explain xkcd - User contributions [en]

Talk:3157: Emperor Palpatine

2025-10-22T07:22:22Z

Xseo:

What happens when he is five years old in canon Star Wars [[User:Mathmaster|Mathmaster]] ([[User talk:Mathmaster|talk]])
:As a Youngling, he would obviously get a funny hat and a 'not quite so dangerous' training-lightsaber. At least for Jedi training, can't speak for Sith training, which probably goes with the exact opposite (funny shoes and a lightsaber that has no hilt?)... ;) 22:13, 20 October 2025 (UTC)

I don't think the title text is sarcastic. Making Palpatine look older in Return of the Jedi allowed the actor's age to be very precise for the character in the 3 subsequent movies (while allowing the same actor playing the character). --[[Special:Contributions/181.236.188.58|181.236.188.58]] 22:22, 20 October 2025 (UTC)

My first thought when reading the alt-text was of the reincarnated leader of the History Monks in the Discworld, analogous to the Dalai Lama. The memories and personallity of an old man, in the body of a toddler. The wise old man is normally in control, but sometimes the toddler takes over, leading to him wanting a biccie. {{unsigned ip|92.239.132.210|15:34, 21 October 2025}}

If he actually included a data point at Ian=74, Emperor=119 for Rise of Skywalker instead of just claiming "undefined", the trendline would have a positive slope...regardless of whether or not 119 is accurate, he clearly appears older than he does in Return of the Jedi, and even adding a point at (74, 89) would still result in a positive slope. However, I can get behind the idea of pretending Rise of Skywalker doesn't exist. [[Special:Contributions/136.226.154.60|136.226.154.60]] 16:24, 21 October 2025 (UTC)

Just by film chronology (because the EU and extended-EU already dealt with it, but has been largely decanonised since then), the true age of any particular Palpatine clone (there still may have been other extant ones, as well as such dead failures as might remain) is probably not much older than Jango's initial contribution to the Clone Trooper project, the same process being used (though not also on Kamino), and so roughly as old as Bobba Fett would be at that point (if surviving the Sarlak, etc), having had little to no 'aging up' treatment. Though ''with'' the aging up, effective developmental age is accelerated, and with both the hit'n'miss nature of the emperor-cloning process and the need of Exegol's caretakers to always try to keep a not-too-decrepit clone at hand to become a ready vessel for Sheev's spirit to occupy, his body's true age is probably quite young even if his apparent age is far older. And, in terms of psychological age, he's probably ''exactly'' as old as if he had not jumped-bodies, or maybe that minus any 'gap time' that his Sithish force-ghost might have had to have spent in some form of stasis as the transplantation process was being put into effect. [[Special:Contributions/82.132.236.174|82.132.236.174]] 21:39, 21 October 2025 (UTC)

The current explanation reads like an AI response. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 07:22, 22 October 2025 (UTC)

Talk:Main Page

2025-05-14T12:19:38Z

Xseo: /* Side navigation menu */

{{TOC}}{{notice2|<big>'''For the discussion of the latest comic #{{LATESTCOMIC}}, [[{{LATESTCOMIC}}#Discussion|click here]].'''</big> This page is for discussion of the [[Main Page]] itself. Other issues belong in the [[explain xkcd:Community portal|Community Portals]].}}

==New discussion page==
As a new user, I think the first page is very important. So I thought why not begin a discussion here what to have on the first page every user visits.--[[User:Relic|Relic]] ([[User talk:Relic|talk]]) 05:59, 1 August 2012 (EDT) Re-signed here - b/c I broke the comment in two when I added the "List of comics" header. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 23:01, 2 August 2012 (EDT)

Can someone get this to display the redirected page instead of the original? For example, I just moved the page [[2865: the Wrong Stuff]] to [[2865: The Wrong Stuff]], but it still shows the origional (wrong) page. Can someone change that? [[User:B for brain|B for brain]] ([[User talk:B for brain|talk]]) 19:17, 9 December 2023 (UTC)
:The problem seemds to have been (and was proven to be solved through) the way the template for the "newest comic" (re)redirects through the [[2865]] page, which was still pointing at the original place. Maybe there's a "two redirection limit", or a lower limit on top of the one(s) the wikicode already knew that it would (ordinarily) have to deal with to make the transclusion end up at the right place... I haven't delved too far into the mechanics, as I rarely visit the Main Page off my own back, so would never have noticed without your informative bugrep.
:Also, the 2865 redirect page probably needed changing, anyway, to keep track with everything else. I then made [[the Wrong Stuff]] redirect to the new name, too. And, just checking, it looks like someone (who has page-creation priviliges) needs to make a duplicate redirection page/valid target for [[The Wrong Stuff]], which right now will be a red-link. Or rename the "the" version to "The", but it depends upon how/if you want to cover all the bases for potentially valid (FCVO 'valid') searchig options. Wouldn't suggest wrong-case copies of anything else, but future searching using (external) historical data certainly could get caught up in this slight muddle... ;) [[Special:Contributions/162.158.74.49|162.158.74.49]] 20:20, 9 December 2023 (UTC)

==List of comics==
I was thinking of having a quick link to the list of comics that is explained. Right know, it took me a while to even see any of them. Eventually I found the "List All Pages" (found it in Special pages) where I could find the comics that have been explained. What do you think?
:A category tag will do that for you automatically. Having a list of comics indexed by its number would be a little different.--[[User:Relic|Relic]] ([[User talk:Relic|talk]]) 05:59, 1 August 2012 (EDT)
::Sounds like a great list - I ''think'' it'd have to be manually maintained until/unless we get someone who knows how to make a bot update it. Categories will be useful, but they only work if someone added the category to the page in the first place. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 07:21, 1 August 2012 (EDT)
:::A (somewhat) related question - should [[:Category:Comics]] be sorted alphabetically or by comic number? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 07:43, 1 August 2012 (EDT)
::::I think [[:Category:Comics]] should be sorted by comic number. If you are looking for a specific comic, you will use the search field. Is there a way to make that happen? --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 08:11, 1 August 2012 (EDT)
:::::They are two different functions. For the former, instead of adding <nowiki>[[Category:Comics]]</nowiki>, add, say, <nowiki>[[Category:Comics|1]]</nowiki>. For the second, we can create redirects. Normally, I'd say just make sure the search term was in the article text, but since numbers are going to be use for other purposes than just comic titles, it may be better to create [[1]] and [[Comic 1]] as redirects to the relevant articles right off the bat. --08:24, 1 August 2012 (EDT)
::::::We could also have a comic-list template on the Main Page, I suppose, or perhaps two - one for number and one for name? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:54, 1 August 2012 (EDT)
:::::::Here's what I was thinking of for that: {{tl|Comics navbox}} Thoughts? ''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]]
:(outdent) It's ugly, but a sortable wikitable [[User:SurturZ/sandbox|(click here for example)]] could be used as a checklist to see what has been uploaded and what hasn't. What's the project namespace here, anyway (analogue of "WP:")? --[[User:SurturZ|SurturZ]] ([[User talk:SurturZ|talk]]) 03:04, 3 August 2012 (EDT)
:OK, I've found a way to get all the titles of the comics, so I was confident enough to create <big>[[Explain XKCD:Checklist]]</big> which can be used to fill in the gaps. --[[User:SurturZ|SurturZ]] ([[User talk:SurturZ|talk]]) 03:41, 3 August 2012 (EDT)
::I'm liking the checklist! That should do quite nicely as a "tool for editors". (I'm linking to it at the Community Portal). We still need the "template for readers." Did you think {{tl|Comics navbox}} was on the right track or should we do something else for that? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 20:09, 3 August 2012 (EDT)
::Better idea - I'm throwing it directly onto the Main Page. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 20:10, 3 August 2012 (EDT)

==Admin list==
You can find a system-accurate list of admins [{{canonicalurl:Special:ListUsers|group=sysop}} here], so that might good to share, along with the manual list. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 07:13, 1 August 2012 (EDT)
:Added to page. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:10, 1 August 2012 (EDT)
::That's exactly what I wanted, but couldn't find the auto page for it. I knew it was somewhere. I don't see any reason to keep the link to the manual page. Do you? --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 08:11, 1 August 2012 (EDT)
:::Not unless you want it. I'll remove it. Should I add the similar link for 'crats or is that unnecessary at this point? --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:25, 1 August 2012 (EDT)
::::To be honest, I have no idea what the Burecrats role does. Might be unnecessary now but helpful in the future? --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 11:16, 1 August 2012 (EDT)
:::::Bureaucrats can turn other users into administrators (or indeed, other bureaucrats). That privilege isn't available to ordinary administrators. I'd keep it to yourself for the time being. :-) --[[User:Yirba|Yirba]] ([[User talk:Yirba|talk]]) 17:39, 1 August 2012 (EDT)
::::::You can actually see a technical list of which rights each group confers at [[Special:ListGroupRights]]. As the wiki grows, you might want to spin off a few, such as the ability to grant rollbacker and autopatrolled, to admins as some other wikis have. But for the time being, at least, there's really no reason for the wiki to have more than one 'crat. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 17:07, 2 August 2012 (EDT)

== Community portal ==

I've created the [[Explain XKCD:Community portal]] as a tools/help page. If that's not what you want, feel free to change/move/whatever it, but I thought it'd be nice to save this page for discussion of the Main Page and discuss the wiki as a whole/ask for help there. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 08:36, 1 August 2012 (EDT)

== Direct link to latest comic ==

There should be a direct link to the latest comic at the top of the Main page. A nice thing about going to explainxkcd.com was that the latest comic is right there at the top. For those changing their default link to the wiki, there should be an easy "Latest Comic" link that quickly takes them there. I'm sure some folks actually skip xkcd.com and come directly here instead to read the latest offering from Randall. They shouldn't have to search for it.
[[User:Christopher Foxx|- CFoxx]] ([[User talk:Christopher Foxx|talk]]) 11:59, 1 August 2012 (EDT)

