball and Megan, who are on the other side of the tank looking into it, Cueball with a hand to his mouth. Above them there is a frame inside the panel with a caption:]
:We visit a bio lab:
:Scientist: These are cuttlefish.

:[Very detailed drawing of a cuttlefish, with its special W shaped pupils, all eight arms and two longer tentacles, and the striped body with waving parts shown waving down each side. The scientist tells about the animal with text above and below.]
:Scientist (off-panel): They're frighteningly smart, have manipulating arms and tentacles, have ink jets, can dart backwards and see the polarization of light through their w-shaped pupils.
:Scientist (off-panel): And their sides are 200 dpi display screens which they use for camouflage and communication.

:[Back to the original setting where the scientist stands a little farther back from the tank with his arms down. Cueball and Megan have also moved farther back and are even leaning away from the tank.]
:Scientist: When we realized how intelligent they were, we began to teach them.
:Scientist: They've advanced quickly.
:Scientist: '''Cuttlefish: GO.'''

:[The two cuttlefish float straight out of the tank (lines indicating the movement and water splashing at the surface of the tank). The scientist looks down at them, while Cueball and Megan are holding hands and leaning farther back and Cueball taking his hand back to his mouth.]

:[Pan to only the scientist, standing with one arm bend in front of him and the other holding a finger up to his mouth, and the tank from where the cuttlefish now flies towards Cueball and Megan, who are now off-panel. Lines behind the cuttlefish show they fly right but bobbing up and down. The cuttlefish talks in a strange way where the letters are alternately up and down.]
:Cuttlefish: K<big>i</big>l<big>l</big> t<big>h</big>e P<big>h</big>y<big>s</big>i<big>c</big>i<big>s</big>t<big>s</big>
:Cuttlefish: K<big>i</big>l<big>l</big> t<big>h</big>e Ph<big>y</big>s<big>i</big>c<big>i</big>st<big>s</big>
:[Pan to Megan and Cueball, with the tank almost inside the left frame. Both cuttlefish are surrounded by their own zigzag lines, which then extend from them in a thin line to encompass either Cueball or Megan. Cueball was running away from them, when this happens, with legs bent at the knees and arms out, one bent. Megan has fallen lying face down with her arms out.]

:[In this panel with faint gray shading, Cueball is waking up in bed from the dream, rising up to a sitting position suddenly as indicated with two movement lines behind his head. One arm is supporting him on the bed next to the pillow, and the other is pulling his sheet down away from his torso. The first sentence is maybe still part of the dream, as there is no line from Cueball to the sentence, and it is written high up. There is a line to the second sentence.]
:Cueball: Oh god.
:Cueball: I knew it.

:[This panel is divided into five segments. At the top, there is a large caption in two lines. There are three drawings following each other from left to right. First, a bottle is pouring liquid into a an Erlenmeyer flask (a conical laboratory flask) that is half full. Then, Cueball takes the flask and holds it up as a salute. Finally, he drinks from it leaning his head way back. Below there is more text.]
:<big>xkcd</big>
:Salutes Bio Majors
:If we join you against the chemists, will you train your fleshy minions to leave us alive?

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Multiple Cueballs]]
[[Category:Dreams]]
[[Category:Chemistry]]
[[Category:Biology]]
[[Category:Animals]]

226: Swingset

2022-05-04T22:49:10Z

PaintspotInfez: Why is this comic not showing up in the category? Would a null edit like this one fix it?

{{comic
| number = 226
| date = February 21, 2007
| title = Swingset
| image = swingset.png
| titletext = Someone bring me a pocket fan so I can drift around the yard.
}}

==Explanation==
In the opening panel of this comic, [[Blondie]], possibly as [[Miss Lenhart]], sees [[Cueball]] sitting on a swing set. She tells him that during his swing, he becomes weightless. Cueball then imagines that at the peak of his swing he is able to become permanently weightless, floating above the ground without any support.

When on a swing or other [http://www.learner.org/interactives/parkphysics/pendulum.html pendulum ride], there is a moment between swinging forwards/backwards and swinging back down again when the forces of gravity, friction, air resistance, etc., bring the velocity of the swing to zero. At this moment, there is no acceleration toward the pivot of the swing (since the centripetal acceleration is proportional to the square of the speed). So the swinger experiences no centripetal force. Of course, gravity still acts on the person, but if the swing is horizontal at that point, then there is no reaction force, so for one moment, the swinger is in free-fall and experiences {{w|weightlessness}}. However, that weightlessness can only be maintained for a fraction of a second, so if Cueball tried this in real life, he would come crashing to the ground.

In the title text, Cueball asks for a pocket fan, believing he could fly around the yard using this small device perhaps as a propeller.

==Transcript==
:[Woman talking to Cueball on swing-set.]
:Woman: You know, at the peak of a big swing, you become weightless.
:[Thought bubble from Cueball.]
:[Cueball swings higher and higher. At the peak of a big swing, he shoves himself off the swing. Cueball remains hovering in the air.]
:Cueball: Hey guys. Come check this out.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Physics]]

2614: 2

2022-05-04T22:09:47Z

PaintspotInfez: Undo revision 253215 by Ex Kay Cee Dee (talk) rv

2614: 2

2022-05-04T20:36:06Z

PaintspotInfez: Undo revision 243673 by Ex Kay Cee Dee (talk) Nope.

270: Merlin

2022-05-04T20:01:12Z

PaintspotInfez: Undo revision 240682 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 270
| date = May 30, 2007
| title = Merlin
| image = merlin.png
| titletext = I mean, the black-and-white stuff was running backward, but it hardly mattered to the story.
}}

==Explanation==
{{w|Merlin}} is a wizard who features prominently in various retelling of the legend of King Arthur. ''{{w|The Once and Future King}}'' by author {{w|T. H. White}} is one of the most popular versions of the legend, and in it, Merlin is described as living backwards through time, as [[Cueball]] and [[Megan]] discuss in this comic (this is also briefly mentioned in the musical ''{{w|Camelot (musical)|Camelot}}'', which is based on this version of the story).

In the comic, Cueball is speculating philosophically on how this would have affected Merlin's life as he started life with all his memories, and gradually lost them, comparing this to Megan's own sense of unreality at goodbyes.

Many old people do, however, end up alone without friends or family. And they may do nothing but watch TV all day. They might also lose their memory. So in this respect, Merlin's last days may not be so different from many real people's, except of course that Merlin was supposed to live in the late 5th and early 6th centuries with no access to DVDs or even TV.

''{{w|Memento (film)|Memento}}'' is a movie telling the main parts of its story backwards, while a few black-and-white scenes are straightforward. So when Merlin watches the movie, he sees nearly the whole story in its actual order, and the title text drives home the joke by noting that these few scenes, which make more sense to someone with normal perceptions than the rest of the movie, would make less sense to him.

Normal old people would not be able to enjoy ''Memento'' like Merlin. Although he would of course always have remembered seeing it when he got old, until the day he saw it and then forgot it afterwards...

==Transcript==
:[Cueball and Megan standing by a train on a platform.]
:Megan: I'm bad at goodbyes. At some level I never think they're for real.
:Cueball: They make me think of T. H. White's Merlin.

:[They are still standing at the edge of the platform, but the train is no longer in the frame.]
:Megan: Oh?
:Cueball: He lived backwards, remembering the future and not the past. To him, final goodbyes meant nothing, while first hellos were tearful and bittersweet.

:[Zooming out, the rail closest to the platform becomes visible.]
:Megan: Huh - so over the years he'd forget all his friends.
:Megan: Must've been lonely.
:Cueball: Yeah. He ended up just sitting around at home watching DVDs all day. The best was the time he rented 'Memento'...

:[Merlin with pointy hat and long white beard is sitting in a couch with the remote, watching TV which emits light and is clearly hooked up to a device (a DVD player).]
:Merlin: Well, that was straightforward.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]

2088: Schwarzschild's Cat

2022-05-04T20:01:02Z

PaintspotInfez: Undo revision 240685 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 2088
| date = December 21, 2018
| title = Schwarzschild's Cat
| image = schwarzschilds_cat.png
| titletext = Cats can be smaller than the critical limit, but they're unobservable. If one shrinks enough that it crosses the limit, it just appears to get cuter and cuter as it slowly fades from view.
}}

==Explanation==

This comic is primarily a wordplay joke about the {{w|Schwarzschild radius}}, or the distance from a black hole corresponding to the {{w|event horizon}}.The Schwarzschild radius for a given body is the limit to which a given mass can be shrunk down before it becomes a black hole - the Schwarzschild radius also represents the event horizon of this newly-created black hole. The event horizon, in turn, is the limit from which nothing can leave a black hole; not even light. The joke is that, apparently, smaller cats are cuter, and there is a limit below which a sufficiently small cat (but larger than zero) will approach infinite cuteness, in a similar pattern to the way time's rate for an observer will approach infinity, the closer they get to the event horizon of a black hole.

It's also an oblique reference to the {{w|Schrödinger's cat}} thought-experiment, since the names (Erwin) "Schrödinger" and (Karl) "Schwarzschild" are somewhat similar and both men were early 20th-century physicists who exchanged ideas with Albert Einstein. However, the actual comic doesn't bring up {{w|quantum superposition}}.

The title text makes two allusions. First, it alludes to what happens when an object falls into a black hole. From an outside observer's point of view, such objects appear to slow down and take an infinite amount of time to cross the event horizon due to the time dilation of {{w|General relativity}}. The object's photons become increasingly red-shifted, fading as they lose energy to the black hole's gravity well. The scientific consensus suggests that from the falling object's point of view, it should continue to experience time and cross the Schwarzschild radius, but that event is unobservable from the outside (hence the term "event horizon").

Second, the title text is a play on the {{w|Cheshire Cat}} from Alice in Wonderland, which slowly fades from view until only its grin remains.

Randall previously discussed the superiority of tiny mammals in [[1682: Bun]], and drew graphs relating to the perceived cuteness of cats in [[231: Cat Proximity]].

==Transcript==
:[A graph is shown. The x-axis is labeled "Cat size" and the y-axis, "Cat cuteness". Parallel to and a short distance from the y axis is a dashed line the same length as the y-axis line, representing a vertical asymptote; the space between the y axis and the dashed line is labelled "Critical Limit". Graphed is a function coming down from infinity, starting close to the dashed line; it then levels off and does not reach zero on-screen. At the top end of the graph is the text "Schwarzschild's Cat" and an arrow pointing upwards outside of the graph.]

{{comic discussion}}
[[Category:Physics]]
[[Category:Cats]]

772: Frogger

2022-05-04T19:56:01Z

PaintspotInfez: Undo revision 240711 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 772
| date = July 28, 2010
| title = Frogger
| image = frogger.png
| titletext = I understand you and your team worked hard on this, but when we said to make it more realistic, we meant the graphics.
}}

==Explanation==
{{w|Frogger}} is a classic video game introduced in 1981. The aim of the game is to safely get a frog across a busy road and a river to a lily pad at the top of the screen.

The title text reveals that a team of programmers misinterpreted a task to make the game "more realistic", i.e. with better graphics, and instead made the trucks swerve to avoid the car-sized frog, causing another vehicle to crash into the truck resulting in a serious road accident. This is instead of the traffic just inexorably moving at a constant rate in their assigned lanes and disregarding the movements of the frog, who is normally the only one who ever needs to take evasive action or suffer the consequences.

