explain xkcd - User contributions [en]

2298: Coronavirus Genome

2020-04-25T07:34:05Z

Ribbit: /* Explanation */

{{comic
| number = 2298
| date = April 24, 2020
| title = Coronavirus Genome
| image = coronavirus_genome.png
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.
}}

==Explanation==
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abreveated as G, A, C, T, and U).

[[Cueball]] is surprised that she and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this "{{w|epigenetics}}". In the real world, epigenetics is the study of changes that are not caused by direct changes to the genome itself, but in patterns of gene expression and activation. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or placed in bold and made large to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.

Is this a pun on "gene editing" as with CRISPER Cas9 ?

The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which far exceeds the {{w|longest words}} of any natural language and may exceed the capabilities of any available spell-checking program.

The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking could identify (space-delimited) lengths of genetic code that have never been seen before, but grammar checking could be used to identify whether known sequences of bases make no sense as a larger sequence (a gene, or even a whole organism), which is potentially a very big question among geneticists.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]
:Cueball (off-screen): So that's the coronavirus genome, huh?
:Megan: It is!
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA

:[Cueball walks up and stands behind Megan, still working on the laptop.]
:Cueball: It's weird that you can just look at it in a text editor.
:Megan: It's essential!
:Megan: We geneticists do most of our work in Notepad.

:[A frameless panel, Cueball still standing behind Megan.]
:Cueball: Notepad?
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.
:Cueball: Ah, okay.
:Megan: That extra formatting is called "epigenetics".

:[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.]
:Cueball: Hey, why does that one have a red underline?
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.
:Cueball: ''Clever!''

{{comic discussion}}
[[Category: Comics featuring Cueball]]
[[Category: Comics featuring Megan]]
[[Category: Biology]]
[[Category:COVID-19]]

1871: Bun Alert

2017-08-03T07:50:32Z

Ribbit: Does "bun" = "small loaf of bread" mean this comic is a (bad) pun?

{{comic
| number = 1871
| date = August 2, 2017
| title = Bun Alert
| image = bun_alert.png
| titletext = Since buns range from crepuscular to nocturnal, it's recommended that you enable the scheduled "Do Not Disturb" mode on your phone to avoid being woken by alerts about Night Buns.
}}

==Explanation==
{{incomplete|Still needs work.}}
The comic opens with [[Beret Guy]] identifying a "bun", the name given to a rabbit in [[1682: Bun]]. As in that comic, the bun's size is said to be inversely correlated with its status; smaller buns such as the one in this comic are thought of as higher-ranking "king buns" by the characters in both strips. In real life, smaller rabbits are more likely to simply be children.

Upon seeing the bun, Beret Guy uses his phone to send an alert about the bun as a [[wikipedia:Push technology|push notification]]. His alert system was probably developed by his recurrent company, as he refers to the people who built it as "we". He is still looking for investors since it seems that few sane people would be willing to invest in such a feature. Upon [[Ponytail]]'s questioning, he explains why he created the alert system using a rather [[703|tautological]] line of reasoning. His comment that buns are "like loaves of bread that hop" refers first to the species' physical appearance, and then to a method of locomotion commonly associated with rabbits.

Just as Ponytail is leaving, [[Megan]] hurriedly approaches, excited to see the bun. This serves as a punchline as despite Ponytail appearing to be the voice of reason, it seems that Beret Guy's inane bun alert system has gathered a dedicated following after all.

Is there a pun here? "bun" = "small loaf of bread".

==Trivia==
*In [[1682: Bun]], it was Ponytail who was infatuated with "buns", while Megan was the incredulous one questioning the situation. In this comic, the roles are reversed. This is a strong indication that the characters represented by Ponytail and Megan in this comic are not the same characters from 1682.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[Beret Guy and Ponytail see a rabbit sitting in the grass; Beret Guy points to the bun.]
:Beret Guy: Bun alert!
:Ponytail: Oh, yeah! Cute!
:Beret Guy: Gotta document this. I'll notify everyone, send out a push alert.
:Ponytail: ...to who?

:[Zoom in on Beret Guy and Ponytail; Beret Guy taps on his phone.]
:Beret Guy: Everyone subscribed to the alert system.
:Ponytail: Alert system?
:Beret Guy: Yeah! We built it over the last few years. It's pretty small. Still looking for investors.
:Ponytail: But...''why'' are you alerting people about rabbits?

:[Zoom out; Beret Guy points at the bun.]
:Beret Guy: I mean...look at them. They're like loaves of bread that hop.
:Ponytail: I see.
:Beret Guy: ''People need to know.''

:[Zoom on Beret Guy in a frameless panel.]
:Beret Guy: They need to know:
:Beret Guy: '''''There are buns.'''''

:[Ponytail walks off, Megan comes running towards Beret Guy with a phone in her hand.]
:Ponytail: Okay, uhh, I'm gonna go.
:Megan: ''I got the alert!'' Where's the bun? '''''Is it small?'''''
:Beret Guy: ''Extremely.''
:Megan: Oh my God.

{{comic discussion}}

[[Category:Comics from 2017]]
[[Category:Comics from July]]
[[Category:Wednesday comics]]
[[Category:Comics featuring Beret Guy]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Megan]]
[[Category:Animals]]
[[Category:Beret Guy's Business]]

Talk:1531: The BDLPSWDKS Effect

2015-05-29T08:21:23Z

Ribbit: interaction between the various effect can be important (at least in this situation!)

Doesn't the reference to the "Doppler" effect refer to the fact that the Doppler effect may distort the meaning of words in a tonal language, thus making it harder to perceive the word being shouted out of the firetruck? [[User:A-jay|A-jay]] ([[User talk:A-jay|talk]]) 07:52, 29 May 2015 (UTC)

I think it is a bit more complex than effect mentioned having an individual referent. It becomes complex because the language level, for example, interacts with the physics level. (I think this is the joke, that such random effects from different fields can actually interrelate in some bizarre scenario) A tonal language would be much more susceptible loss of meaning due to blue shift from the doppler effect than a nontonal language. Shouting red is also probably a reference to the 'red-shift' in the doppler effect, which, depending on the speed of the truck may distort the sound the shout or make it unintelligible. At sufficient speed, this would also distort the actual color of the firetruck, which is a topic Randall discussed in one of the What-If's about traffic lights and should probably be linked here. --[[User:MareCrisium|MareCrisium]] ([[User talk:MareCrisium|talk]]) 08:15, 29 May 2015 (UTC)

I wonder if the reference to whether the language has a word for "firetruck" is a Sapir Whorf reference? If there's no word for firetruck, the listener (victim?) is likely to be more confused by the situation than a listener who can at least recognize what kind of vehicle is about to kill him/her (Curses! There's no sexless personal pronoun in this language!) So the reaction time of the first person is likely to be longer than that of the second person.

There's a whole class of psychology experiments (with both human and animal subjects) that uses reaction-time as a measure of degree of understanding in various situations. Is this effect named after a famous experimental psychologist? If so, Randall may have to issue an update to this cartoon...