: Maybe the page [[latest]] should redirect to the most recent comic? Could that be taken care of by some sort of script/template so it doesn't have to be manually updated? Should each explination page also have "next", "previous", "random", "first" and "latest" links, possibly also generated automatically via scripts/templates? Additionally, shouldn't the number page be the canonical one? It seems like [[Internal monologue]] should redirect to [[1089]] rather than the other way around - certainly it would make a bunch of scripting types of things a lot easier. [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:02, 1 August 2012 (EDT)
:::If you wanted, we could even use wiki-magic to show the title of the page as the Comic name, but the URL as the number - in order to parallel the actual XKCD website. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 17:09, 2 August 2012 (EDT)
:: Shouldn't there be a way to programmatically find the comic with the highest number that has a page with content? That would work as long as no one puts future comic pages up. --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 20:25, 1 August 2012 (EDT)
:::It's all sounding like folks are over-complicating something quite easy. All I'm suggesting is a prominent link to http://www.xkcd.com/. No need, I think, to list which number the latest is, or include the next/last/random buttons, etc. [[User:Christopher Foxx|- CFoxx]] ([[User talk:Christopher Foxx|talk]]) 11:41, 3 August 2012 (EDT)
::::Oh. We've got that, now, in the sidebar - labeled as "XKCD." I do think that having an internal link to the latest (explained) comic would be a great thing, though. --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 16:36, 4 August 2012 (EDT)

You can transclude the latest comic on the main page like this: <nowiki>{{:pagename}} e.g. {{:Internal_monologue}} </nowiki>--[[User:SurturZ|SurturZ]] ([[User talk:SurturZ|talk]]) 00:25, 2 August 2012 (EDT)
: I've started with just a manual link to the latest comic. Ideally it will be automatic, but a manual link will work for now as I've had quite a few people ask for it. --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 21:09, 1 August 2012 (EDT)

Transclusion of the latest comic is great. Someone with the right permissions should add (for instance on the top-right corner of the grey transclusion area) a link to edit the corresponding wiki page, so that people seeing something they could add would feel invited to do so (wiki style). In my opinion this would be a good way to improve the quality of the user-generated explanations.
Also, all the "XKCD"s in the "New here?" section should be converted to the lowercase "xkcd"...
[[User:Cos|Cos]] ([[User talk:Cos|talk]]) 14:00, 6 August 2012 (UTC)
:Good points. I've done both. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 15:48, 6 August 2012 (UTC)

Call me dumb, but... You've got a link called "prev" that goes to the explaination for the previous comic. Then a link called "comic #42" but that goes to xkcd. And then a smaller, less prominent link called "go to this comic" that doesn't go to the comic but to its explaination. Anyone else think that's a little back-to-front? [[User:Zootle|Zootle]] ([[User talk:Zootle|talk]]) 17:18, 31 August 2012 (UTC)
:OK, you're dumb :-). The standard template for an explanation page includes the header with "Prev", "Comic # (date)", and "Next" links. If we don't have explanation pages for the previous or next comic, we don't show the respective link. I hadn't noticed that the "Comic # (date)" bit was a link to the xkcd site before, but in context it makes sense to me. Including a link to the Explain page for the comic who's explain page you are already looking at doesn't make sense.
:The explanation page for the latest comic is "transcluded" in the main page pretty much as-is, so we get the header, the comic, the explanation, etc. We don't get the discussion, which is visible at the bottom of the Explain page. Because there is never an explanation for a comic that hasn't been released yet, there is never a "Next" link on the main page's transcluded header. So you get "Prev" and "Comic" links. The "Go to this comic" link is added by the main page above the transcluded explain page.
:I can see how the "Go to this comic" link might be poorly worded especially as it's placement seems to be within the explanation it's linking to. [[User:Blaisepascal|Blaisepascal]] ([[User talk:Blaisepascal|talk]]) 18:16, 31 August 2012 (UTC)
::Rather than "Go to this comic" maybe it could be "Go to full explanation" ? Something else? [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:38, 5 September 2012 (UTC)
::There was [http://www.explainxkcd.com/wiki/index.php?title=explain_xkcd:Community_portal/Admin_requests#.22Edit_this_explanation.22_link_on_main_page a discussion at one point] about a wittier/more descriptive link - but no one came up with anything. I do like "Go to Full Explanation" better, for what it's worth. --[[User:DanB|DanB]] ([[User talk:DanB|talk]]) 15:31, 5 September 2012 (UTC)
:::My problem with that suggestion is that it implies that the main page explanation is not full. As of right now, the full explanation is transcluded on the main page. There's nothing more to see by clicking that link (explanation wise) Perhaps "Go to full explanation page" but that doesn't quite sound right to me... [[User:TheHYPO|TheHYPO]] ([[User talk:TheHYPO|talk]]) 15:42, 7 September 2012 (UTC)
::::How about "Go to this Comic Explanation Page"? One nice thing about the specific page rather than the [[Main_Page]] transcoding is that it nicely includes the discussion as well. I have a bookmark to the [[Main_Page]] that I look at every day, but I want to easily read the discussions, not only the explanation. Humm, maybe we could have a page [[most recent comic]] that automagically redirects to the most recent comic? [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 12:42, 8 September 2012 (UTC)
:::::I tried to get [[most recent comic]] to redirect to LATESTCOMIC, but can't get the syntax working - it is possible? [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:03, 8 September 2012 (UTC)
::::::Apparently it isn't. I would have tried <code><nowiki>#REDIRECT [[{{LATESTCOMIC}}]]</nowiki></code> like you did, but since that doesn't work, I'll delete the page for now. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 16:38, 20 November 2012 (UTC)

== Discussion of latest comic ==
Perhaps include the discussions of the latest comic here? I almost missed there was a discussion field a few times because I would only read about the latest comic on the main page. [[User:Carewolf|Carewolf]] ([[User talk:Carewolf|talk]]) 14:54, 22 September 2012 (UTC)

This comics's explanation is complete bollocks, I think. Of course it is NOT a "fact that such a room exists". This comics parodies trope often used in cop movies - an elderly cop goes to work for the last time before his retirement, packs things, plans fishing the next day ... only to be called to one more case (possibly with a new, young and brash partner). And despites his efforts not to screw anything and stay clear of danger, he is either mortally wounded or screws big time and is degraded. So much clichè, that if someone says "It's my last day or service", you might be sure one of the two options above happens. See http://tvtropes.org/pmwiki/pmwiki.php/Main/Retirony [[User:edheldil|Edheldil]] 10:17, 26 September 2012 (UTC)

I believe this link maybe relevant: http://en.wikipedia.org/wiki/Turtle_graphics {{unsigned|Rhudi}}

I went ahead and filled out the bracket from today's (see edit date) comic: http://m.imgur.com/gallery/WyPkHx2 {{unsigned|Glaucon81}}

*rise

Btw, why wouldn't I just enter "ipconfig free" if I didn't want my IP address showing? {{unsigned ip|172.68.65.48}}

== The comic explanation count is wrong ==

The adjustment is currently 3, but there are now 6 subcategories and one list making the current correct adjustment 7.
If the wiki was upgraded to version 1.20, a form exists to automatically exclude subcategories.
--[[User:Divad27182|Divad27182]] ([[User talk:Divad27182|talk]]) 09:56, 8 October 2012 (UTC)

:Looks like another week of the wiki going down then.
:But seriously, I've been noticing this too. Didn't know what was causing it, but it's going to have to be fixed sometime.[[User:Davidy22|Davidy22]] ([[User talk:Davidy22|talk]]) 10:25, 8 October 2012 (UTC)

::The text reads <pre><nowiki>We already have [[:Category:Comics|'''{{#expr:{{PAGESINCAT:Comics}}-3}}''' comic explanations]]!</nowiki></pre> The -3 is to account for the subcategories and non-explanation pages in the category. There apparently used to be three such pages, and now there are seven. I would fix this myself, but the page is protected. If the wiki where upgraded to version 1.20, the categories could be explicitly excluded, but the [[List of all comics]] would still be in the category. (Note that the -3 actually appears twice.) --[[User:Divad27182|Divad27182]] ([[User talk:Divad27182|talk]]) 05:03, 11 October 2012 (UTC)

:::Mediawiki 1.20 fixes this issue, although it'd be nice if this could be fixed in the meantime via the hack reccommended by divad. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 06:40, 16 November 2012 (UTC)

:Looks like Waldir updated the "Comic Correction Count" to "10" (as of 20 November 2012):
<nowiki> We already have [[:Category:Comics|'''{{#expr:{{PAGESINCAT:Comics}}-10}}''' comic explanations]]!</big>
Note: the -10 in the calculation above is to discount subcategories (there are 7 of them as of 20 November 2012),
non-comic pages (2 as of same date: [[List of all comics]] and [[Exoplanet]])
and the comic 404, which was deliberately not posted. Thus 7 + 2 + 1 = 10
(But there are still {{#expr:{{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-10)}} to go. Come and [[List of all comics|add yours]]!)</nowiki>
:Could we possibly make this more dynamic by creating a "IGNORE_IN_COUNT" category or something? and then using something like: <nowiki>{#expr:{{PAGESINCAT:Comics}}-{{PAGESINCAT:IGNORE_IN_COUNT}}}</nowiki>? Then any additional entries to the "Comics" category (that are 'special' entries) could just have the special category added and no main page editing would be necessary? --[[User:Bpothier|B. P.]] ([[User talk:Bpothier|talk]]) 07:50, 22 November 2012 (UTC)

==Make Jeff stop apologizing==
The apology for server downtime has been around for a while now. Can we take it down? [[User:Davidy22|Davidy22]] ([[User talk:Davidy22|talk]]) 04:41, 11 October 2012 (UTC)

== Spambots ==

I think someone should install [http://www.mediawiki.org/wiki/Extension:AbuseFilter AbuseFilter]. --[[User:Kronf|Kronf]] ([[User talk:Kronf|talk]]) 10:09, 13 October 2012 (UTC)

== Purge ==

We should regularly purge the server's cache for the main page using http://www.explainxkcd.com/wiki/index.php?title=Main_Page&action=purge to keep the explanation up to date. --[[User:Kronf|Kronf]] ([[User talk:Kronf|talk]]) 02:28, 3 November 2012 (UTC)

Now that we've been hacked, that doesn't seem like a very good idea. [[Special:Contributions/172.71.167.209|172.71.167.209]] 02:55, 25 July 2023 (UTC)
:We've really [[932: CIA|not been hacked]], and even I can undo the vandalism (though there are other ways to proof us from a recurrance of this latest laughable attempt, that proper admins might use). [[Special:Contributions/172.70.90.80|172.70.90.80]] 07:46, 25 July 2023 (UTC)

== Updating the Rules ==

I've been having a lovely discussion with someone who apparently thought the "edit anything you want" rule applied to the Talk pages. As we don't have any codified rules for ''here'' and can only point to "well the canonical way this is done on Wikipedia is..." I think that there are a few things we need to put into the list of Rules on the front page, and then have a link to a more in-depth talk about why the rules exist and what-not.