The game continues to introduce increasing drama with the reactions of off-panel bystanders.

This is similar to the idea behind the modification of the game in [[873: FPS Mod]], in which realism makes a video game much less enjoyable.

==Transcript==
:[The dark green frog, Frogger, is standing in the middle of the panel on the green grass by the side of a light gray road with at least four tracks divided by black midlines. The last track being mainly outside the top frame of the panel. It is looking out into the traffic, which includes three trucks (two in the nearest lane one in the third) with different color of the cabin (one blue and two dark gray) and white behind the cabin. There is also a red car in the second lane. All four vehicles are driving towards left.]

:[Lines behind the frog and sound indicates that Frogger hops, and it moves out right in front of the right truck which is now close to it. The left truck is partly outside the panel, and the other two have moved further left and a new gray car has entered from the right in the second lane.]
:''Hop''

:[The truck in the inner lane swerves into the second lane to avoid Frogger, which takes the truck out in front of the gray car. The other truck in the inner lane has exited the panel and the red car only shows the rear part. ]

:[The truck and the car collide with a great noise displayed with shaky letters above them. The car and the cabin of the truck both crumples. Behind the car is two lines of skid marks. Frogger is left unharmed in the inner lane. The red car is gone and the third lane truck is leaving the panel to the left, the cabin just outside the frame.]
:<big>''Boom''</big>

:[Only the two crashed vehicles are left on the road with smoke pouring out of their hoods. The trucks rear end also seems to have crumbled more than in the previous image, and strangely enough the skid marks of the car now stretches longer towards the right than before... Frogger turns around and hops back to the side of the road, again indicated with lines and sound. At the bottom of the panel three off-panel voices calls out:]
:''Hop''
:Off-panel voice 1: Oh god!
:Off-panel voice 2: Someone call 911!
:Off-panel voice 3: Mom!

==Trivia==
Randall made a mistake in the last panel, where the skid marks of the car stretches longer towards the right than in the panel before, even though the car and truck did not move (and the view has also stayed the same through out the comic.) However, this could just be smoke plumes.

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Video games]]
[[Category:Animals]]

551: Etch-a-Sketch

2022-05-04T19:55:08Z

PaintspotInfez: Undo revision 240658 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 551
| date = March 4, 2009
| title = Etch-a-Sketch
| image = etch-a-sketch.png
| titletext = Surrounded by boring mysteries.
}}

==Explanation==
[[Cueball]] notices that if you draw a lot on an {{w|Etch_A_Sketch|Etch-a-Sketch}}, the aluminum powder in it can be cleared from enough of the screen to allow a view of the interior (as seen [http://upload.wikimedia.org/wikipedia/commons/7/78/EtchASketch_Inside_Shown.jpg here]).

Cueball then proceeds to clear a window into the device, which shows him that there's a girl, [[Megan]], inside whose job is to act as the stylus for the Etch-a-Sketch. She suggest that they be friends, and little hearts pop up.

As the dream fades, it then becomes clear that this is just a fantasy, and Cueball sighs at the rather more mundane reality that the lines get drawn by a stylus moving on a simple arrangement of rods. The comic ends with Cueball shaking the Etch-a-Sketch, which resets it and will re-conceal the mechanism.

The title text notes that sometimes the mysteries surrounding us turn out to be much more boring than we dream they are.

==Transcript==
:[Cueball is sitting on a bench playing with a pink Etch-a-Sketch.]
:Cueball: Hey. If I draw enough lines, I can see what's behind the screen.

:[Close up on the Etch-a-Sketch's screen.]
:Cueball (off-screen): Oh man, almost...

:[Cueball looks at the Etch-a-Sketch.]
:Etch-a-Sketch: Hi!

:[Head of Megan appears in the black hole Cueball has drawn on the Etch-a-Sketch screen.]
:Megan: You're cute!

:[Cueball is looking closer on the Etch-a-Sketch screen.]
:Cueball: Wha—
:Megan (out of the Etch-a-Sketch): I'm the one who draws when you turn the knobs.
:Megan (out of the Etch-a-Sketch): It's lonely in here.

:[Cueball holds the Etch-a-Sketch further away from his head.]
:Cueball: It's lonely out here too.
:Megan (out of the Etch-a-Sketch): I'm glad you found me, then!

:[Cueball holds the Etch-a-Sketch very close to his face. Panels start to break away into thought bubbles.]
:Megan (out of the Etch-a-Sketch): Let's be friends
:Megan (out of the Etch-a-Sketch): And never be alone again.

:[The next panel is almost gone in the thought bubbles. In the remaining top left corner there are three pink hearts, the top one of these looks like it was drawn on an Etch-a-Sketch.]

:[From the last two panels the above turns out to have been a fantasy of Cueball. There is a rather large break between the first three lines of panels to the last line. Between the previous line of panels (from the middle panel ) to the last line, there are three large circles, which then continues with seven more inside the next panel down to Cueball sitting with the etch-a-sketch.]
:Cueball: *Sigh*

:[Close up of the Etch-a-sketch where the black hole Cueball has drawn shows what is really behind the glass; just the mechanics of the machine, with a pin that moves on a cross and removes the sand from the screen.]

:[Zoom back out to Cueball who shakes etch-a-sketch above his head.]

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Romance]]
[[Category:Social interactions]]

1337: Hack

2022-05-04T19:54:51Z

PaintspotInfez: Undo revision 240652 by Ex Kay Cee Dee (talk) Reverted vandalism.

<noinclude>:''"1337", this comic's number, redirects here. For the 2007 storyline of the same name, starting with [[341: 1337: Part 1|comic 341]], see [[:Category:1337]].''</noinclude>
{{comic
| number = 1337
| date = March 3, 2014
| title = Hack
| image = hack.png
| titletext = HACK THE STARS
}}

==Explanation==
This comic is an imagined project to re-position the {{w|International Cometary Explorer|ISEE-3/ICE}} probe, and a parody of the 1995 movie ''{{w|Hackers (film)|Hackers}}''. The first row (four panels) explain the history of the probe, and the true story about how the probe was coming back into signal range and seemed capable of being controlled. NASA declined to attempt to regain control of the probe, but a group of enthusiasts assembles the equipment and attempts to re-purpose the probe.

The following two rows (eight panels) set up a fictional scenario: the enthusiasts have been locked out of the system, the probe is being controlled by someone else, and the message "Mess with the best, die like the rest" is communicated from the probe. This is a catch phrase of the protagonist, Crash, from ''Hackers''.

The final row is a reference to the ending of the movie, where Crash romances Burn, his romantic interest, in a rooftop pool. In the movie, while Crash and Burn swim in a rooftop pool, several buildings light up with the words "CRASH AND BURN". This was at the end of a contest and is Crash's latest hack and romantic gesture which he indicates by saying 'Beat that!'. In the comic the transmitter being used to communicate with ISEE-3 was hacked by Burn to make the probe burn up over Crash and Burn swimming in the pool providing a "shooting star" for romantic effect.

The comic number is 1337, which stands for "leet", short for "elite hacker" and "leetspeek" in {{w|leetspeak}}. Leetspeak is a form of symbolic writing that substitutes various numbers and {{w|ASCII}} symbols for letters. It originates from the hacker subculture, where words were converted to leetspeek e.g. to avoid filters and triggers on chat rooms. "1337" for "leet" can most likely be explained as {{w|calculator spelling}}.

The title text "Hack the stars" is also an allusion to ''Hackers'', where the phrase "Hack the planet!" is used on multiple occasions.

This project since [http://spacecollege.org/isee3/ became reality], as [[Randall]] noted in a [http://blog.xkcd.com/2014/05/30/isee-3/ blag post]. See [[#Background for ISEE-3/ICE|details below]].

==Transcript==
:[A black image shows an image of the ISEE-3/ICE spacecraft in white. Text is written in white above it]
:The ISEE-3/ICE probe was launched in 1978.
:Its mission ended in 1997 and it was sent a shutdown signal.

:[The text continues, black on white, without a frame around it, between the first frame and the next.]
:In 2008, we learned-to our surprise-that the probe didn't shut down.
:It's still running and it has plenty of fuel.
:...and in 2014, its orbit brings it near earth.

:[Megan holding up one hand and Ponytail are talking to each other.]
:Megan: We could send it on a new mission...
:Megan: Except we no longer have the equipment to send commands to it.
:Ponytail: Can't we—

:[Zoom in on Megan's head and torso as she looks towards Ponytail off-panel to the right.]
:Megan: NASA won't rebuild it. "Too Expensive"
:Ponytail (off-panel): ''Seriously?''
:Megan: I know, right?
:Megan: So the internet found the specs
:Megan: And we went to work.

:[Megan and Ponytail are walking towards right, between Hairbun facing left and Cueball (with head phones) facing right. They are sitting at desks working on their laptops. Megan speaks, as indicated both by the story line and by her hand which is lifted up, but there is not speech line from her to the text.]
:Megan: We've convinced them to give us time on the Madrid DSN transmitter and hacked the maser to support the uplink.
:Megan: And today's the big day.

:[Zoom in on Cueball's head and torso, he holds a hand up to his speaker on his head phones and watches his lit screen (as indicated by lines emanating from it).]
:Cueball: Transmitting...
:Cueball: We have a signal!
:Cueball: We have control!

:[Zoom in on Megan's head and torso. She has turned away from Cueball to the right towards Hairbun.]
:Megan: OK, transmit the new comet rendezvous maneuver sequen—
:Cueball (off panel): What ''the hell?''
:Megan: What?

:[Same setting as when Megan and Ponytail entered the control-room, but Ponytail just stands there and Megan puts a hand out towards Cueball.]
:Cueball: My console went dead!
:Hairbun: ''Mine too!''
:Megan: What's happening?!

:[Another zoom in on Cueball's head and torso and glowing screen. He has both hands down.]
:Cueball: There's a new signal going out over the transmitter!
:Megan (off panel): A bug?
:Cueball: ''Someone else is in the system!''

:[Zoom in on Hairbun's head and torso. She is also working on her laptop, with the glowing screen visible.]
:Hairbun: Kill the connection!
:Cueball (off panel): ''I can't find it!''
:Hairbun: ''They're firing the probe's engines!''
:Cueball (off panel): ''No!!''

:[Back to a zoom in on Cueball. He points at his screen.]
:Megan (off panel): ''Who's '''doing''' this??'' Stop them!
:Hairbun (off panel): ''I'm trying!''
:Cueball: ''Look! My screen!''

:[Same setting as when Megan and Ponytail entered the control-room, but Ponytail has a hand to her mouth and she and Megan stand close to Cueball who has taken his hands off the keyboard. The text on Cueball's laptop screen is shown above the setting, indicated with zigzag lines:]
:M-E-S-S-W-I-T-H-
:T-H-E-B-E-S-T

:D-I-E-L-I-K-E-
:T-H-E-R-E-S-T

:[The last four panels is outside night scenes with a black sky above. In the first of these a woman (Burn) with long hair (Megan like) and a hairy man (Crash) is seen in a swimming pool with blue water.]

:[A zoom out reveals that the pool is on top of a skyscraper in a vertically developed, downtown setting with lots of light in all the skyscrapers, one of which is even taller than the one with the pool. From the top of the central skyscraper speech lines come which indicate that the two from the pool is up there speaking, and we get their names from this panel.]
:Burn: Crash?
:Crash: Yeah, Burn?