Specifically, I'm talking about writing "Feel free to edit any page on the wiki to be better. But, treat talk pages like you would blog comments: comments by other people ''cannot be changed by you'', you can only respond to them." as a new rule to be plastered on the front page, as there seems to be an increasing number social neophytes that seem to think that editing words that are attributed as being said by another person is perfectly legitimate and non-controversial.

Shall we discuss? [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 01:25, 15 November 2012 (UTC)

:We could add the etiquette rules as an addendum to the signature reminder at the top of the page. Just an extra note below the alert box asking people to not edit other people's comments. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 06:40, 16 November 2012 (UTC)

::It really should be right down with the "edited mercilessly" description, because this is an exception to that statement. Shouldn't have two sets of contradictory instructions in different places. When I made my improper edit, I had a semi-conscious moment of doubt about whether changing the other guy's comment was ok, even though this is a wiki (and even though it wasn't really clear to me that this "discussion" box held something totally separate from the page content), but that statement at the bottom put all such doubts to rest. I read it multiple times to be sure. But I did not notice that line at the top about the four tildes until ''much'' later. It's somewhat lost, visually, in the header line, when you're not looking directly at it.[[Special:Contributions/50.0.38.245|50.0.38.245]] 18:32, 18 November 2012 (UTC)

:::There's discussion to replace that message with a more noticeable alert box. The message at the bottom of the page appears for all pages, including talk pages, so a talk-page specific message there would not entirely fit. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 00:18, 19 November 2012 (UTC)

::::If that text at the bottom is in fact alterable, it should be written to take every case into account. It's an extremely poor user interface that has instructions appearing on a page stating rules that are the exact opposite of reality. And note that the altert box on the top looks a lot like a banner add, when you don't focus on it and read it. People will tend to habitually filter out anything written there from their perception. Also, it can easily be scrolled off the top of the screen when the discussion starts to get long, and they have a preview displayed.
::::So I think after the "...then do not submit it here.", it should add, "'''Exception''': others' comments in Discussion pages are not to be altered. See full rules at <<link to appropriate wikipedia page>>."[[Special:Contributions/50.0.38.245|50.0.38.245]] 15:46, 28 November 2012 (UTC)

== Update after changes ==

The front page explanation hasn't been updated at all day to match changes in the explanation on the comic's page. This is a major problem i think, as it is the front page explanation people visitors will most often read. --[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 20:43, 26 November 2012 (UTC)
: It might be a caching issue. Appending <code>&action=purge</code> to the URL will probably fix it. Can you confirm it looks good to you now? --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 00:29, 27 November 2012 (UTC)
::Yep, now it updates instantly! Well done, whatever you did! :) --[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 16:24, 27 November 2012 (UTC)

:::I've also added a link underneath the comic box that has the action embedded, so no one has to do any manual URL hacking. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 17:38, 11 December 2012 (UTC)

::::Just wanted to check in on this - are there issues with automated systems or spammers following this link? I know it can affect performance - caching is important on a busy site! --[[User:Overand|Overand]] ([[User talk:Overand|talk]]) 22:37, 13 September 2013 (UTC)

== Suggestion: Change "Go to this comic" to "Go to this entry" ==

Just a small suggestion. For the Main Page, I suggest changing "Go to this comic" to say "Go to this ''entry''" instead to remove any confusion for new and regular viewers. It certainly took me a while to figure how to go to each featured comic's entry from the main page.

[[Special:Contributions/69.43.114.2|69.43.114.2]] 17:04, 11 December 2012 (UTC)

:How about if it reads "Go to this comic explanation"? Would that be less confusing? I only quibble because the explanations aren't really entries, in wiki parlance each page is usually called an article, but that doesn't seem to fit here as we really have explanation pages. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 17:41, 11 December 2012 (UTC)

::Agreed. [[User:Ctxppc|Randy Marsh]] ([[User talk:Ctxppc|talk]]) 22:55, 8 January 2013 (UTC)

== Explain the Unreleased Comic? ==
:I wonder if [[http://i56.tinypic.com/a9ton8.png this comic]] is permitted to be explained, despite the double issue of Randall pulling the comic plus me finding the pulled comic through "xkcd overrated"... [[User:Greyson|Greyson]] ([[User talk:Greyson|talk]]) 18:21, 12 December 2012 (UTC)



== Comic Links ==

Some of the links seem to be confusing, as they're titled in a weird way. The link/button 'go to this comic', I'd expect would go to the actual comic on XKCD's page. Yet it goes to the comic's wiki page. And clicking on the comic # and date directs you to the XKCD page, yet I really feel that link should go to the wiki page, as it's right at the top center there, and has the date and everything, sort of indicating that it's a wiki page, yet it's not. And the prev and next buttons next to it don't go to the xkcd page, they go to the wiki pages. Which is really messed up, I think. Because of my confusion, every single time I visit here, I clicked on the wrong link, though now I've gotten used to it. I suggest rewording the links as 'XKCD Comic # and date' and 'go to this comic's wiki page'. And possibly switching the links' positions so that the wiki links could be in that navigation bar and the XKCD links could be off to the side. After all, we are a wiki, so putting our wiki links to the comic off to the side and the direct xkcd link in the center seems odd. Anyway, has anyone had the same thoughts and/or agree with me on this?--[[Special:Contributions/69.119.250.251|69.119.250.251]] 18:19, 9 January 2013 (UTC)

== Unexplained comics ==

The template that starts each explanation page should be edited to have the next and previous buttons automatically skip over pages that don't exist, rather than simply not being there if comic n+1 or n-1 doesn't exist. Preferably it would append a notice to the next page (like the redirect notices commonly found on mediawiki) telling you how many comics have been skipped. I'm not sure how feasible this would be to script, however. [[Special:Contributions/130.160.145.185|130.160.145.185]] 23:45, 9 March 2013 (UTC)

== Percentage of remaining comics calculation is off... ==

Okay, I hate to be "that pedantic math guy", but... Today the main page reads "We have collaboratively explained 936 xkcd comics, and only 252 (27%) remain." While I agree that 252/936 is roughly 27%, I believe we should really be calculating the percentage as "the number left to explain" divided by "the total number of comics that exist", not divided by "the number we have finished". That is (today), 252/1188=21%. Think about it. If we had completed 594 comics today, with 594 remaining, what should the percentage be? 594/594=100%? That's not right... 594/1188=50%? That's what we really want to say.

The page is protected, which makes sense. So I'll make my suggestion here.

Change this:

<pre>
and only {{#expr:{{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)}}
({{#expr: ({{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)) / ({{PAGESINCAT:Comics}}-9) * 100 round 0}}%)
remain.
</pre>
To this:
<pre>
and only {{#expr:{{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)}}
({{#expr: ({{LATESTCOMIC}}-({{PAGESINCAT:Comics}}-9)) / {{#expr:{{LATESTCOMIC}}}} * 100 round 0}}%)
remain.
</pre>
[[User:Imperpay|Imperpay]] ([[User talk:Imperpay|talk]]) 15:32, 20 March 2013 (UTC)

:Done and done. '''[[User:Davidy22|{{Color|purple|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 15:37, 20 March 2013 (UTC)

:Thanks for the heads-up! However, notice that the #expr: around LATESTCOMIC was unnecessary. I've removed it. [[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 11:30, 21 March 2013 (UTC)

::Waldir, you have exposed me as a charlatan and a fool! (I just copied, pasted, and tinkered until I made something that worked. I don't actually understand it. No formal training, you see. It's what we used to call "hacking" back in the dawn of the digital era, before the word took on connotations of vandalism, trespassing, and fraud. Have you kids come up with another word for it?) [[User:Imperpay|Imperpay]] ([[User talk:Imperpay|talk]]) 13:59, 22 March 2013 (UTC)

::: Joke's on me then, 'cause you sure fooled me – I readily assumed you knew your way around those parser functions. Nice job hacking the code, it was a nearly perfect crime ;) --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 03:26, 25 March 2013 (UTC)

:::I've heard the cool kids call that the "Maker Mentality", usually with a reference to [http://makezine.com/ Make magazine] and [http://makerfaire.com/ Maker Faire]. But I think there's also a movement to resurrect the original meaning of hacker. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 04:21, 25 March 2013 (UTC)


== Expression error on Main Page ==

Please use <code><nowiki>{{PAGESINCAT:...|R}}</nowiki></code> instead of <code><nowiki>{{PAGESINCAT:...}}</nowiki></code> to correct these errors :) --[[Special:Contributions/110.168.83.62|110.168.83.62]] 10:55, 8 April 2013 (UTC)
:Dun diddly done. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 11:21, 8 April 2013 (UTC)

== Compile a list of non-technical comics to non-technical readers? ==

I'm a long-time reader and fan of >< |< C |}, but my normal approach is useless when I introduce this provocative comic series to my less technical friends. They stay at the apparent level of many comics. They don't bother reading the explanations, but they would say, "it's hard to make sense". Imagine an average non-technical (and non-arts) major guy/girl, can we compile a list of state-of-the-art but less-technical, easy-to-comprehend but "ah ha!!" strips that is suitable for them? --[[User:FrenzY|W shll nvr flly xpln xkcd!]] ([[User talk:FrenzY|talk]]) 12:39, 18 May 2013 (UTC)
:Oh my god that signature.
:Gaah, derailment. Uh, pretty much anything that isn't tagged with the physics or math categories are easy enough to understand for the average English speaker, so just check the categories at the bottom of the page for that. Also, avoid comics with the incomplete tag, and that oughta be fine. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 14:41, 18 May 2013 (UTC)


== List of incomplete comics ==
We need a link to the "Incomplete articles" at the main page below the "Missing link". Most pages are created but many are incomplete.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 19:06, 7 June 2013 (UTC)

== Header message ==

'''Please don't take this seriously unless you actually think it's a good idea:'''

I think the header should be changed from "explain xkcd: It's 'cause you're dumb." to "explain xkcd: It's 'cause you're dumb... or still have some hope that comic [[1190]] will end." or something similar. [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 14:53, 9 June 2013 (UTC)

::Nope! This page is trying to explain more than 1222 comics, not only [[1190: Time]]. The header just states the truth.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 15:49, 9 June 2013 (UTC)

I'd vote for a change. People have started coming over to discuss the comic even when they've 'gotten' it. That, and the fact that this is one step ahead of Googling the references yourself. So.. maybe, "it's because you're dumb..and lazy."[[Special:Contributions/220.224.246.97|220.224.246.97]] 02:26, 31 August 2013 (UTC)
:I honestly don't think it either. This is the most comprehensive comic-by-comic Wiki. People don't come here because they're dumb ''or'' lazy. That's like saying I'm dumb for reading a review of an episode after I've watched it - I'm interested in seeing what other people up with or caught that I didn't. It denigrates the idea of aggregating information, which is a very un-XKCD idea.

As a regular reader of explainxkcd (who was to lazy to cotribute anything until now), I'd like to support the proposed edit. (... and lazy) It really fits to the tone of our favourite waste of otherwise productive time (which is xkcd for myself). Best wishes from Heidelberg, Germany. --[[Special:Contributions/147.142.13.86|147.142.13.86]] 14:38, 10 October 2013 (UTC)

A friend that happens to be blind hates this site because of the "It's cause you're dumb" tagline. If he wants a transcript of the comic on xkcd, his option is to come here and have his screen reader program telling him that he is dumb every single time.

How about, "explain xkcd: because sometimes we all need a little help."? -- [[Special:Contributions/173.245.54.65|173.245.54.65]] 02:07, 8 February 2016 (UTC)

:Oh, hadn't thought about that. There's been recurring complaints about this over the years, though the tagline's been around since before we were a wiki. I'll write something up and put this to a vote. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 09:00, 8 February 2016 (UTC)

It's been 12.5 years now since Randall advised us to stop making fun of people who aren't in the loop: [[1053: Ten Thousand]]. For an inside joke, we could change it to "explain xkcd: now you're one of today's ten thousand." Alternatively, I like the semi-honest/semi-self-deprecating "explain xkcd: because jokes are always funnier with an explanation." -- [[Special:Contributions/103.111.183.139|103.111.183.139]] 19:54, 15 December 2024 (UTC)

I go with the notion that there's nothing at all wrong with starting off less informed. It makes it easier to learn something new. [[Special:Contributions/172.69.79.165|172.69.79.165]] 23:53, 15 December 2024 (UTC)

== A point of confusion ==

Why is 'Apatosaurus' a category but 'Internet Argument' no longer a category? [[User:Greyson|Greyson]] ([[User talk:Greyson|talk]]) 13:53, 20 June 2013 (UTC)
:Cuz people hit the random button, see an Apatosaurus feature in three comics and figure it must be a recurring theme. Same as the internet argument thing. Will get round to a category purge after we've cleared out all the incomplete tags. I think there's one for ferrets hidden away somewhere in the dark recesses of our catalog of categories. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 14:45, 20 June 2013 (UTC)
::On the subject, can I suggest a "Barred from Conferences" category, or similar? That's definitely a recurring theme (for a long, long time), and thus should be justified enough. I'd be happy to add various qualifying articles as I scroll through again, if I can, but first I'll leave it up to someone else to solidify the actual name. (In case it turns out not to be just conferences, for example.) [[Special:Contributions/178.98.31.27|178.98.31.27]] 16:27, 22 June 2013 (UTC)

== Incomplete comics statement ==

I suggest the minor change: "We have an explanation for all x xkcd comics, and only y (y/x %) are '''marked as''' incomplete." –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 08:07, 21 June 2013 (UTC)

== 1262 is out ==

So what are you waiting for? [[Special:Contributions/75.60.27.102|75.60.27.102]] 06:25, 9 September 2013 (UTC)
:<nowiki>(diff | hist) . . N 1262: Unquote‎; 06:23, 9 September 2013 (UTC) . . (+322)‎ . . ‎Davidy22 (Talk | contribs | block)‎ (Created page with "{{comic | number = 1262 | date = September 9, 2013 | title = Unquote | image = unquote.png | titletext = I guess it's a saying from the Old Country. }} ==Expl...")</nowiki>
:Examine the time stamps. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:30, 9 September 2013 (UTC)

== Adverts ==

I am not going to disable my adblock, I hate ads. If you accept bitcoin I can make a donation though. [[Special:Contributions/184.66.160.91|184.66.160.91]] 05:24, 27 September 2013 (UTC)
:Our ads are always easy-to-load images as opposed to flash ads, they're always pointing to some valuable product of some form and we've looked at and approved all of them. They also occupy space that would otherwise have been empty, as our one ad is bound strictly to the sidebar. We used to have a paypal donation button, but it was pitifully tended to and a much less reliable source of income than ads. Ads are the only reliable business model for small sites like this one; unless our readers suddenly become willing to pay all our server costs for us, we can't feasibly afford a better hosting plan without ads. We legally aren't allowed to open a merch store, because that infringes on Randall's shop, and we haven't had a single generous benefactor yet. If you want to stop seeing our server error messages, loosening up adblock for us and contributing to our impressions count will help us massively. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:00, 27 September 2013 (UTC)

I don't care about your server message, I wanted to make a donation. Sooo, you don't want any bitcoins? [[Special:Contributions/37.221.161.235|37.221.161.235]] 07:16, 27 September 2013 (UTC)
:This took a bit of digging. We're fine with bitcoin donations, it's just that at the rate donations came in, they were just not enough to pay for anything. [https://coinbase.com/checkouts/b19f921822ac962807a8f72d51509e59] '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 20:34, 28 September 2013 (UTC)

Donation made! [[Special:Contributions/184.66.160.91|184.66.160.91]] 23:23, 30 September 2013 (UTC)
:Thanks! '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 02:27, 1 October 2013 (UTC)

I hope you kept your Bitcoins ;) --[[User:192·168·0·1|192·168·0·1]] ([[User talk:192·168·0·1|talk]]) 21:43, 5 May 2022 (UTC)

Am I the only one that feels it is "wrong" that the explainxkcd site has ads and the real xkcd doesn't have any? It feels like someone is profiting off of Randall's work. Does he officially endorse this website? Do any proceeds help go to support his ongoing publication of an awesome comic? [[Special:Contributions/173.245.54.19|173.245.54.19]] 16:01, 7 July 2015 (UTC)

:An admin will be able to give you more detail than me, but explainxkcd has a significant number of visitors (and thus hosting costs), and no way to generate income other than donations and ads. In contrast, Randall makes money from his comics by way of books and merchandise (and possibly public speaking), some of which will pay for his hosting. He could choose to have ads on his site to generate additional income, its his choice not to. I have no knowledge of the finances of explainxkcd, however I doubt there is much/any surplus ad revenue being pocketed by the owners/admin. As far as the site being officially endorsed, not as far as I'm aware, no.
:Also, for more discussion on adverts/income, see [http://www.explainxkcd.com/wiki/index.php/explain_xkcd:Community_portal/Proposals#Sidebar_ads here].--[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 16:21, 7 July 2015 (UTC)

== /wiki is returning a 403 ==

Hello, 
http://www.explainxkcd.com/wiki/ is returning a 403 now. In my eyes you should redirect it to the main-page instead :-). --[[User:DaB.|DaB.]] ([[User talk:DaB.|talk]]) 12:41, 8 November 2013 (UTC)
:We have a new, hopefully better, server. The problem is already reported to [[User_talk:Jeff#Forbidden]] --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 14:22, 8 November 2013 (UTC)

== Explain Explain XKCD / Explain^2 XKCD ==

This particular comic explanation requires explanation. Way too many potential cross references with each conjecture requiring its own explanation page. Dial it back a little. {{unsigned ip|108.162.245.11}}
:Uh, sorry, could you clarify that a little? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 07:23, 19 November 2013 (UTC)

::He is talking about the [http://www.explainxkcd.com/wiki/ http://www.explainxkcd.com/wiki/] issue. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:32, 19 November 2013 (UTC)
:::Well if it's that, that's an intentional permissions setting on a URL that no-one is feasibly going to type. Unless you can come up with a better use for that URL, with a reason? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 08:40, 20 November 2013 (UTC)
::::A symlink to "index.php" at the root folder would solve the problem.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 09:26, 20 November 2013 (UTC)
:::::I cannot believe how many weeks that took to fix. Amazing. No one was going to type it, but everyone was going to get redirected to it from the home page! [[Special:Contributions/108.162.222.227|108.162.222.227]] 11:37, 20 November 2013 (UTC)

The problem is still not solved. [http://www.explainxkcd.com/wiki/ http://www.explainxkcd.com/wiki/] gives still a 403 error because "index.php" is not included in the http server configuration as a default index page. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:07, 20 November 2013 (UTC)
:: I've fixed this. Sorry about the delay. Was super busy! --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 16:02, 21 November 2013 (UTC)
:::Thanks Jeff, it's working. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:20, 21 November 2013 (UTC)

== Webmaster: Obtrusive video ad on your site ==

In the ad section I saw a box sticking out and blocking out the explanation. This was therefore a very obtrusive botched video ad. Please remove this ad from your site. [[Special:Contributions/199.27.128.188|199.27.128.188]] 22:29, 6 June 2014 (UTC)

EDIT: It's now sticking out and preventing me from clicking on the "Save page" button. [[Special:Contributions/199.27.128.188|199.27.128.188]] 22:29, 6 June 2014 (UTC)
:We only accept GIFs for moving ads. Ads should also be contained within the sidebar as they're techonogically restricted to standard-sized PNGs and GIFs, so an extruding ad would be a CSS error on the site end/browser error. In addition, we run ads from lots of advertisers, and "this ad" is not specific enough to tell us which ad you want us to remove. Could you provide a screenshot/link/more information? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 22:54, 6 June 2014 (UTC)


== This explanation may be incomplete or incorrect: link ==

This has been bothering me for a while now. Why does the link in the info box for the main page link to editing the main page? It needs to link to the editing of the page which the comic's explanation is on. When I would like to edit the latest XKCD explanation, I click that thinking I am going to edit the explanation, but instead I am led to editing the main page. [[User:Auraxangelic|Auraxangelic]] ([[User talk:Auraxangelic|talk]]) 15:19, 24 October 2014 (UTC)
:Ooooooh, nice catch. I've actually never noticed that before, and it's definitely not intentional. It happens because the text of the explanation page is folded into the main page before mediawiki parses links and syntax, and the "Edit this page" button links to the page that the link is on. I have an idea for how to fix it though, so I'll get on that. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 01:49, 25 October 2014 (UTC)