:[Same setting but only one speech line.]
:Burn: Make a wish.

:[The last panel shows the same setting, but with the spacecraft streaking across the sky as it enters the Earths atmosphere and burns up in a way that is indistinguishable from a meteoroid.]

==Trivia==

===Background for ISEE-3/ICE===
The {{w|International Cometary Explorer|ISEE-3/ICE}} probe was launched in August 12, 1978 and tasked to study Earth's magnetic field and the solar wind. Before completing its original mission the probe was repurposed on June 10, 1982 to study the interaction between the solar wind and a cometary atmosphere. By flying through the comet {{w|21P/Giacobini–Zinner|Giacobini-Zinner}}'s tail, it became the first probe to do so. This put ISEE-3 in a {{w|heliocentric orbit}}. Its trajectory will bring it close to Earth on August 2014.

The Deep Space Network (DSN) detected the probe again in 2008 because NASA mistakenly left its transmitters on. However, the probe was only transmitting the carrier signal at that time. A status check of the spacecraft has revealed that many of its instruments are still working and that it contains plenty of fuel.[http://www.planetary.org/blogs/emily-lakdawalla/2014/02070836-isee-3.html]

It was reported that the hardware to communicate with ISEE-3/ICE had been decommissioned. The Madrid DSS complex still has the special filter required to communicate with the ICE satellite, but because of frequency conflicts S-band uplink is not supported.[http://deepspace.jpl.nasa.gov/dsndocs/810-005/101/101E.pdf]

On March 1 and 2, 2014 radio amateurs were able to detect the beacon signal from the retired NASA deep space probe ICE (International Cometary Explorer) using the 20 m radio telescope at the Bochum Observatory (Germany).[http://amsat-uk.org/2014/03/09/radio-amateurs-receive-nasa-isee-3ice-spacecraft/]

===Updates for ISEE-3/ICE===
After this comic was published, it was established that an 18-meter satellite dish at the Johns Hopkins Applied Physics Laboratory does still have the right hardware.
*April 4, 2014: Volunteers started a crowdfunding project on RocketHub to contact the probe and put it back into a {{w|halo orbit}} orbit around {{w|Lagrangian point}} L1.[http://www.rockethub.com/42228 "ISEE-3 reboot"]
*May 23, 2014: First contact to the probe was established.
*May 29, 2014: NASA gave them approval to try to achieve contact.
*May 30, 2014: The project, led by [http://www.rockethub.com/profiles/68340-dennis-wingo Dennis Wingo] and {{w|Keith Cowing}}, had taken control of the spacecraft.
*July 2, 2014: The reboot project successfully fired the thrusters for the first time since 1987. The engines on ISEE-3 performed a successful spin-up burn. The spin rate was changed to 19.76 rpm which is inside of the original mission specifications at 19.75 +/- 0.2 rpm.
**Further attempts to change the trajectory into an earth bound orbit did fail. Despite the effort from experts and amateurs via the internet [http://spacecollege.org/isee3/we-are-borg-crowdsourced-isee-3-engineering-and-the-collective-mind-of-the-internet.html] it was determined that the spacecraft had run out of nitrogen pressurant.
*Since the device was still communicating, and many of the instruments were still working, the ISEE-3 was intended to be used for the first citizen science, crowd funded, crowd sourced, interplanetary space science mission.[http://spacecollege.org/isee3/announcing-the-isee-3-interplanetary-citizen-science-mission.html]
*{{w|International_Cometary_Explorer#Contact_lost|Contact was finally lost}} on 2014-09-16.

See [http://spacecollege.org/isee3/ Space College: ISEE-3 Reboot Project Archives] for the coverage of this amazing project.

{{comic discussion}}

[[Category:Comics with inverted brightness]]
[[Category:Comics with color]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Hairbun]]
[[Category:Space probes]]
[[Category:Astronomy]]
[[Category:Computers]]

1940: The Food Size Cycle

2022-05-04T19:53:44Z

PaintspotInfez: Undo revision 240736 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 1940
| date = January 10, 2018
| title = The Food Size Cycle
| image = the_food_size_cycle.png
| titletext = There's data suggesting that this model may apply to deep-dish/thin-crust pizza. I've designed a thorough multi-year study to investigate this personally, but funding organizations keep denying my grant requests.
}}

==Explanation==
This comic illustrates the evolution of the size of food items over time, using the example of a sandwich. It starts with a regular sandwich at the beginning. As the sandwich became more popular, sandwich makers had an {{w|arms race}} concerning sandwich size as they competed for customers. Eventually, these sandwiches became too big to eat comfortably. At this point (according to Randall) some smart guy invented the panini, a small sandwich, to cater to those who couldn't find a sandwich small enough for their needs. Eventually, the panini itself will begin to grow, and either displace or become indistinguishable from the existing giant sandwiches, and the cycle will repeat. This is similar to Clayton Christensen's theory of disruption, where products keep adding features beyond what is needed by customers, and is then resolved by cheaper products with adequate features.

The title text suggests that the same cycle may be applicable to the depth of pizza crust, with thin crusts being replaced with deeper and deeper ones, eventually necessitating a resurgence in thin crust. Randall laments that despite seeking funding to conduct experiments to test that hypothesis, he keeps getting turned down, probably because it sounds suspiciously like he wants to be paid for eating pizza.

==Transcript==
:[There is a chart with the x-axis shown on top labeled "Food item size" and the y-axis labeled "Time". There are arrows pointing away from the top left corner on both axis.]

:'''The food size cycle'''
:[A normal sandwich is shown high up the chart. The text on the right reads:]
:Initial normal-sized food (sandwich, burger, burrito, taco, etc)

:[The next part below, further in time, has no pictured item but the text reads:]
:Food becomes more popular

:[Next below a larger sandwich is shown.]

:[And below again an even larger sandwich is shown. The text to the right is:]
:Size arms race: average item grows as restaurants compete to offer the largest version to hungry customers

:[On the left side, representing small food sizes, the text embedded in arrows pointing to every direction is:]
:Void

:[Below of that an enormously large sandwich is shown. The text is:]
:Food gets too large to eat comfortably

:[More below a new row on the left for small sizes comes up, inside is a panini. The text reads:]
:New format appears and fills the void (panini, burrito bowl, taquito, slider, etc)

:[Below of all the two paths may converge, indicated by two arrows pointing downwards and slightly together. The final text reads:]
:Merger or replacement

{{comic discussion}}

[[Category:Charts]]
[[Category:Food]]

1530: Keyboard Mash

2022-05-04T19:53:27Z

PaintspotInfez: Undo revision 240764 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 1530
| date = May 27, 2015
| title = Keyboard Mash
| image = keyboard mash.png
| titletext = WHY DON'T YOU COME HANG OUT INSIDE MY HOUSE. WE CAN COOK BREAD AND CHAT ABOUT OUR INTERNAL SKELETONS.
}}

==Explanation==
[[Cueball]] is chatting with [[White Hat]], who says he is frustrated because a barking dog is preventing him from sleeping and White Hat mashes the {{w|keyboard}} to show his frustration. Keyboard mashing is often used in this way where the user makes their hands spasm across the keyboard, creating a line of text that can be compared to an angry groan in real life. Cueball is about to give some advice, but is confused by a quirk in what White Hat typed. All the characters he typed (except one) were on the home row of the QWERTY keyboard, the row starting with the letters A, S, D, and F, in the middle of the keyboard. The letters A, S, D, F, J, K, and L (all from the home row) are scattered throughout the text, but there is a 7 (which comes from the numbers row, on top of the keyboard) in the middle of this text. Cueball, wonders how White Hat put a seven in there, because if White Hat was keyboard mashing and touched the 7 key, he likely would have hit any of the QWERTY row keys because of keyboard mashing hand spasms, but he didn't. All the other characters were on the home row. White Hat berates Cueball for always focusing on strange, tiny details. When the final panel shows what's going on where White Hat is, we see that a giant {{w|spider}} has imprisoned him in a web and is talking to Cueball, which explains how the keyboard mashing "White Hat" did was strange.

The reason the dog was barking appears to be because the giant spider was lurking nearby. Little did White Hat know that the dog was alerting him of the spider. When the spider notices that White Hat mentions the barking dog to Cueball, the spider apparently restrains White Hat and takes over typing. Another possibility is that the "dog" barking is actually White Hat, as he is seen making grunts from beneath the spider's silk. It can be seen in the last panel that the spider is typing with 3 legs, which explains how the 7 key would have been pressed.

The statement "I am a normal human typing with my human hands" is {{tvtropes|SuspiciouslySpecificDenial|an oddly specific assertion}} from the giant spider that it is actually a human, a claim that would normally be taken for granted and had not really been cast into doubt by Cueball's inquiries about how "7" got into a string of home-row keystrokes.

The title text invitation ends with a similar statement, suggesting that they "...CHAT ABOUT OUR INTERNAL SKELETONS", which spiders (unlike humans) do not possess and which are not a common conversation point among humans, helping to demonstrate (along with the spider's suspiciously specific denial and using the phrase cook bread instead of bake bread) that the spider is not very good at blending in as a human. This implies that the spider also wants to trap and possibly eat Cueball as well, or actually hang out with him in an attempt to make friends or to find out how humans talk so the spider will be able to blend in better in the future. "...HANG OUT INSIDE MY HOUSE" may also have a double meaning, as White Hat and the spider are actually "hanging" from the ceiling inside White Hat's house. Also another oddity is that the spider asks Cueball to cook bread, although bread is actually baked, and in any case this isn't a common pastime during the night (the spider could also mean make toast). The final oddity is that the title text is written in all caps which is usually interpreted as shouting and would not be used in a casual invitation, although the title text should just be imitating the fact that the rest of the text messages use a font that make them look like they are in all caps.

The central theme of the comic is a vindication of Cueball's world-view, wherein tiny oddities such as the appearance of a numeral in a keyboard mash merit investigation. In the real world, the appearance of a "7" in the middle of a home row keyboard mash is more likely attributable to {{w|Rollover (key)#Key jamming and ghosting|key ghosting}}.

Alternatively, the fact that Cueball uses the phrase "all your hands" instead of "both your hands" or "both of your hands" could indicate that Cueball (and likely other people as part of a coordinated uprising of giant spiders) has also been taken hostage by a spider, and the spider behind Cueball's profile picture knows that the organism behind White Hat's profile picture is a spider, not a human. This would also explain why the spider behind White Hat's profile picture feels that the spider behind Cueball's profile picture pointing out the usage of a numeral among home row keys is weird; spiders know that other spiders have many legs and that these legs do not have to be in the same section of the keyboard.

In the title text of [[1541: Voice]] there is again a reference to a sentence that could be uttered correctly by a human, but would never be used in real life. But a non-human entity that tries to blend in as a human, may inadvertently use such a "wrong" sentence to try to ensure other people think they are indeed humans. It is a direct reference to the type of sentence used in the title text here.

This comic is somewhat unusual in that the panels are read from top to bottom instead of being read from left to right in more than one row. This may be in order to accommodate the second panel, which must be tall due to containing a text conversation, without making the comic look weird due to the second panel being much taller than the first panel.