==Cueball/Rob merge==

It seems to me from a general reading of the comics that Randall has always intended for the character we here call "Cueball" to have the name "Rob". Much as "Cutie" was renamed "Megan" when we learned her name, and now she is identified as "Megan" even in comics where her name is not explicitly mentioned, I think we should consider merging the "Cueball" and "Rob" articles. I know there's a lot of inertia here, but it seems to me that this is Randall's intention for the character's name. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 13:38, 10 March 2015 (UTC)
: Alternatively, we should un-merge [[Megan]] and [[Cutie]] for consistency. [[User:Djbrasier|Djbrasier]] ([[User talk:Djbrasier|talk]]) 14:50, 10 March 2015 (UTC)
: I'm pretty sure this is an augmentation of the author's internal characters, including the one he has developed involuntarily as to the nature of his love. His memory of his love is not his love, yet it is what he has to love. Randall seems the type to delve into this, and thus I am in support of keeping the character names as they stand. /eof [[Special:Contributions/173.245.56.185|173.245.56.185]] 05:43, 25 March 2015 (UTC)


== Broken Date Box on comics ==

The "Comic #1511 (April 13, 2015)" textbox that appears on top of each comic breaks if you shrink the screen. I think the space after the comma needs to be replaced with a non breaking space.{{unsigned ip|108.162.238.144}}

:Is it fixed now? '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 20:59, 13 April 2015 (UTC)

::It looks like it. I had pointed it out once before and it was fixed. I guess somebody reverted that change or something... --[[Special:Contributions/173.245.56.202|173.245.56.202]] 13:42, 15 April 2015 (UTC)

== 1515? ==

Is it correct that we have 1515 comics, as of April 15, 2015? --[[Special:Contributions/173.245.48.122|173.245.48.122]] 05:20, 15 April 2015 (UTC)
:It's not, but some people insist on making comic pages for things that aren't comics. I'll fix that. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:27, 15 April 2015 (UTC)

== 972 is broken ==

Look, I'm not going to make an account here or anything, but I just wanted to point out that trying to access the page for comic #972 leads to a database error, and maybe someone should check on that. [[Special:Contributions/173.245.48.102|173.245.48.102]] 07:45, 14 July 2015 (UTC)

Actually a lot of other pages lead to that same error as well... Even the 'Technical Diskussions' sub-page is broken. Seems to my, like some swap-spac needs cleaning up? [[Special:Contributions/108.162.230.83|108.162.230.83]] 10:32, 14 July 2015 (UTC)
:Yep. It's a symptom of another problem, but the errors should be cleared up now. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 16:31, 14 July 2015 (UTC)
::No dice. [[997]] is still broken. --[[Special:Contributions/198.41.235.119|198.41.235.119]] 00:27, 3 August 2015 (UTC)

:::Looks like they're working now. 21:01, 2016-11-27 {{unsigned ip|141.101.98.163}}


== URL ==

I notice that whenever you add "explain" to an xkcd url, it takes you here! neat! [[Special:Contributions/198.41.235.233|198.41.235.233]] 23:13, 28 August 2015 (UTC)
:Someone noticed! Finally! '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 04:45, 29 August 2015 (UTC)

== Should we really be using CC-BY-SA? ==

Don't get me wrong, CC-BY-SA is my favorite creative commons license. The problem is, are we really allowed? The reason I'm worried is that I'm not sure if what we are doing really counts as "fair use" with respect to XKCD. It would probably be better to do CC-NC-BY-SA, to respect XKCD, or at least put a note that CC-BY-SA only covers the wiki portion (since it's probably too late to do CC-BY-SA anyway).
[[Special:Contributions/173.245.54.37|173.245.54.37]] 23:38, 27 January 2016 (UTC)
:This is a tough one. Mediawiki sites generally use CC-BY-SA, even if the content they're based off is copyrighted (Wikia sites for various topics do this). The license only does apply to content ''created'' here. What should probably be done, if it isn't already, is some specification on pages in the <code>File:</code> namespace indicating that they are owned by someone other than the owners of this site. [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 19:37, 7 April 2016 (UTC)

== #1663: Garden not yet added? ==

For me it's 4:30 AM, 4/4/16 - I have a sleep schedule just like [https://xkcd.com/361/], so I've been first on quite a few xkcd explanations immediately. when they came out.
I notice that usually, immediately once a new xkcd comic is released, a bot generates a corresponding bare-bones page on this wiki. However, this new comic "1663: Garden" doesn't yet have an automatically-generated page. Maybe it's because of the strange user-session hash key that appears in the URL bar when the "comic" is interacted with? Maybe this sort of interactive thing messes with the bot?
Am I just being impatient? Do I have to wait a few minutes? (I'm going to bed, and this probably won't be seen until tomorrow, but I am at least interested in knowing how the bot system works.) [[Special:Contributions/173.245.54.21|173.245.54.21]] 09:01, 4 April 2016 (UTC)

== Skins broken ==

It seems both the Classic and Monobook skins are very very broken. Only Vector seems to be laid out normally. [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 19:39, 7 April 2016 (UTC)
: Yes, for me too. Let me see what can be done. [[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 20:10, 12 April 2016 (UTC)
::All calls to /load.php seem to fail, which results in the broken look. --[[Special:Contributions/162.158.86.167|162.158.86.167]] 11:02, 14 April 2016 (UTC)
:::Oh wow, I thought I was the only one. [[User:SuperSupermario24|Just some random derp]] 15:57, 8 May 2016 (UTC)
::::Should be fixed now. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 18:59, 17 May 2016 (UTC)


== Random Button ==
The actual xkcd site has one and adding one would make it closer to the actual site and make discovering random comics and their explanations easier. It could go next to the comic # button.[[Special:Contributions/173.245.52.69|173.245.52.69]] 01:03, 5 June 2016 (UTC)
:There is a random page button on the left. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 02:36, 5 June 2016 (UTC)
::Oh. Didn't see that. Sorry.[[Special:Contributions/173.245.52.69|173.245.52.69]] 20:16, 5 June 2016 (UTC)
:I think that a random button next to the XKCD button would make sense too, but also with the link on the sidebar. [[Special:Contributions/172.71.151.78|172.71.151.78]] 22:50, 15 February 2023 (UTC)
{{Done|Done!!!}}  Check [[{{LATESTCOMIC}}]] for an example of how it looks and works. --[[User:FaviFake|FaviFake]] ([[User talk:FaviFake|talk]]) 15:54, 23 April 2025 (UTC)


== Chatroom Idea... What do you guys think? ==
I have an idea. What if there was a discussion board for the wiki? (And no, I don't mean boards like this or the "comment section" of comic explanations. I mean a live chatroom plugin of sorts. We could add it to the website and enable it so we can talk to each other in real-time and make live edits with each other. This way, we can also let each other know of edits we've made, make new pages altogether, or just talk. What do you guys think? -- [[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 9:10, 13 September 2016
:The [http://www.explainxkcd.com/wiki/index.php/Special:RecentChanges recent changes] log already notifies all users on the site of new pages and edits. User talk pages and the community portals exist for coordination. Also, avoid creating new comment topics in the middle of a talk page in the future, comments are supposed to follow a chronological order. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 15:39, 13 September 2016 (UTC)
::Sorry. --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 13:59, 26 September 2016 (UTC)

== Copying versus embedding ==

Hi, I'm new here and I'm trying not to be an asshole. However, I just noticed that this site uses its own archive of copied xkcd comics, rather than using the image URL provided for hotlinking and embedding. I can understand this website will want to have its own archive in case xkcd.org ever goes offline, but until then, why not just embed the images instead of copying?

The reason I'm asking: I just realised I hardly ever go to xkcd.org anymore ever since my browser put explainxkcd above xkcd.org. Explanations get updated, so sometimes I check back later, which rarely happens with the comics. It makes perfect sense. But if more people experience this issue, xkcd.org is getting fewer unique visitors because of it, and this could be fixed by fetching the image directly from there, while still making and storing a copy in case it is needed in the future. Thoughts, anyone? [[Special:Contributions/141.101.104.33|141.101.104.33]] 17:08, 18 October 2016 (UTC)
:So, we can't do this for every comic, like [[1190]] or other april fools comics. Also, xkcd's revenue comes from merchandise sales, not ad revenue, so I believe it's not actually negatively impacting them that we're serving the images ourselves rather than making the main site serve them for us. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 05:39, 19 October 2016 (UTC)

:Embedding images is generally known as "stealing bandwidth", since it uses resources of the original site's server (may be limited) without bringing it any actual visitors (they won't see anything else of the website, like announcements, shop, other sections, ...). Also, depending on how unique visitors are counted, "visitors" through embedding might be invisible (client's side scripts won't be loaded). So no image embedding without the original site's owner express permission. [[Special:Contributions/141.101.88.106|141.101.88.106]] 12:51, 7 February 2017 (UTC)

== Other Languages ==
Are there translations of pages anywhere. It has been mentioned that they are on subdomains of this site, or a sub-page, as Main_Page/es for spanish. I can't seem to find them there. [[User:The Muffin Man|The Muffin Man]] ([[User talk:The Muffin Man|talk]]) 14:48, 7 February 2017 (UTC)
:It's a work in progress, long delayed but I really do want to get to it eventually. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 18:58, 7 February 2017 (UTC)

== Why are there male/female symbols in some of the entries? ==

Those symbols are not in the comic, but they're in the table. I think a vandal put them there. Can someone remove them from the Lavaball, Bladeball, Eggspotting, Merfishing, Consequence Golf and Heck Escape? (now don't act like someone who criticizes "politically correct leftist "libt++d" SJW snowflakes" just because I said "heck" or censored the derogatory term for "liberal" or not even trying to say these uncensored) -- [[Special:Contributions/108.162.221.106|108.162.221.106]] 12:36, 25 November 2017 (UTC)

== How quaint ==

From the Main Page:

Explain xkcd: '''It's 'cause you're dumb.'''

From the Rules section:

'''Don't be a jerk. '''

(Emphasis mine)

How very ,very quaint. --[[Special:Contributions/162.158.126.100|162.158.126.100]] 21:00, 5 December 2017 (UTC)

== HTTPS? ==

Hi,
With the general trend towards HTTPS being favoured over HTTP for security and speed reasons, would it be possible to force the use of HTTPS and secure the mixed content please?

Please see [https://www.whynopadlock.com/results/7e707bfd-cd71-4b00-b95e-be226fb10fb6 Why no Padlock?] for more details.

Thanks,
[[Special:Contributions/162.158.179.202|162.158.179.202]] 10:32, 13 January 2018 (UTC)

:Browsing using HTTPS seems to just work. There's even a signed certificate.
:https://www.explainxkcd.com/wiki/index.php/1946

:I really don't get why people are so convinced that browsing using HTTPS is so much more "secure". You even seem to claim that it's faster?
:If you love it so much, install a browser extension like https://www.eff.org/https-everywhere.

:With the exception of the login / register page, I really don't see the point for enforcing this for the whole site. I am no admin though.
[[Special:Contributions/172.69.54.93|172.69.54.93]] 22:30, 25 January 2018 (UTC)

We are already in 2018 and this website still does not even redirect automatically to HTTPS ([https://support.cloudflare.com/hc/en-us/articles/200170536-How-do-I-redirect-all-visitors-to-HTTPS-SSL- you can do it so easily with Cloudflare...]) nor enforce HTTPS with {{w|HSTS}}... I don't know, just check [https://scotthelme.co.uk/hardening-your-http-response-headers/#strict-transport-security on Scott Helme's site] why it's important. Having to rely on the user installing an extension for doing the sysadmin work is a bad joke, really. And it does not fix some issues with mixed content of course. With Let's Encrypt and Cloudflare providing certificates for free and the plethora of tutorials online on securing a website (not limited to HTTPS), there is no excuse to not do it. -- [[User:guest|guest]] ([[User talk:guest|talk]]) 11:22, 31 January 2018 (UTC)

== "It's 'cause you're dumb" ==
I see that there was some talk about this a while ago, in which people seemed to agree that the "It's 'cause you're dumb" tagline is unnecessarily mean and should be changed... and yet, it's still here. I'd like to add some more fuel to the fire with several reasons why I really hate this tagline:

* The tagline doesn't fit the tone of XKCD. Randall celebrates knowledge. Even Black Hat wouldn't just outright say "You're dumb", because he's a classhole who can insult way better than that.
* Many of the people who contribute to this wiki are very smart. They're not dumb.
* They're also quite amicable from what I've seen. If they wouldn't insult someone, why is the website doing so?
* Not knowing something is not the same as being dumb. Even the smartest people don't know everything.
* Having a desire to learn is smart, not dumb.
* The tagline's logic is flawed. Just because you learn a new thing, doesn't mean you were dumb to begin with.

Anyone with me on this?

[[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 14:07, 20 February 2018 (UTC)

: The first line of the "Rules" section is "Don't be a jerk" at the time of writing. The first thing this wobsite does is to break that rule. I'm not sure what else is to be said here. --[[Special:Contributions/162.158.126.76|162.158.126.76]] 16:55, 20 March 2018 (UTC)

:I always thought that was weird too. But it's still there... I'll tell the admins about it, and hopefully it will be changed. [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 13:18, 18 April 2018 (UTC)

Explanation: ''This'' is a joke... Missing the punchline? --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 15:15, 18 April 2018 (UTC)

Personally, I'm fine with the current tagline. I consider it a joke and don't feel offended. However, if there is consensus a) that and b) to what it should be changed, I'm ok with changing it. --[[User:SlashMe|SlashMe]] ([[User talk:SlashMe|talk]]) 16:18, 18 April 2018 (UTC)

I'm wondering, would it be possible to temporarily (a week or so?) stop new ads from appearing in the sidebar and replace it with a poll concerning this issue? Right now it's just showing what appeared in the banners in [[1965: Background Apps]], and not a real ad. [[Special:Contributions/162.158.58.81|162.158.58.81]] 10:12, 19 April 2018 (UTC)
:The advertisement is used to pay the fees needed to run this site. Right now this wiki get's an upgrade but when it's done this discussion will get a proper placement here. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 13:37, 21 April 2018 (UTC)

The first time I encountered this tagline I thought it was pretty funny. Satire can be hard to detect online but this one seems clear enough. --[[User:DKMell|DKMell]] ([[User talk:DKMell|talk]]) 20:42, 20 August 2018 (UTC)
:What is it satirizing? I'm serious; I genuinely don't know. It could well be that I just don't get the joke. [[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 13:39, 10 January 2019 (UTC)

At first I liked the joke, but now it's either annoying or I ignore it. Personally I don't feel it needs to be changed, as it's in the satirical spirit of xkcd, but I wouldn't care too much. [[User:Nyx goddess|Nyx goddess]] ([[User talk:Nyx goddess|talk]]) 22:56, 5 December 2018 (UTC)

It's satire, if it gets removed that's exactly the kind of overzealous political correctness that MAGA chuds are talking about when they accuse us of being snowflakes, howabout let's not give them ammo. - 02:03, 22 December 2018 (UTC) {{unsigned ip|162.158.63.94}}
:As above: what it is satirizing? Also, for my part, it's not about political correctness at all; it's that the tagline doesn't match my personal positive image of XKCD, nor of this wiki, and it just feels unfitting to me, for all the reasons that I laid out. [[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 13:39, 10 January 2019 (UTC)

I'm in favor of a change. Let's drop the "dumb". Or at least modify it. I propose a "strikethrough" of dumb, then add any one of a list of possible words: confused, ignorant, curious, wondering, befuddled... (Oooh, could it randomly change each time the page is loaded? Code wizards, advance!) [[User:Imperpay|Imperpay]] ([[User talk:Imperpay|talk]]) 22:25, 24 January 2019 (UTC)
:A complete list of all synonyms of dumb, including dumb and all synonyms of those synonyms, according to thesaurus.com. One randomly loads each time you load the page via rng, or on a once a day system, like the incomplete page of the day. That would actually probably make it more mean on average, but more clearly a joke. Wouldn’t be impossible to code either.[[User:Netherin5|Netherin5]] ([[User talk:Netherin5|talk]]) 15:18, 21 February 2019 (UTC)

The reason I come to Explain XKCD is because I'm excited to see what other people have said about it. I agree with the above - it doesn't fit the spirit of xkcd's joy for knowledge and it really just isn't why people come here. Furthermore, it skirts demeaning people with disabilities. Please remove it. [[User:Jachra|Jachra]] ([[User talk:Jachra|talk]]) 07:43, 2 July 2019 (UTC)

I also agree with Hawthorn. This tagline always was very strange for me. No, this is nothing about political correctness. I don't mind being insulted, if there is a joke, or something ironical or satirical behind it. But there just isn't. It's just not funny at all.
A random selection on every page load from a long list of completely absurd reasons would be more the XKCDs way. You could even try to create one or more "''It's because ...''" explanations for every comic and randomly display one out of those. 2206: "''... you don't know how to type capital numbers.''", 2205: "''... you don't assume Pi is one.''", 2204: "''... you didn't give us a moon.''", 2203: "''... there wasn't a really big meteor impact for a while.''" and so on. Pretty straight forward. The more frequent visitors of XKCD would probably even get many of the references and remember the corresponding comic. --[[Special:Contributions/162.158.91.221|162.158.91.221]] 17:39, 24 September 2019 (UTC)
:I did recently raise the issue again on the [https://www.explainxkcd.com/wiki/index.php/explain_xkcd:Community_portal/Miscellaneous#Is_the_.22It.27s_.27cause_you.27re_dumb.22_tagline_a_relic_of_the_past.3F Community Portal], explaining my case in more detail, although it seems to have garnered little interest. [[User:Hawthorn|Hawthorn]] ([[User talk:Hawthorn|talk]]) 12:13, 30 September 2019 (UTC)
:2865: "... you built a spaceship out of bricks" [[User:B for brain|B for brain]] ([[User talk:B for brain|talk]]) 12:56, 10 December 2023 (UTC)

What instead, then? It's poor form to suggest half a change; if not "it's cause you're dumb," what should the tagline be? [[Special:Contributions/173.245.52.85|173.245.52.85]] 16:37, 25 December 2019 (UTC)

There seems a pretty clear consensus to get rid of the jarring insult, with no apparent objections. Has been for years now. What do we need to do to delete it? What's the blocker, here?
"first we need a consensus on replacement" isn't an answer. It sets too high a bar for something which is trivial, and anyway replacement is a separate task which can be performed later. Deletion is step 1, so what needs to be done to perform step 1, since none of us seems to have access to do so?
Personally, I'd argue for making it publicly editable, which then magically also resolves step 2, replacement. Any tagline that stayed for any amount of time would then only remain because it was widely considered worthy by site members. --[[Special:Contributions/172.69.71.143|172.69.71.143]] 16:39, 30 September 2021 (UTC)
:I like that idea, it efficiently gets rid of the years-old issue, and any further issues would have their own discussion page, plus any change that's problematic, obscene or spam could easily be reversed. I can imagine that at first there would be many changes, but after a few weeks/ months it should stabilize itself. [[User:256.256.256.256|256.256.256.256]] ([[User talk:256.256.256.256|talk]]) 14:19, 30 November 2021 (UTC)

In my opinion it is not an issue of political correctness, or any related flavour of woke nonsense. It is much simpler. Problem is, ''"It's 'cause you're dumb"'' is extremely pretentious and high-horsed, while simultaneously having absolutely no business being so. It feels like it is said by someone who unironically refers to him/herself in third person. Someone whose professional CV includes the fact that he/she used to be a class leader in second grade of primary school. Someone who used to remind a teacher about homework that the teacher was supposed to check, but forgot. Someone who still asks his/her mom to cut the crust off his/her sandwiches. I am not offended nor insulted by this line, I am just cringing because of that line's author being too socially inept to realize that he/she is not in the place to judge and attempt insulting readers' intellectual capabilities. Understanding Munroe's poorly drawn stick figures, diatribes, and diagrams originating from his neurotic turmoil does not come with an added bonus of entering the supposed high echelons of intelligence, and certainly not comedy nor humour. Munroe's "humour" actually requires only the superficial sliver of knowledge from any given domain to understand and thus does not really come with too many prerequisites, while at the same time it succeeds in making readers feel rare and exceptional as a result of being able to understand said "humour", and makes them feel much smarter than they actually are. That's why those comics were able to find quite a large audience within their niche. It is quite smart in itself, actually: while Munroe may be poor quality comedian, he seems to be self-aware enough to realize the existence of his own shortcomings, and compensate by "bribing" his readers via appeasing their egos. In return, the readers are willing to overlook poor comedic value of virtually all Munroe's content, as long as they are being deluded to feel exceptionally intelligent and sophisticated for understanding the comics' supposedly hyperintellectual subtle references. Meanwhile, doing what this website does: insulting that audience is basically, in principle, going in the completely opposite direction to what actually made Munroe's content successful in the first place, and hence is quite self-destructive from this website's point of view. --[[Special:Contributions/172.70.242.207|172.70.242.207]] 00:20, 3 May 2022 (UTC)

Sometimes you're dumb, sometimes it's the joke that's dumb.