==Transcript==
:[Cueball approaches his desktop computer, which has emitted a message seemingly from White Hat as it displays a picture of him.]
:New chat message

:[Below the chat log is shown with White Hat's comments on the left in gray frames and Cueball's comments to the right in white frames. The first post in a row from each person is labeled with their picture at the end of a small arrow in the frame]:
:White Hat: Can't sleep. Stupid dog keeps barking.
:White Hat: So frustrating. FJAFJKLDSKF7JKFDJ
:Cueball: Ugh, I'm sorry. Maybe you could...
:Cueball: ... Okay, wait. I have to ask.
:Cueball: How did you hit a "7" in the middle there?
:White Hat: Huh?
:White Hat: I was just randomly keyboard mashing.
:Cueball: Sorry, Right.
:White Hat: Anyway,
:Cueball: I know this is silly, but like... All your hands were clearly right on the home row.
:Cueball: I don't get how one finger could have stretched up to the "7".
:White Hat: Why do you always fixate on these bizarre details?
:Cueball: I don't know.
:Cueball: Sorry.
:White Hat: It's weird, is all.

:[Chat transcript continues above White Hat's laptop, as it started in the first panel over Cueball's computer. But now we see a human-sized spider suspended from the ceiling by web is using three of its legs to type on the laptop. Behind the spider, White Hat is suspended from the ceiling upside down, almost totally encased in spider web. He tries to speak. Between them, a chair has been knocked over onto its back.]
:Spider (as White Hat in the chat): I am a normal human typing with my human hands.
:Cueball (chat): Yeah, of course. I know.
:White Hat (speaking): '''Mmm!! Mmph!!!'''

{{comic discussion}}
[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Cueball]]
[[Category:Spiders]]

1655: Doomsday Clock

2022-05-04T19:53:12Z

PaintspotInfez: Undo revision 240679 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 1655
| date = March 14, 2016
| title = Doomsday Clock
| image = doomsday_clock.png
| titletext = After a power outage at the Bulletin of the Atomic Scientists, the new Digital Doomsday Clock is flashing 00:00 and mushroom clouds keep appearing and then retracting once a second.
}}

==Explanation==
The {{w|Bulletin of the Atomic Scientists}} is an academic journal which has a recurring feature known as the {{w|Doomsday Clock}}, which shows the Bulletin's judgment on the current state of the world. The idea is that when the clock hits midnight, the world ends (originally conceived as in a {{w|nuclear war}}), so how close the clock is to midnight is a scale of the world's current state of risk. Its setting as of the publication of this comic was at "three minutes to midnight" (11:57 PM or 23:57). Its current setting is (as of 24th January 2020) at "100 seconds to midnight" (11:58:20 PM or 23:58:20).

{{w|Daylight saving time}} (DST) is a feature in many countries where in the summer months, everyone moves their clock forward an hour to artificially postpone sunset and thereby have a longer time of sunlight in the afternoon. The {{w|History_of_time_in_the_United_States#Start_and_end_dates_of_United_States_Daylight_Time|day before this comic came out}} (Sunday), most of the United States switched from standard time to DST. This makes it the first of [[:Category:Daylight saving time|several comics about DST]] that has been released in conjunction with the beginning of DST.

[[Cueball]] is inside the office of the Bulletin of the Atomic Scientists and comes across the Doomsday Clock, which is apparently an actual clock. Citing a {{w|mnemonic}}, "Spring forward, fall back", referring to which direction to move the hour hand in the season when DST begins or ends, he pushes the hour hand forward one hour, so instead of the world being three minutes ''from'' the end of the world, it is now 57 minutes ''into'' it, so the final panel simply shows the world erupting in a {{w|Dr. Strangelove|''Dr. Strangelove''}}-esque [https://youtu.be/NFkryh6hC-k?t=23s nuclear apocalypse], with the typical mushroom cloud shape, with a ring around the stem, which is also displayed in the Wikipedia page on {{w|nuclear weapons}}.

This is an absurdist joke confusing the Doomsday Clock with an actual clock; the Doomsday Clock is a subjective measurement of risk, not of time, and as such is not subject to Daylight Saving Time. Furthermore, in the comic the Doomsday Clock does not just measure the world's risk but actively controls it; even if the Doomsday Clock were affected by DST, the doomsday scenario notably does not occur until Cueball adjusts the clock. Also Cueball would only ever adjust the clock like this, if he happened to come by just when the real time was 12:57 the day after DST (as it is not clear from an analog clock if it is AM or PM). When he spots the clock showing 11:57 at 12:57 he just thinks someone has forgotten this particular clock, (which happens a lot the day after DST), and he is thus just helpfully adjusting to the new correct DST time.

The title text continues on this same theme, with the digital doomsday clock (apparently it has now been replaced by a digital one, maybe Cueball broke the old analog one) being reset by a power outage. Many [https://www.youtube.com/watch?v=_0fdc_D38-c digital clocks blink] 00:00 once per second after a power outage, only stopping when the clock is reset. This is interpreted as the world actually blinking in and out of the Doomsday Clock's midnight, so nuclear explosions thus naturally appear and disappear in sync with the clock.

This once more underlines the entire point of this comic, that it makes no sense to have such a clock. Many people, including [[Randall]], also believe that DST also makes little sense today, so maybe this is why the two are connected in this comic. Randall has [[:Category:Daylight saving time|mocked DST several times]], so this could be yet another attempt to have some fun at its expense.

Another doomsday clock was used in [[1159: Countdown]], although here it was for a {{w|supervolcano}} eruption. A nuclear bomb, not yet exploded but with a short countdown, was the facilitator of the joke in [[1168: tar]].

Within a year before this comics release Randall made several other comics about nuclear weapons, most recently January of 2016 with [[1626: Judgment Day]], and before that these two in 2015, [[1539: Planning]] and [[1520: Degree-Off]]. Nuclear weapons are also mentioned twice in ''[[Thing Explainer]]'', specifically they are explained in the explanation for ''Machine for burning cities'' about {{w|Thermonuclear weapon|thermonuclear bombs}}, but they are also mentioned in ''Boat that goes under the sea'' about a submarine that caries nukes. All three comics and both explanations in the book, does like this comic, comment on how crazy it is that we have created enough firepower to obliterate Earth several times (or at least scourge it for any human life). After these there was some time without nuclear bombs, but a new mushroom cloud was displayed in [[1736: Manhattan Project]], the week after such weapons invention was listed at 1950 CE.

==Transcript==
:[Above a clock that shows 3 minutes to 12:]
:Bulletin of the Atomic Scientists
:<big>Doomsday Clock</big>

:[Cueball enters the frame from the left and walks up the clock while looking up at it.]
:Bulletin of the Atomic Scientists
:<big>Doomsday Clock</big>
:Cueball: Oh hey, spring forward.

:[Cueball grabs hold of the hour hand on the clock and adjust it one hour ahead to 3 minutes to 1.]
:Bulletin of the Atomic Scientists
:<big>Doomsday Clock</big>

:[Nuclear apocalypse with one large central mushroom cloud, with a typical ring around the central stem, two other mushroom clouds are behind it left and right as well as three smaller ones near (or even partly under) the horizon. There are also three smaller explosion in the air.]

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Daylight saving time]]
[[Category:Time]]
[[Category:Nuclear weapons]]

231: Cat Proximity

2022-05-04T19:52:56Z

PaintspotInfez: Undo revision 240659 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number =231
| date =March 5, 2007
| title =Cat Proximity
| image =cat_proximity.png
| titletext =Yes you are! And you're sitting there! Hi, kitty!
}}

==Explanation==
This comic refers to the use of "{{w|baby talk}}" when speaking to pets, especially {{w|cats}}. A person's voice becomes {{w|falsetto}} and {{Wiktionary|cooing}}, vocabulary becomes simplified, and phrases are repeated, such as "Here, kitty, kitty, kitty."

The chart shows that a person's apparent intelligence decreases, and that the {{Wiktionary|inanity}} (i.e. uselessness or emptiness) of their statements increases, the closer they get to a cat.
Most people act like this when they're playing with cats or trying to call them over to them.
Thankfully, being close to a cat doesn't actually cause any decrease of intelligence in normal circumstances; the graph technically refers to ''demonstrated'' intelligence rather than actual IQ levels.{{Citation needed}}

The title text continues [[Cueball|Cueball's]] obvious statement (and thus inane/useless point made) from below the graph.

In [[1535: Words for Pets]], [[Randall]] again mentions how people often talk strangely to their pets.

==Transcript==
:[A graph with the x-axis labeled, and the scale indicated from left to right:]
:Far
:Human proximity to cat
:Near
:[Two curves are drawn and labeled, first the one starting on top, which then veers downwards and crosses the other as that curve veers upwards.]
:Intelligence
:Inanity of statements

:[Below the graph, Cueball is seen standing at three distances from a cat that is drawn to the far right. The two first Cueballs are just standing, one below far, the other in the middle, and the last is standing close to the cat (below near) with his hands up, and he is speaking.]
:Cueball: You're a kitty!

==Trivia==
*This comic is available as a signed print in the [https://store.xkcd.com/products/signed-prints xkcd store].

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Cats]]
[[Category:Line graphs]]
[[Category:Comics with xkcd store products]]

1963: Namespace Land Rush

2022-05-04T19:51:57Z

PaintspotInfez: Undo revision 240651 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 1963
| date = March 5, 2018
| title = Namespace Land Rush
| image = namespace_land_rush.png
| titletext = You can also just mash the keyboard at random, but you might end up with a gibberish name no one can pronounce.
}}

==Explanation==

When a new web service starts, such as a forum, a social media server or an email portal, the people who sign up get to choose their username on the service, which, in most cases, blocks future users from using those usernames. Common names such as "john" are likely to be taken quickly. This is analogous to the way that land was distributed in America, with the first to claim able to choose the best land.

This comic is a list of usernames [[Randall]] suggests should be used if they are available.

The title text is a self-reference to "xkcd"; the name of the comic is a purposefully unpronounceable phrase created by Randall. The fact that an unpronounceable name is portrayed as a disadvantageous outcome is also humorous because the comic has a section dedicated to unpronounceable usernames.

(Note: for a more serious list of problematic user names to block from a service provider’s point of view, see [https://ldpreload.com/blog/names-to-reserve Hostnames and usernames to reserve] as well as [https://tools.ietf.org/html/rfc2142 RFC 2142].)