It's been 12.5 years now since Randall advised us to stop making fun of people who aren't in the loop: [[1053: Ten Thousand]]. For an inside joke, we could change it to "explain xkcd: now you're one of today's ten thousand." Alternatively, I propose the semi-honest/semi-self-deprecating "explain xkcd: because jokes are always funnier with an explanation." Or we could just get rid of it altogether. It's long overdue. -- [[Special:Contributions/103.111.183.139|103.111.183.139]] 19:54, 15 December 2024 (UTC)

You know what, I'm glad it's stayed through all these years. It really dosen't feel insulting really at all, and sometimes it seems quite ironic because of the obscurity of some of Randall's jokes. I vote for it to stay, as I simply do not agree with the statement that it feels insulting and it adds a bunch of personality and wryness to the wobsite that wouldn't be there otherwise. [[User:Willintendo|Willintendo]] ([[User talk:Willintendo|talk]]) 14:07, 23 April 2025 (UTC)

== Editor FAQ ==
Eventually we may need that banner at the top for something else, like the incomplete explanation spotlight, or when the wiki was being upgraded, so I think we should add the Editor FAQ in the New Here? section. [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 11:21, 2 June 2018 (UTC)
:It's a first draft and I'm just waiting to be convinced that it's NOT incomplete. And be sure I haven't written it without a plan how to present it on the proper places. Furthermore this "Sitenotice" on the top is only "dissmissable" for valid users, every visitor not logged in does see this always. Thanks for your participation and I'm grateful about any help. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 16:30, 2 June 2018 (UTC)

== Categories on Main Page ==

[[MediaWiki:Common.css]] has the following entry:
<pre>
.page-Main_Page div#catlinks ul li {
border-left: none;
position: absolute;
left: 70px;
bottom: 6px;
}
</pre>
The <code>70px</code> cause an overlap for me in Firefox, and much too small a gap in Chrome. I suggest to actually remove that line completely, just compare it with categories on other pages: The gap is quite large. In Firefox, also the <code>6px</code> are too much, but in Chrome they are required. But it might be worth to try whether setting vertical align to something else can achieve a more consistent display. --[[Special:Contributions/162.158.88.230|162.158.88.230]] 10:22, 13 July 2018 (UTC)
:And the comment above that says: "Dirty hack to hide the categories of the current comic from main page. ...". I'm aware of this but there is much more, especially for a mobile version I'm looking forward to. Only in this case I see three problems: The component is rendered as a list (ul,li) by hiding the bullets. This then empty space is always rendered different in different browsers. Using "position: absolute" tries to circumvent this but absolute positioning is bad layout and never should be used. Furthermore mixing the units ''px'' and ''em'' in many places is also a problem when comparing it at different browsers. I'm working on this with the final goal also having a proper mobile version, not only for Firefox, Chrome, Edge,... on a desktop. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 12:12, 13 July 2018 (UTC)

== Bookmark ==

I think we should add this book mark I made to automatically transfer anything from xkcd to its explainxkcd page (I was frustrated, ok?):

javascript:x=window.location.href;x = x.replace(/\D/g,'');t=document.title.substring(5).replace(/ /g,"_");window.location.href="https://www.explainxkcd.com/wiki/index.php/"+x+":"+t;

I know the code could be more compact, but using this, you can just press a button and it will take you to the explain page {{unsigned ip|172.68.47.84}}
:Just changing the URL from <code>xkcd.com/2115/</code> to <code>explainxkcd.com/2115/</code> (putting the word explain to the beginning) does the same. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 16:41, 22 February 2019 (UTC)
:Collecting these [[Browser helpers|here]]. – [[User:Yfmcpxpj|Yfmcpxpj]] ([[User talk:Yfmcpxpj|talk]]) 04:48, 13 October 2020 (UTC)

== Non-comic explanations? ==

So I was looking at xkcd and I noticed a little jokey line near the bottom of the page in very small print that reads <pre> <nowiki> "xkcd.com is best viewed with Netscape Navigator 4.0 or below on a Pentium 3±1 emulated in Javascript on an Apple IIGS at a screen resolution of 1024x1. Please enable your ad blockers, disable high-heat drying, and remove your device from Airplane Mode and set it to Boat Mode. For security reasons, please leave caps lock on while browsing." </nowiki> </pre>
Now, I know enough to understand the joke, but it would be nice to have a page for this. Do we have one? Am I just blind? Either way, I would like to know. Thanks! [[User:Nyx goddess|Nyx goddess]] ([[User talk:Nyx goddess|talk]]) 23:39, 28 March 2019 (UTC)
:Nevermind, I just found it. Sorry! [[User:Nyx goddess|Nyx goddess]] ([[User talk:Nyx goddess|talk]]) 23:40, 28 March 2019 (UTC)
::Where? [[User:B_for_brain|B for brain]] ([[User_talk:B_for_brain|talk]]) ([https://www.youtube.com/channel/UCg4bo-hj-mDyOOUp_Yp0pug youtube channel] [https://bforbrain.weebly.com/ wobsite (supposed to be a blag)] 21:47, 12 December 2023 (UTC)
:::Whether or not it's the only place, you'll see this dealt with in the current [[Footnote]] page. [[Special:Contributions/172.70.86.6|172.70.86.6]] 00:37, 13 December 2023 (UTC)

== Latest comic released. ==

I don't know where to post this, but the bots haven't created the page yet.
[[User:HelloWorld|HelloWorld]] ([[User talk:HelloWorld|talk]]) 19:24, 4 April 2020 (UTC)

: Probably infected by COVID-19. That's why you should wash your keyboards after visiting other websites. Until then, feel free to create the page manually (if possible). --[[Special:Contributions/108.162.242.19|108.162.242.19]] 21:07, 4 April 2020 (UTC)

== Minor edit proposal ==

Line 19 of the main page includes this sentence:
<pre>Many of the recent contributors, listed above, have [http://www.explainxkcd.com/wiki/index.php?title=Special%3AContributions&contribs=newbie just joined].</pre>
That right there is not a wikilink. Could we change it to:
<pre>Many of the recent contributors, listed above, have [{{fullurl:Special:Contributions|contribs=newbie}} just joined].</pre>
Both render as follows:
{|class="wikitable"
|Many of the recent contributors, listed above, have [{{fullurl:Special:Contributions|contribs=newbie}} just joined].
|}
And I think my way is cleaner. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 14:52, 9 April 2020 (UTC)
:Done --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 15:04, 7 February 2025 (UTC)

==1000: 1000 Comics/1000 characters update==
I've completed the blank explanations for all the remaining characters in [[1000: 1000 Comics/1000 characters]]; however, it could really use some work in terms of verification. I offer the sweet incentive of being able to get rid of a page's 'incomplete' label as reward for people to double check my, and [[User:Kynde|Kynde's]] work on the project. [[User:BlackHat|Your favourite sociopath]] ([[User talk:BlackHat|(the one who leaves all the parentheses open]] 07:58, 25 October 2020 (UTC

==2021-02 updates to top of page==
I don't really like the changed first few lines - I think it takes up too much room and the previous info was better. I look at the main page daily, and want to see the comic and explination not all this stuff that I think would be better down below the daily comic display. [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 17:50, 5 February 2021 (UTC)

: I agree, and it drives me crazy that {{tl|Welcome}} is designed for talk pages, so there is a red link to [[User:Main Page]]! [[Special:Contributions/172.68.142.213|172.68.142.213]] 15:22, 6 February 2021 (UTC)

: Since Jeff is much more involved in all this sort of stuff than myself, I would tend to defer to his judgement, but I also agree that the "Main Page" red link is pretty ugly. I will "be bold" and revert the change and then drop it if he really wants it. [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 18:54, 6 February 2021 (UTC)
::I guess I cannot revert things as there are no "edit" buttons I can view for the Main Page [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 19:01, 6 February 2021 (UTC)
:::You need administrator privileges to edit the main page. This was done to reduce spam, which is basically non-existent now. I made the {{tl|Welcome}} template, and I certainly did not make it for it to be displayed in the main page! I made it to welcome new users to the site. — [[User:Sqrt-1|The 𝗦𝗾𝗿𝘁-𝟭]] [[User talk:Sqrt-1|talk]] [[Special:Contributions/Sqrt-1|stalk]] 13:16, 8 February 2021 (UTC)
::::I see on [User:Jeff|Jeff]]'s talk page that Sqrt-1 has made a comment about this so maybe it will be taken care of. I am guessing that some automatic bot-like thing might have made an error. Today I got the {{tl|Welcome}} template added to my user page by Sqrt-1. It does seem like a useful template for user pages - less so for the Main page. [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 13:28, 8 February 2021 (UTC)
:It looks like [[User:Jeff|Jeff]] has reverted it - Thanks! [[User:J-beda|J-beda]] ([[User talk:J-beda|talk]]) 11:51, 12 February 2021 (UTC)

== Overuse/misuse of incomplete template ==

Instead of having information on why the comic is incomplete or being removed once the explanation is finished, the incomplete template is being treated as a place to put witty comments. This overcrowds the category, making it more difficult to see articles in need of actual help or know why they need help. I have gone through the incomplete articles and posted new topics on ones with incomplete tags that do not provide information on why the template is there, asking to know why the comic is incomplete and, failing that, to have the template removed. For the full details, please see [[User:Quillathe_Siannodel|my user page]].