==Table==
{| class="wikitable"
!style="width:30%"|Entry
!style="width:70%"|Explanation
|-
!colspan=2|Straightforward (Usernames that a person would use under typical circumstances)
|-
|<Your usual username, if any>
|Most internet users will have settled on some unique handle that they try to use across all platforms. Even if this wasn't a new service, most people would try this first.
|-
|<Your given name>
|More rare is using one's nickname or first name as their username, since the amount of common names will mean many users share a name. Thus, if you can get your given name, you will have a simple username that many others wanted, and without resorting to prefixes or numbers (i.e. Xx_MyName00_xX)
|-
|<Your full name>
|Similar to your given name, but slightly more unique since a last name and/or middle name is added.
|-
|<Initial><Surname>
|A common second choice if a given or full name is already in use.
|-
|<Surname>
|Possibly available if your last name is more uncommon; names like "Smith" or "Kim" will probably be taken faster than even given names.
|-
!colspan=2|Recognizable (Usernames that would make it look like the email came from an official source within the organization named)
|-
|Google
|Registering the name "Google" would allow for communicating on the site (or even outside of it) with a name that appears to be an official Google account. For any of the examples in this section, you would select the names for the same reason. This has been done in the past with both [https://twitter.com/BiIIMurray humorous] and [http://www.chicagotribune.com/bluesky/technology/ct-russian-twitter-account-tennessee-gop-20171018-story.html nefarious] results.
|-
|iPhone
|Many services would mark messages sent from an iOS client on iPhone as "sent from iPhone".
This could make people believe that your messages are sent from an iPhone even if you don't own one.
|-
|Facebook
|Similiar to Google above.
|-
|Bitcoin
|One could pose as the Bitcoin Core development group by using this handle and/or scam uninformed users interested in cryptocurrencies.
|-
|Obama
|Impersonating a president, supposedly to send messages as them to make them seem bad (or not).
|-
|Canada
|Impersonating a whole country might get you in trouble.{{Citation needed}}
|-
|NFL
|The American "National Football League".
|-
|Garfield
|In the original "GMail" service on the Internet, the G stood for "Garfield".
|-
|<Your city>
|Impersonating the official account for your place of residence.
|-
|NASA
|The American "National Aeronautics and Space Administration". Randall worked there as a contract programmer and roboticist.
|-
|<Name of person who runs the service>
|Impersonating the site owner can get you the trust of users.
|-
!colspan=3|Causing Trouble (Usernames that might cause errors when mixed with the service's back-end code)
|-
|User
|This is usually the default username for a non-administrative account. This may trick a user that this is owned by the operator of the service.
|-
|Username
|See above.
|-
|Name
|See above.
|-
|You
|Many services display "You" as the signed-on user, so naming oneself "You" makes users think that they are you/they are signed on when they aren't.
|-
|Guest
|Attempts to fool users into thinking that they have a guest account.
|-
|Account
|The opposite of "Guest" (someone without an account). However, for someone with an account, their username will usually be displayed.
|-
!colspan=2|Causing More Trouble
|-
|Admin
|Impersonating to be a system administrator will let someone fool people and cause a lot of trouble. In particular, it could be used to obtain SSL certificates by demonstrating ownership of a supposedly internal address.
|-
|Administrator
|See above.
|-
|System
|Pretending to be a system-controlled account - might give permissions if the server checks by name.
|-
|<Name of service>
|Pretending to be the official account of the service.
|-
|Help
|Pretending to be the help account. This could led to many questions from new users.
|-
|Error
|This may trick users to do what the user says as they could claim that it was a legitimate error.
|-
!colspan=2|Impossible to Say
|-
|Hyphen-Emdash
|Could be read "Hyphen hyphen Em dash" or "Hyphen dash em dash".
|-
|Dash-8hyphen-8
|Could be read "Dash dash eight hyphen dash eight" or "Dash hyphen eight hyphen hyphen eight". "Hyphen eight" sounds like "hyphenate".
|-
|Zero0ne2numeral2
|Could be read "Zero zero one two numeral two" or "Zero zero ne two numeral two" or "Zero oh ne two numeral two".
|-
|KrisasinHemsworth
|This would be confusing to say out loud, as it would sound like the user was saying that their username was "Chris," spelled the same way that famous actor {{w|Chris Hemsworth}} spells his name. However, the actual username uses the name "Kris," spelled a completely different way than Chris Hemsworth's name, and the phrase "as in Hemsworth" being also part of the username, rather than a clarification of the spelling of "Kris" as would be assumed.
|-
|TheWord&Ampersand
|This would also be confusing and difficult to communicate, as anyone trying to read the username to someone else would say "The word ampersand ampersand" which could be interpreted as "ampersand&" or "ampersand ampersand". Having the phrase "the word" in front of a symbol makes it quite difficult to communicate which variation of ampersand (word or symbol) is actually being referred to.
|-
|ZettaWith3Teees 
|Read aloud, this would lead the listener to expect a username of 'Zettta'. Clarifying that "with three tees" is text and not description would in turn make it difficult to explain the spelling of 'Zetta' with two 't's, and 'Teees' with three 'e's.
|-
!colspan=2|Misc
|-
|<Single Letters> and <Single Numbers>
|These are highly valuable. The Twitter handle "@n" for example is constantly bombarded with offers and hacking attempts.
|-
|<Common Words>
|Also highly valuable; overlaps with "Recognizable" and "Causing (more) Trouble".
|-
|<SQL/JS Injection>
|Codes such as "Drop Table" intended to cause errors or even damage the service's back-end code. (See [[327|Comic 327]])
|-
|ASDF and QWERTY
|Since those keys are right next to each other (on English language layouts), they are often typed as placeholders.
|-
|Yes
|This might be a [[Beret Guy]]-esque misunderstanding when filling out the sign up form. When encountering the form field "Username:" someone may type "Yes" (as in "yes, I want a username") instead of specifying it.
|-
|Bot and Computer
|Pretending to be a bot.
|-
|Blocked
|When users get banned or blocked, their name is often replaced by a string like this.
|-
|Deleted
|Some services like Reddit keep up user posts and data after account deletion, marking the content as submitted by the user "[Deleted]" or "Deleted".
|-
|Jeeves
|Might refer to {{w|Ask Jeeves}} (now Ask.com), a Internet Search Engine.
|-
|Narrator
|In books, radio plays and movies it is quite common to have a narrator explain parts of the story. In an online forum however, it is not.{{Citation needed}}
|-
|Internet
|"The Internet" sometimes refers to a large group of users, the collective hive-mind if you will. However, there cannot be a single user account speaking on behalf of them, as they aren't a single entity.
|-
|NPC
|Stands for Non-player character.
|-
|Password
|If the user accidentally typed their password into the username field, this would be the result.
|-
!colspan=2|Permissive Character Sets
|-
|<Space>
|Usernames containing only whitespace can not only be confusing for other people, but often systems 'trim' (remove whitespace at the beginning and end) user input. If the username was only made of spaces, after trimming it would be completely empty, which can cause a whole slew of other problems.
|-
|<nowiki>@ é |</nowiki>
|The @ seperates the local part from the domain part of email addresses. If a service decides to create email addresses for their users, they will have a hard time if they allowed the "at" character as part of a username.
é is encoded in many character sets, like Latin-1 and Unicode. In Unicode, it can even be described either "U+00E9 LATIN SMALL LETTER E WITH ACUTE" or as the sequence "U+0065 LATIN SMALL LETTER E" and "U+0301 COMBINING ACUTE ACCENT". If a system uses {{w|Unicode normalization}} after the check if the username is available, this might allow someone to take over someone else's account.
|-
|<nowiki>“ ” " ‘ ’ ' `</nowiki>
|Various quotation marks.
“, ”,‘ and ’ (Unicode quotes): can expose a system's inability to handle multi-byte-encodings. If they are converted to their ASCII counterparts, they might cause code injections.
' and " (ASCII single and double quotes): often used as string delimeter (causing the rest of the name to be interpreted as HTML, or worse, code.
` (ASCII grave / backtick): Sometimes used as string delimeter; Perl (which some websites are still programmed in) executes commands ("shell code") when between backticks.
|-
|<NBSP>
|Unicode character "U+00A0 NO-BREAK SPACE". Similar attack vector as <Space>, but some programming languages will not strip non-ASCII whitespace (therefore the validation will pass).
|-
|<nowiki>\ . #</nowiki>
|The backslash is very often used for "escape sequences", that get expanded to other characters. (\n -> newline, \t -> tab character, \b -> backspace character (deletes the character to its left), etc.)
The period can be problematic in emails. RFC 2822 forbids periods at the beginning or end of the local part or more than one period in a row.
In URLs, the Octothorpe (#) is used as the 'anchor'. Anything following a # will not be transmitted to the server. If a user is named 'logout#blahblah' (which might be a valid username) and the user profile is located at http://example.com/<the_username>, the server might generate the URL http://example.com/logout#blahblah. Since the URL will be truncated at the '#', any user attempting to view this profile will be logged out of the service.
|-
|<RTL override>
|The right to left override is an Unicode character which forces text after it to be laid out right to left. Thus, in left-to-right locales, it flips everything after it. This can be rather amusing if permitted. (See [[1137|Comic 1137]])
|-
|<nowiki>– - _ /</nowiki>
|Includes both the em-dash and the hyphen, which are easily confused and are highly unusual for user names. The forward slash is also the path delimeter for URLs; if user profiles are located at e.g. http://example.com/user/the_username, this can cause obvious issues.
|-
|<Any emoji>
|Current databases are not set up to store emojis as characters.
|-
|","
|In CSV files this separates one column or data item from another. This could cause bugs if the usernames are used as part of a CSV file since the next column on the row could be left blank filled with other data.
|-
|<nowiki>&NBSP</nowiki>;
|The special entity in HTML (web page language) for a non-breaking space, or a space that prevents an automatic line-break at its position. When rendered as part of an HTML page without sanitization, this would only display a space.
|-
|<nowiki></HTML></nowiki>
|This is trying to inject code for the web page using the user name. If the user name is not sanitized and does not have special characters encoded, this HTML end tag could end the HTML document, leading to page errors.
|-
|&LT;/HTML&GT;
|&LT; and &GT; are special character entities in HTML that represent < and >, repectively. So all together, when rendered as part of an HTML document, this would print "<nowiki></HTML></nowiki>" Although this would look similar to the previous <nowiki></HTML></nowiki> entry, it would be unlikely to cause problems as the symbols are not interpreted if encoded as special entities.
|-
|OkThisIsKindOfConfusingButIt's <LessThan\ForwardSlashHTML GreaterThanActualGreaterThan Symbol>Yes,ThatWasAllPartOfThe Name,ButSoIs...Ok,LetMeStartOver”
|The abundance of symbols and symbol related worlds and phrases such as ActualGreaterThanSymbol would make this extremely difficult to vocally communicate to another person. This difficulty is further compounded by the parts at the beginning and end, which sound like they are part of the explanation despite being part of the name itself.
|-
|}

==Transcript==
{{incomplete transcript|Layout not standard (eg. indentation) and a short description at the beginning about what is shown should be given.}}
'''Namespace Land Rush Cheat Sheet'''
(Note: if an item is "quoted", it is meant literally, otherwise the reader is supposed to substitute their own information for words in <angle brackets>)

When a new service appears that lets you register a name, here are some you may want to try and get first:

* Straightforward
** <Your usual username, if any>
** <Your given name>
** <Your full name>
** <Initial><Surname>
** <Surname> (Bold & Slightly Unconventional)

* Recognizable
** "Google"
** "iPhone"
** "Facebook"
** "BitCoin"
** "Obama"
** "Canada"
** "NFL"
** "Garfield"
** <Your city>
** "NASA"
** <Name of person who runs the service>

* Causing Trouble
** "User"
** "Username"
** "Name"
** "You"
** "Guest"
** "Account"

* Causing More Trouble
** "Admin"
** "Administrator"
** "System"
** <Name of service>
** "Help"
** "Error"

* Impossible to Say
** "Hyphen-Emdash"
** "Dash-8hyphen-8"
** "Zero0ne2numeral2"
** "KrisasinHemsworth"
** "TheWord&Ampersand"
** "ZettaWith3Teees" 

* Misc
** <Single Letters>
** <Single Numbers>
** <Common Words>
** <SQL/JS Injection>
** "ASDF"
** "QWERTY"
** "Yes"
** "Bot"
** "Computer"
** "Blocked"
** "Deleted"
** "Jeeves"
** "Narrator"
** "Internet"
** "NPC"
** "Password"

* Permissive Character Sets
** <Space>
** <NBSP>
** <RTL override>
** <Any emoji>
** "<nowiki>&NBSP</nowiki>;"
** "<nowiki></HTML></nowiki>"
** "&LT;/HTML&GT;"
** one or more of the following symbols: <nowiki>@ é | “ ” \ . # " ‘ – - _ / ’ ' `</nowiki>
** "," (including quote marks)
** "OkThisIsKindOfConfusingButIt's<LessThan\ForwardSlashHTMLGreaterThanActualGreaterThanSymbol>Yes,ThatWasAllPartOfTheName,ButSoIs...Ok,LetMeStartOver”"

{{comic discussion}}
[[Category:iOS]]

2292: Thermometer

2022-05-04T19:51:42Z

PaintspotInfez: Undo revision 240653 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 2292
| date = April 10, 2020
| title = Thermometer
| image = thermometer.png
| titletext = I hate how many times you have to press it to get to the system normal people use, degrees Rømer.
}}

==Explanation==
This comic is arguably the 17th comic in a row (not counting the [[2288: Collector's Edition|April Fools' comic]]) in a [[:Category:COVID-19|series of comics]] related to the {{w|COVID-19 pandemic}}.

This comic expresses frustration at the multitude of {{w|temperature}} scales. [[Randall]], as a former engineer, has strong opinions about units, as unit conversion is often a gripe for many engineers. (In a special preface in the UK edition of Randall's book ''What If'', he mentions that one does not appreciate the metric system unless they have had to go through a bunch of scientific papers using really unusual units like "kilocubic feet per second" or "acre-feet".) As elevated body temperature is a symptom of COVID-19, the comic is thus also concerning the virus.

[[Cueball]] is holding what appears to be a medical thermometer, implying that he's trying to check his {{w|Human body temperature|body temperature}}. He mentions that the thermometer is in Celsius, and asks how to change it. Many thermometers sold in the United States have settings for both Fahrenheit and Celsius, with an option to change between the two. Americans are almost always more familiar with body temperatures in Fahrenheit, so Cueball presumably expects to change to that scale. However, he finds that the thermometer provides measurements in a series of scales that are increasingly unhelpful. Human body temperature in Celsius is 37 °C.

*Degrees {{w|Celsius}} are used in most of the world. The Celsius scale sets 0 degrees to water's freezing point and 100 degrees to water's boiling point. Few Americans have a clear idea of what normal and elevated ranges of human body temperature are in Celsius.
*{{w|Kelvin}} is a unit often used in scientific fields. It is calibrated on the same scale as degrees Celsius, but 0 K is set at {{w|absolute zero}} or -273.15 °C. This is used in scientific or engineering contexts requiring a thermodynamically absolute temperature, such as {{w|Charles's law}}, but almost never in a medical context, making the report of little use.
*The {{w|Rankine scale}} is another absolute scale, with its zero set at absolute zero, but degrees identical to degrees Fahrenheit. While this scale is still occasionally used in some industrial and scientific settings (being more convenient for absolute temperatures in a system including Fahrenheit), it's essentially never used in medicine, and most people have never heard of it.
*Thermodynamically, temperature is the average translational {{w|kinetic energy}} of a group of particles. ''Translational'' kinetic energy means it doesn’t include rotational and vibrational kinetic energy. The relation between a gas’s translational kinetic energy E and its temperature T is
::<math>E=\frac32 k_B T,</math>
:where kB is the {{w|Boltzmann constant}}, 1.380649×10−23 J⋅K-1. So if this thermometer told you a translational kinetic energy measurement in joules, you could get the measured temperature in the Kelvin scale by dividing by the Boltzmann constant and multiplying by 2/3. Somebody who actually wanted to use this measure of temperature might then find it useful to have Boltzmann's constant printed on the thermometer.

Using these last three units for home temperature gauging would be ridiculous, as Kelvin and Rankine measurements of body temperature are unfamiliar to the average user and even those familiar with them would need to do calculations to translate normal body temperature. Kinetic energy is obscure enough that only physicists, engineers and thermodynamicists, a relative handful of the potential buyers, would likely know what it refers to. Those that do could make use of the value printed on the thermometer, but such would add a great deal of unnecessary complexity to what should be a simple and intuitive task.

In the last frame Cueball calls the thermometer the worst. It seems to lack {{w|Fahrenheit}} entirely, frustrating its American consumer base, including Cueball. From a nerd's perspective this would be an extraordinary device, offering even exotic temperature scales. However, a "normal person" would find this thermometer terribly difficult to use for everyday purposes when set on any of the non-Celsius scales, like checking their body temperature or the temperature of food. As an item of consumer electronics, especially one sold in the United States, it would be almost completely useless.

Deliberately lacking Fahrenheit is a jab against the {{w|Imperial system of units}}, and against the similar but distinct system of {{w|United States customary units}}. Although Imperial units and local traditional units are still used for various limited purposes (and/or by older generations) in different countries, most of the world has switched to using the metric system for most purposes going forward, with the US being relatively unusual in the extent to which it still routinely defaults to the US customary units in daily life. Many proponents of the metric system have long pushed for the US to change over, arguing that Imperial and US customary units (and degrees Fahrenheit, specifically) are archaic and obsolete. [[Randall]] has dealt with this conflict in [[1643|other strips]]; as a physics major, he's partial to the metric system, and finds it frustrating to maintain multiple different scales (which is the basis of the conflict in this strip). On the other hand, he recognizes certain intuitive advantages to Imperial and US customary measurements, and recognizes that the forces of social inertia in US society make change difficult.

The title text references an archaic temperature unit, {{w|Rømer scale|Rømer}}, first proposed in 1701, and is the common ancestor of both the Celsius and Fahrenheit scales. Unlike the other measurements mentioned in this strip, the Rømer scale is no longer used in any context, and only people interested in the history of temperature scales have any idea that it even exists. This is the ultimate form of obscure and outdated temperature measurements.

==Transcript==
:[Cueball stands in the center of the panel holding a thermometer.]
:Cueball: This thermometer is in Celsius. How do you change it?
:Off-panel voice: Long press the button.

:[Cueball presses the button, and the thermometer beeps]
:''Press''
:''Beep''
:Thermometer: Units: Kelvin
:Cueball: No...

:[Cueball presses the button, and the thermometer beeps]
:''Press''
:''Beep''
:Thermometer: Units: Degrees Rankine
:Cueball: What.

:[Cueball presses the button, and the thermometer beeps]
:''Press''
:''Beep''
:Thermometer: Units: Average Translational Kinetic Energy
:Cueball: This is the worst thermometer.
:Off-panel voice: Boltzmann's constant is on the side if you need it.

==Trivia==

In [[1643: Degrees]], Cueball struggles with which temperature unit to use, and ultimately tells his friend the temperature in {{w|radian}}s, which is not a valid temperature scale.

In [[1923: Felsius]], Randall proposes a combined Fahrenheit/Celsius temperature scale called Felsius.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:COVID-19]]
[[Category:Science]]
[[Category:Physics]]

2082: Mercator Projection

2022-05-04T19:51:33Z

PaintspotInfez: Undo revision 240648 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 2082
| date = December 7, 2018
| title = Mercator Projection
| image = mercator_projection.png
| titletext = The other great lakes are just water on the far side of Canada Island. If you drive north from the Pacific northwest you actually cross directly into Alaska, although a few officials--confused by the Mercator distortion--have put up border signs.
}}

==Explanation==
The {{w|Mercator projection}} is a {{w|map projection}} (a way to present the spherical Earth surface into a flat 2-D map) presented by Flemish cartographer Gerardus Mercator in 1569. It was the standard map projection for some time, because it does preserve all angles in their true shape (i.e. it is a {{w|conformal map projection}}). This means that if you measure an angle on the map you get the right direction in the real world - a very useful feature if you're using the map for navigating. However, preserving the angle leads to severe distortions of the surface area, especially in the higher latitudes where countries appear much larger than they actually are. For example on the Mercator Projection, Greenland (the largest non-continent island in the world) is shown to be much larger than Australia (the smallest continent), although the latter in reality is nearly 4 times as big. Other examples of regions having distorted sizes and shapes due to the Mercator Projection can be explored in [https://thetruesize.com this link].

[[Cueball]] uses [[White Hat|White Hat's]] mistrust of the Mercator projection to convince him of ridiculous facts about Canada, namely that it is simply a small island in {{w|Lake Ontario}}. Map projections are generally {{w|continuous function}}s, meaning that they never map a {{w|disconnected space}} onto a connected one and therefore can never give the false impression that two areas that don't border each other do.

The title text continues on these falsehoods, claiming that the {{w|Great Lakes}} are simply "water on the far side of Canada Island", and that it is possible to drive directly into Alaska from the Pacific Northwest region of the US (it's not, Canada is in the way). Cueball can possibly make these statements as Canada is a country in the northern regions, where the Mercator Projection would show it larger than it actually is. However, Canada is the second largest country in the world by total area (land and water), after Russia.

The Mercator Projection was previously mentioned in [[977: Map Projections]] of "what your favorite map projection says about you". People who preferred the Mercator Projection was listed as "You're not really into maps." It is also the second comic in a row that relates somehow to latitudes. [[:Category:Bad Map Projections|Bad Map Projections]] is a series in xkcd, showing that it is really something on [[Randall|Randall's]] mind.

It is not the first time Cueball (or Randall) tries to spread misinformation, for instance it also has White Hat as the target in [[1677: Contrails]], but it can also be other people that are fooled like in [[1405: Meteor]].

==Transcript==
:[Cueball is holding a hand up as he talks to White Hat.]
:Cueball: Did you know Canada is actually a smallish island in Lake Ontario?
:White Hat: What?
:Cueball: Yeah, it only appears to have a land border with the U.S. due to the Mercator Projection.
:White Hat: Wow! I had no idea.

:[Caption below the frame:]
:At this point people feel so misled by the Mercator Projection that you can use it to convince them of basically any map fact.

{{comic discussion}}

[[Category:Maps]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring White Hat]]

1678: Recent Searches

2022-05-04T19:51:20Z

PaintspotInfez: Undo revision 240635 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 1678
| date = May 9, 2016
| title = Recent Searches
| image = recent_searches.png
| titletext = autoexec code posted by verified twitter users
}}

==Explanation==
People often find answers to computer problems by searching on {{w|Google}}, which attempts to guess your intended search term based on your location, language and the characters you've already typed, placing its suggestions in a drop-down box beneath the input area. If the search box is clicked on but nothing is typed, the drop-down box by default shows a list of your most recent searches.

Here we see a list of search queries, each of which suggests the author is perversely misusing or overextending some computer technology. The overall impression is of someone technically sophisticated enough to shoot themselves in the foot, and who does not learn any larger lessons despite doing so repeatedly. The title text is another possible entry in this list.

The caption implies that from Randall's perspective, every computer he uses seems to be broken; he doesn't seem to realise this is because he's the one using them, not because the computers actually start off broken. (For similar themes see also these comics: [[349: Success]], [[1084: Server Problem]], [[1316: Inexplicable]] and [[1586: Keyboard Problems]]).

([[979|Dear people from the future]], if Google directed you here because it is the most popular result for a problem you are experiencing, this is not the page you were looking for).

===List of searches===
; [https://www.google.com/search?q=Google+translate+syntax+highlighting Google translate syntax highlighting]
: {{w|Syntax highlighting}} can be used when editing {{w|source code}} to make the code more readable and easier to understand. It is not generally used for natural languages, but {{w|sentence diagram}}s of brief passages are used in language education. {{w|Google Translate}} is used to translate text from one {{w|natural language}} to another. It uses {{w|JavaScript}} <tt>mouseover()</tt> to highlight words as an aid in matching phrases in the source with their translations, but does not apply different highlighting dependent on syntax.
:Alternatively, this could imply that Randall is attempting to translate code from one programming language to another using Google Translate. Success would be unlikely, since the service is not intended for this {{Citation needed}}, and syntactically valid output might further break the computer executing it.
:Two other possible interpretations of this phrase are that Randall wants to translate the phrase "syntax highlighting" to another language, or that he wants to perform syntax highlighting on the source code for Google Translate.
; Autodetect mixed bash zsh
: {{w|Bash (Unix shell)|Bash}} and {{w|Z_shell|Zsh}} are two {{w|Command-line_interface|command line interfaces}} for {{w|Unix-like}} OSes. The way to execute commands is almost identical, making detecting a script that contains a mixed syntax nearly impossible. This was later referenced in [[2510: Modern Tools]].
; CPU temperature sensor limits
: The CPU's temperature sensors exist to tell you when your CPU is becoming dangerously overheated (normally because of a faulty fan or overclocking). Someone who searches for information about the limits of those sensors is presumably expecting to misuse their CPU. Probably also a reference to [[1172: Workflow]].
; GIF to XLS
: .GIF (Graphic Interchange Format) is a file extension used to store images and sequences of images to be displayed as an animation. .XLS is the file extension for Microsoft Excel spreadsheets. The joke is that the two file types are used for different purposes - it's quite normal for someone to want to convert between .GIF, .JPG, .PNG, .BMP files, as these are all image files; or between .XLS, .CSV, and .ODS files, as these all record tabulated information. However, for some reason Randall wants to convert an image file to a spreadsheet. (This is actually possible, because a digital image is essentially an array of colour and brightness values; it just wouldn't be particularly useful for most people. [http://www.think-maths.co.uk/spreadsheet Here] is a webpage with an online converter.) Matt Parker has done a [https://www.youtube.com/watch?v=UBX2QQHlQ_I stand up routine] about converting these two file types.
:An alternate way to convert an image file, such as a .GIF file, into a text-based file like an .XLS file, is through {{w|optical character recognition}} (OCR). This is only effective if the image is a copy (i.e. a scan or reasonably clear photograph) of a document containing letters and words, and neither .GIF nor .XLS are file formats anyone would usually use in that case.
; Clock speed jumper sample rate
: A jumper is an intentional short circuit used for selecting options for an electronic circuit. They are usually used where it is not feasible to use programming (such as outputting a byte or word through a port) to alter the selection, such as before the processor even begins executing. A common example would be, on some motherboards, jumpers can be used to alter the clock speeds of various motherboard functions (such as the CPU or the front side bus). These jumpers should ordinarily be modified when the computer is off. However, this search is asking how often the motherboard checks the status of the clock speed jumpers, implying that they intend to change these jumpers while the computer is powered on, and often enough that the sample rate matters (change cpu speed several times a second, by moving jumpers on the motherboard.). That is, of course, a little silly.
; [https://www.google.com/search?q=clean+reinstall+keybinding Clean reinstall keybinding]
: This refers to keybinding, the practice of mapping (binding) a certain key to a certain function (e.g., pressing PRTSC will take a screenshot). Most keyboards do not output characters directly, but only codes for which keys have been pressed (or released). Keybindings translate the pressing of the "A" key on your keyboard into the letter "A" being sent to a program which is reading keyboard input. A "clean reinstall" of keybindings is something that would almost never be necessary - it means Randall has modified his default keybindings to such an extent that his [[1031:_s/keyboard/leopard/|leopard]] has become unusable (similar to [[1284: Improved Keyboard]]), necessitating a "clean reinstall" of the bindings. Alternatively, he might be doing clean reinstalls so often that he wants a keybinding to execute them with minimal loss of time.
; Cron job to update crontab
: {{w|Cron}} is a utility on most Unix-like OSes that allows you to schedule commands or scripts to be run periodically. These scheduled jobs are read from a ''crontab'' file. A job that updates the crontab (therefore creating new jobs, removing old ones or editing existing ones) is paramount to a {{w|job scheduler}}, and trying to use cron for such functionality could result in highly unstable functionality (although a crontab could be sensibly regenerated periodically by a set of machines from a master crontab file annotated with per-host directives). This is similar to {{w|self-modifying code}}.
; [https://www.google.com/search?q=fsck+chrome+extension fsck Chrome extension]
: This is a search for an interface to the Unix '''f'''ile'''s'''ystem che'''ck'''er {{w|fsck}} via third-party software added to Chrome. fsck is a program for checking your filesystem for corruption. Repairing a filesystem this way would be inadvisable. {{Citation needed}} This might indicate confusion about the meaning of the term "online filesystem repair", in which "online" means "while the filesystem is in use" rather than "over the Internet". Alternatively, Randall might want to repair an installation of the operating system Chromium, in a manner less drastic than the {{w|factory reset}} preferred by Google.
; Recursive font
: An idiosyncratic mix of {{w|recursion}} and the font style ''{{w|cursive}}'', referring especially to text handwritten in a flowing manner. {{w|PostScript}} (the language in which {{w|PostScript fonts|some fonts}} are written) is capable of recursion and PostScript Type 3 fonts are able to use the full language. This could create effects like fonts with complicated fractal borders and fill patterns - but the increase in processing time would contribute to seeming brokenness of the computer (or printer) rendering the font.
:A true recursive font would be a form of {{w|fractal}}s ([http://blog.matthen.com/post/5340546486/first-sketches-in-mathematica-for-a-new-font-it example]).
; Regex matching valid EBNF
: EBNF refers to {{w|Extended Backus–Naur Form}}, which is used to define {{w|formal language}}s. EBNF specifies recursive patterns that are impossible for a {{w|Regular_Expression|regular expression}} (regex) to determine whether it is valid or not. There is some irony in using regex to test the validity of something which ''defines'' the validity of things like regex.
; [https://www.google.com/search?q=Hardlinks+Turing+complete Hardlinks Turing complete]
: In some file systems, for example {{w|ext4}} and {{w|NTFS}}, a single file may be referenced in multiple places in the file system. These filenames are termed "hard links" because the operating system automatically resolves them to the actual file. "Soft" or "symbolic" links are resolved indirectly via a pathname, which may reside anywhere. A file is considered deleted when the last hard link to it is unlinked; a soft link exists independently of its target. In fact, the target need not exist, in which case this is often called a dangling symbolic link.
:{{w|Turing completeness}} is the {{w|computational complexity}} required to simulate any {{w|computable function}} (given an infinite amount of memory). Recently there have been cases where [http://beza1e1.tuxen.de/articles/accidentally_turing_complete.html unexpected mechanisms] from card games to text parsers were proved to be Turing complete. Hardlinks being Turing complete would imply that creating and deleting hardlinks alone is enough to satisfy the requirements of Turing completeness.
; Opposite of safe mode
: {{w|Safe mode}} is a diagnostic mode in many operating systems and applications which allows the user to troubleshoot problems by disabling unnecessary functionality. The "opposite of safe mode" implies a "dangerous mode" where the purpose is to allow uselessly dangerous actions (in actuality this supposed dangerous mode is the default mode). A common example is the {{w|sudo}} command in Unix-like OSes, which grants the user system-level permissions.
:It's also possible that Randall sees Safe Mode so often that he sees regular mode as an unusual and unique state and needs help navigating back to it.
; Predictive touchpad
: {{w|Predictive text}} is a feature of many smartphone keyboards that predicts the most likely word the user wishes to type, and then gives the user the option to place the full word in the sentence immediately without having to finish typing it. A {{w|touchpad}} is a computer pointing device, similar to a {{w|computer mouse}}. The idea of a "predictive touchpad" seems absurd because, as opposed to typed words, there are not a limited number of swipe combinations that are possible on a touchpad. A "predictive touchpad" implies that a computer could predict where the user was going to move the mouse or click, which in this case would seem to defeat the purpose of a user input device. {{Citation needed}}.
:Interestingly, a version of Linux had a predictive cursor option, where the cursor jumped to the nearest button (like window close) when it moved near to but didn't quite reach that button.
; Google docs from bootloader
: A {{w|bootloader}} is a very small program that is usually the very first thing to execute when a computer boots up. It is used mainly for loading the operating system into memory. Such a program by itself would not be capable of directly running something as complex as {{w|Google Docs}}.
; Hardware acceleration red channel only
: {{w|Hardware acceleration}} means that certain calculations are not performed by the computer's {{w|CPU}} but by a "specialized" processor, e.g. a {{w|GPU}} which is part of the graphics adapter. This speeds up output, especially if complex 3D calculations are required, and reduces CPU load. To use this function only on a single color channel seems pretty useless, but one may want to troubleshoot a program that displays only red when hardware acceleration is enabled.
:While graphics cards are most commonly used with three or four channels (red, green, blue, and sometimes alpha), they do support two-channel or single-channel images. An 8-bit single-channel image would use the format '[https://www.opengl.org/wiki/Image_Load_Store#Format_qualifiers R8]', which is indeed 'red channel only'. This type of image could be used to store monochrome images or non-image data.
; autoexec code posted by verified twitter users. ('''Title text''')
: The term "autoexec" refers to code that runs automatically, usually during boot, and derives from one of three boot-time files for {{w|MS-DOS}}: AUTOEXEC.BAT, CONFIG.SYS and COMMAND.COM. AUTOEXEC.BAT would typically contain commands for customizing the command prompt, loading additional drivers, and/or automatically launching a program.
:Automatically executing code from the Internet is generally a terrible idea, because it could be written by someone with malicious intent and harm your computer. The joke here is that the code would only be executed if written by someone who has been "verified" on Twitter. Twitter's verification service only serves to show that a user is who they claim to be, not whether or not their code can be trusted, so this would provide little protection. Usually, Twitter verification is used by celebrities so they can be distinguished from people claiming to be them. The line implies that Randall is only interested in running code posted by celebrities.
:Most code downloaded from authentic sources (such as Microsoft and official Linux distributions) is verified by a cryptographic signature from a true trusted source, authenticating the origin of the software. These may include software updates that run automatically in the background. The joke here is that the term "verified" means very different things between Twitter users and software distribution.

==Transcript==
:[Coloured and styled as the real logo:]
:GOOGLE

:[Google Search bar, with a drop down box with faded text, implying recent searches.]
:Google translate syntax highlighting
:Autodetect mixed bash zsh
:CPU temperature sensor limits
:GIF to XLS
:Clock speed jumper sample rate
:Clean reinstall keybinding
:Cron job to update crontab
:fsck Chrome extension
:Recursive font
:Regex matching valid EBNF
:Hardlinks Turing complete
:Opposite of safe mode
:Predictive touchpad
:Google docs from bootloader
:Hardware acceleration red channel only

:[Caption below the frame:]
:'''I have no idea why my computers are always broken.'''

{{comic discussion}}
[[Category:Comics with color]]
[[Category:Google Search]]

559: No Pun Intended

2022-05-04T19:51:11Z

PaintspotInfez: Undo revision 240622 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 559
| date = March 23, 2009
| title = No Pun Intended
| image = no_pun_intended.png
| titletext = Like spelling 'dammit' correctly -- with two m's -- it's a troll that works best on the most literate.
}}

==Explanation==
"No pun intended" is an idiom meaning that something just said wasn't meant to be a {{w|pun}}, implying that the preceding statement could be interpreted as one. As done in the comic, following a non-pun with "no pun intended", although factually accurate, breaks this implication and confuses listeners who will be trying to work out which part of the sentence could have been interpreted as a pun.

In this comic, which is part of the [[:Category:My Hobby|My Hobby]] series, [[Cueball]] uses this tactic to confuse [[Beret Guy]], who spends the next three hours trying to understand what pun there could have been in Cueball's sentence: ''I think he's internalized his girlfriend's attitudes''. The guy Cueball talks about seems to have taken over ({{w|Internalization|internalized}}) all his girlfriends attitudes, values, standards and opinions, putting these instead of those he has from his own identity or sense of self. This is probably sad, but there is no pun in the sentence.

Beret Guy, however, has been fooled by the addition of ''no pun intended'' and tries to overanalyze the sentence - did Cueball mean ''Lied'' when saying ''Interna'''li'''z'''ed''''' or was it ''Analyzed'' or even ''Attitudes'' he meant; could that be the pun? Since there was no pun, he will never find a solution. This was Cueball's plan all along.

It seems like Beret Guy, after three hours, finally gives up when he says ''Dammit''. This then leads to the title text joke.

Unfortunately for the hobbyist, blank puns default to sexual innuendos, the most notorious example being [http://knowyourmeme.com/memes/if-you-know-what-i-mean "If You Know What I Mean."]

The title text elicits a similar confused reaction, as the most literate people will be more likely to want to spell out "[https://en.wiktionary.org/wiki/damn_it damn it]" rather than using the also correct abbreviated form with morphed spelling, [https://en.wiktionary.org/wiki/dammit dammit], which is referred to as ''with two m's'' because many people ([http://english.stackexchange.com/questions/79282/dammit-vs-damnit mainly in the US] it seems) contract damn it to [https://en.wiktionary.org/wiki/damnit damnit], which is the "wrong way".

==Transcript==
:[Caption above the panel:]
:'''My Hobby:'''
:Appending "no pun intended"
:to lines with no pun in them.

:[Cueball is talking to Beret Guy.]
:Cueball: I think he's internalized his girlfriend's attitudes - no pun intended - and so...

:[The next panel is inlaid partly over the first panel. Beret Guy is thinking. Above his thought bubble is a caption:]
:Three hours later:
:Beret Guy (thinking): "Internalized?" Lied? Analyzed? Or is it "attitudes"? ''Dammit.''

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Beret Guy]]
[[Category:My Hobby]]
[[Category:Language]]
[[Category:Puns]]

2308: Mount St. Helens

2022-05-04T19:50:53Z

PaintspotInfez: Undo revision 240617 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 2308
| date = May 18, 2020
| title = Mount St. Helens
| image = mount_st_helens.png
| titletext = It's a good mountain but it really peaked in the 80s.
}}

==Explanation==
This comic marks the 40 year anniversary of the {{w|1980 eruption of Mount St. Helens|May 18, 1980 eruption of Mount St. Helens}} that killed 57 people. It was a Monday so a normal release day could be used to mark this event.

It shows a graph of the height of the mountains in the {{w|Washington (state)|state of Washington}} as a function of time over the last 100 years. The only mountain to change its height significantly over this time period is {{w|Mount St. Helens}}, which the comic is named after. It is also the only black line as all other (30?) lines are gray.

Mount St. Helens is a {{w|volcano}} that famously and explosively erupted in 1980. Millions of tons of earth were blasted from one face of the mountain all over the surrounding countryside. After it was over, the peak of Mount St. Helens was no longer the 5th highest in the {{w|Washington (state)|state of Washington}}, having lost approximately 1,300 feet (400 m) in height (from 9,677 ft (2,950 m) pre-explosion to 8,363 ft (2,549 m) post-explosion).

The comic shows a rare event that had major effect and was predictable in hindsight, but would have surprised an observer that is just tracking the height of Mt. St. Helens in a non-representative timeframe. Such an event is called a {{w|Michele_Wucker|Gray Rhino}} event.

Currently, the 5 highest {{w|List of mountain peaks of Washington (state)|mountain peaks in Washington State}} are {{w|Mount Rainier}} (at 14,411 ft or 4,392 m), {{w|Mount Adams (Washington)|Mount Adams}}, {{w|Mount Baker}}, {{w|Glacier Peak}}, and {{w|Bonanza Peak (Washington)|Bonanza Peak}}. As shown in the comic, Mount St. Helens was the 5th highest, but now has fallen to #35 (using a {{w|topographic prominence}} cut-off of 500 m (1640 feet)). Only mountains above 8,000 feet (2,438 m) are included, with the graph topping at 15,000 feet (4,572 m), 600 feet (182 m) above the highest mountain. There are 92 peaks above 8000 feet in the state, so not all are included and the lines are not really distinct below 9000 feet. Seems like there are less than 30 lines drawn. Of course it says Mountains not Mountain peaks, but there are only four mountain ranges in Washington with peaks above 8000, so he must mean peaks!

Technically, the other mountains may be fluctuating in height as well, due to erosion or the movement of Earth's tectonic plates, but this phenomenon should not be visible on the time-scale and vertical resolution that Randall has plotted.  Precision GPS measurements of various peaks in Washington have only been available since 2010, and it's likely that the primarily volcanic mountains of Washington experience significant but comparatively slight variations throughout the year due to snowfall, melt, or the pressure of swelling magma inside volcanic cores. These changes go largely unmeasured, while the mountains continue to appear equally physically unchanging and imposing both in person and from a distance.
Source: [https://www.seattletimes.com/seattle-news/how-tall-is-rainier-really/ Seattle Times]. So while the comic does appear to show some slight fluctuations in height for mountains, that is more likely a side-effect of the comic's free-hand drawing style than an accurate reflection of any real fluctuations.

The title text is a play on the term "peak" meaning both the highest point of a mountain and also the optimal, most famous or most impressive stage of a trend; for instance: "The band Rolling Stones really peaked in the 80s."

==Transcript==
:[Caption above graph:]
:Heights of mountains in Washington State
:Over time

:[A graph is shown with close to 30 horizontal gray lines which seem not to change much, if any, as they go from left to right. Only the top 6 gray lines are distinctly separated from others. The top line is way above the second line which again is far above the next two that are close together. Two more close together is somewhat further down, and just below them the rest of the lines follow in close proximity down to the bottom of the graph. A single black line is also shown. It begins as the fifth highest line, just above the two last mentioned above. It, like all other lines, goes horizontally, but only three fifths of the way across the graph – then it immediately drops down well below most of the other lines (at 1980) and levels off, continuing on its horizontal path. There is a caption above the graph, and both Y-axis and X-axis has labels. For the Y-axis there is a tick for every label, for the X-axis only every 2nd tick has a label. A unit is given on the top label on the Y-axis.]

:[X-axis:]
:1920 1940 1960 1980 2000 2020

:[Y-axis:]
:15,000
::feet
:14,000
:13,000
:12,000
:11,000
:10,000
:9,000
:8,000

{{comic discussion}}

[[Category:Line graphs]]
[[Category:Timelines]]
[[Category:Geology]]
[[Category:Volcanoes]]

2331: Hamster Ball 2

2022-05-04T19:50:40Z

PaintspotInfez: Undo revision 240633 by Ex Kay Cee Dee (talk) Reverted vandalism.

{{comic
| number = 2331
| date = July 10, 2020
| title = Hamster Ball 2
| image = hamster_ball_2.png
| titletext = The worst is being teased by responsible, mask-wearing teens. They even spritz the hamster ball with disinfectant before rolling it, carefully avoiding the filter vents.
}}

==Explanation==
This comic is another in a [[:Category:COVID-19|series of comics]] related to the {{w|COVID-19 pandemic}}.

A {{w|hamster ball}} is a small, transparent sphere in which a hamster or other pet rodent can run around (reasonably) safely, without being in its cage. Cueball had [[152: Hamster Ball|previously]] [[211: Hamster Ball Heist|obtained]] a "{{w|zorbing|human-sized hamster ball}}" for himself.

Cueball relates that, once upon a time, he was teased for this seemingly-frivolous pursuit, but he feels that now, in the midst of a worldwide [[:Category:COVID-19|coronavirus pandemic]], having his own bubble to be inside is a smart move. He is contrasted to White Hat, who is wearing a {{w|Surgical mask|facemask}} for protection.

"Who's laughing now" is a common phrase that you know better than others who originally laughed at you, or that the "tides have turned" and you have a control over the situation. However, as White Hat notes, the same people who laughed at Cueball before are still laughing at him, for the same reasons as before: even though his hamster ball has some practical utility now (enforcing social distancing), it still looks ridiculous and is lots of fun to roll around.

In the title text, Cueball says that he feels worst about being teased by "responsible, mask-wearing" teens, who treat the outside of his hamster ball as a potentially-contaminated surface (which it is, if it has previously been rolled around by ''ir''responsible teens who might have contracted and spread the coronavirus) and disinfect it, taking care to avoid spraying the vents and thus not exposing Cueball's lungs to a hazardous chemical, before rolling him around. It's not clear why he doesn't like being rolled around by responsible teens; it could be that he vindictively wishes that they ''would'' catch the coronavirus from the outside of his hamster ball, thus proving that he was correct to use it, or it could be that his ego is injured by the fact that even responsible and otherwise well-mannered and socially-conscious teenagers (who are not likely to be particularly harmed themselves by COVID-19, but conscientiously follow guidance to reduce transmission and protect those who are at-risk) find his hamster ball so ridiculous that they have to have fun at his expense.

As the title indicates, this is the second comic specifically devoted to hamster balls; the first was [[152: Hamster Ball]], in which Cueball wished for a genie to give him a human-sized hamster ball (and then had no other wishes he wished to wish). A human hamster ball also features prominently in [[211: Hamster Ball Heist]].

==Transcript==
: [Cueball is inside a transparent human-sized sphere, evidently "rolling" forward. Ahead of him is White Hat, wearing a mask.]
: Cueball: They laughed at me, all those years ago, when I got this human-sized hamster ball.

: [Frameless panel with just Cueball rolling forward, with his hand in a fist.]
: Cueball: But who's laughing now?!?

: [Cueball and White Hat have stopped. White Hat is pointing into the distance.]
: White Hat: Sounds like the same people.
: White Hat: See? There's some of them over there.

: [Cueball turns around to roll backwards while White Hat stands next to him still.]
: Cueball: Yeah, neighborhood kids.
: Cueball: At least they've stopped trying to roll me into soccer goals.
: Cueball: No, here they come.
: Cueball: Run!

{{comic discussion}}
[[Category:COVID-19]]
[[Category:Comics sharing name|Hamster Ball 2]]
[[Category:Hamster Ball]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring White Hat]]
[[Category:Comics featuring face masks]]