I would like to request that either a less obtrusive solution or compromise be found or the error of my (relatively new user) ways be explained to me by someone more experienced.

Sincerely, <s>[[406:_Venting|Summer Glau]]</s> [[User talk:Quillathe Siannodel|{)|(}]][[User:Quillathe_Siannodel|Quill]][[User talk:Quillathe Siannodel|{)|(}]]

P.S. Maybe an "incomplete incomplete template" template? I don't know.

P.P.S. I can kill you with my brain.

I don't know. I re-signed and edited so many times, March 2021 (UTC)
: In some cases, the "incomplete" tag is left on for a long time, when nobody takes the trouble to remove it from a page that has migrated out of people's attention. Sometimes, people remove it inappropriately, while a page is still actively under revision. In many cases, it's hard for anyone to say what's "incomplete" about a page because there's relevant stuff to add that isn't obvious until someone adds it. The question is more: at what point can a page be reasonably assumed to be "complete"? A week after the most recent edit to it? Some pages undergo revision for quite a while after they're first posted; other pages remain stable after only a few days. It annoys me when someone edits a page and removes its "incomplete" tag at the same time, which gives me the impression of "now that I have made my change, the page is in its final form, and nobody else should touch it!" [[User:BunsenH|BunsenH]] ([[User talk:BunsenH|talk]]) 22:55, 6 April 2021 (UTC)
::Proposal: The default text of the incomplete template could be modified to include <code><nowiki>[[Category: Incomplete Incomplete (or something similar)]]</nowiki></code>. If the text is modified, the page should be removed from the category. This new category would be easily accessible from the main page, and anyone visiting it should see information about the category's meaning and how to help make said templates more informative. Possible ways to go about this:
::* Line 315 of the bot script would be changed to read: <code><nowiki>{{incomplete|Created by a BOT - Please change this comment when editing this page. Do NOT delete this tag too soon.[[Category: Whatever The Name Ends Up Being]]}}</nowiki></code>.
::* The main page banner would be changed to read: <code><nowiki>''Welcome to the '''explain [[xkcd]]''' wiki!'' 
We have an explanation for all [[:Category:All comics|'''{{#expr:{{PAGESINCAT:All comics|R}}-1}}''' xkcd comics]],

and only {{PAGESINCAT:Incomplete explanations|R}}
({{#expr: {{PAGESINCAT:Incomplete explanations|R}} / {{LATESTCOMIC}} * 100 round 0}}%) [[:Category:Incomplete explanations|are incomplete]]. Help us finish them! If you're looking for something easier, you could also edit one of the {{PAGESINCAT:Whatever The Name Ends Up Being|R}} pages with [[:Category:Whatever The Name Ends Up Being|incomplete explanations]], which would help other editors.</nowiki></code>.

::* The new category would read: <code><nowiki>This is the category page for incomplete pages that have no explanation for why they are incomplete in the incomplete tag. Do not add pages to this category. See also: [[:Category:Incomplete pages]] and [[:Category:Incomplete transcripts]]</nowiki></code>.
::I will not do this without first seeking community approval, because these are huge edits that could majorly change the wiki. Is this a good idea? [[User talk:Quillathe Siannodel|{)|(}]][[User:Quillathe_Siannodel|Quill]][[Special:Contributions/Quillathe_Siannodel|{)|(}]]
::: Feels a great idea. Given the dearth of opinion ventured either way, and given you've given plenty of time for people to declare an opinion, I'd argue to be bold, do it, and see if people squeal. It can always be reverted if required. --[[Special:Contributions/172.70.178.161|172.70.178.161]] 17:02, 9 November 2021 (UTC)

== Add another digit to percentage incomplete count ==

With the large majority of comics gaining explanations, I suggest that the current expression be adjusted to the following, changing "round 0" to "round 1":

<pre>({{#expr: {{PAGESINCAT:Incomplete explanations|R}} / {{LATESTCOMIC}} * 100 round 1}}%)</pre>

Resulting in: ({{#expr: {{PAGESINCAT:Incomplete explanations|R}} / {{LATESTCOMIC}} * 100 round 1}}%)
[[User:Gamma|Gamma]] ([[User talk:Gamma|talk]])
:Done --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 15:04, 7 February 2025 (UTC)

== Problems creating account ==

I just attempted to create an account, and got the following message:
There are problems with some of your input.

I made an adjustment to the password (which seemed to be the problem), consisting of making one of the letters of my original attempt a capital. This didn't work.

There is no point telling me there are problems with my input and not telling me what the problems are. I can't read your mind at this distance.

Cheers
Copey.


== add non-numbered comics ==

idea: for the "We have an explanation for all [number] xkcd comics..." make the number include the non-numbered comics like five minute comics part 4, Syndication, Blue Eyes, and that one book-publishing-rate one. what do you guys think? [[Special:Contributions/108.162.221.93|108.162.221.93]] 17:52, 22 October 2021 (UTC)Bumpf

:Good point, also as of right now even only including the numbered comics it's not up-to-date, as the newest comic is 2555 and it says "We have an explanation for all 2554 xkcd comics" -- [[User:256 256.256.256|256.256.256.256]] ([[User talk:256 256.256.256|talk]]) 09:38, 16 December 2021 (UTC)

:: That is likely due to:
<nowiki></nowiki>
:: -- [[Special:Contributions/108.162.237.65|108.162.237.65]] 17:21, 21 February 2022 (UTC)
::: Can we remove that? Randall catagorises it as a comic. So we should too. [[User:B_for_brain|B for brain]] ([[User_talk:B_for_brain|talk]]) ([https://www.youtube.com/channel/UCg4bo-hj-mDyOOUp_Yp0pug youtube channel] [https://bforbrain.weebly.com/ wobsite (supposed to be a blag)]) 14:27, 14 August 2024 (UTC)

== fix these articles please! ==

What If chapters should be a redirect, not a mirror of [[What If? chapters]] ! [[Special:Contributions/172.69.71.10|172.69.71.10]] 17:38, 19 November 2021 (UTC)Bumpf
:Done. — [[User:Sqrt-1|The 𝗦𝗾𝗿𝘁-𝟭]] [[User talk:Sqrt-1|talk]] [[Special:Contributions/Sqrt-1|stalk]] 07:00, 28 November 2021 (UTC)
::The redirect page now deleted --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:10, 23 May 2022 (UTC)


== Top 10 includes no more than 9 people? ==

[[File:Top_10_but_it's_just_nine.png]]

have only nine users edited in the past seven days (unlikely) or does that top ten list really show no more than nine users? [[User:256.256.256.256|256.256.256.256]] ([[User talk:256.256.256.256|talk]]) 09:13, 6 January 2022 (UTC)
:My guess is that it is because currently place 10 and 11 have a tie with a score of 4 due to 3 edits on 2 pages and the top 10 table can show a maximum of 10 entries and cannot "decide" which one to show as no 10.
:You can view the full list by clicking the "lots of people" below the table. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 13:19, 6 January 2022 (UTC)

::That would make sense, except right now it alternates between ElijaRock and Asdf who both have two edits, two points and two unique pages edited, and pure chance seems to decide which one of the two gets 10th place every time I hit F5 [[User:256.256.256.256|256.256.256.256]] ([[User talk:256.256.256.256|talk]]) 14:31, 12 January 2022 (UTC)
:::PS: The actual 10th place right now is neither Asdf nor ElijaRock, it´s Jack (or at least it should be and sometimes, when the wind is blowing in the right direction, it even is) [[User:256.256.256.256|256.256.256.256]] ([[User talk:256.256.256.256|talk]]) 14:34, 12 January 2022 (UTC)

... maybe it's because everyone else is dumb... ^_^ [[User:20040302|20040302]] ([[User talk:20040302|talk]])

== Countdown Timer? ==

What’s the timer at the top right of the xkcd site counting down to? Apologies if there’s already a page on this; I didn’t look very hard :P {{unsigned|Szeth Pancakes|01:37, 11 January 2022}}
:See https://www.explainxkcd.com/wiki/index.php/Talk:2566:_Decorative_Constants -- [[Special:Contributions/172.70.114.39|172.70.114.39]] 02:17, 11 January 2022 (UTC)
:Now here: https://www.explainxkcd.com/wiki/index.php/Countdown_in_header_text. -- {{unsigned ip|172.70.230.57|02:31, 13 January 2022}}

== Set up X-Forwarded-For for correct IP address reporting ==

(I already posted this on David's talk, but I noticed he's no longer active... Hopefully an admin will read this here) This should be done server-side, as right now (and for a very long time) it's been reporting load balancer / cache IP addresses for all the users. With recent vandalism, it'd help. [[User:BytEfLUSh|BytEfLUSh]] ([[User talk:BytEfLUSh|talk]]) 22:27, 29 April 2022 (UTC)

== It says "all 2626 xkcd comics"?? ==

so i get that there are one less than the category, so it should be 2627 (at the time of writing, [[2628]] is the most recent) right? where is the extra one being removed from?[[Special:Contributions/162.158.78.33|162.158.78.33]] 21:05, 6 June 2022 (UTC)Bumpf
:Backend counting error that'll be refreshed when whichever page is missing from the count is updated '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 06:39, 7 June 2022 (UTC)
:: Still not fixed. [[User:GcGYSF(asterisk)P(vertical line)e|GcGYSF(asterisk)P(vertical line)e]] ([[User talk:GcGYSF(asterisk)P(vertical line)e|talk]]) 23:32, 30 June 2022 (UTC)

== wait what ==

category:google doesn't exist yet, it links to its preview, but edit box is empty.
:can you fix the issue? thx [[User:An user who has no account yet|An user who has no account yet]] ([[User talk:An user who has no account yet|talk]]) 16:07, 14 September 2023 (UTC)

== How Long the Bot Takes to Update When New Comics are Released ==

I was wondering how long it takes the bot to scrape new comics from https://xkcd.com.
This is the second time I've seen a brand new comic appear there and it bugs me knowing that the explaination page is yet to be made.
I know it's a silly thing so I feel like maybe, if I know how long the bot takes to update the comic list then I might be able to bring myself to wait.
Thanks, --[[User:OmniDoom|OmniDoom]] ([[User talk:OmniDoom|talk]]) 03:55, 19 October 2023 (UTC)

==Escape speed is no longer incomplete==
Can someone delete the text at the top that says ''"We still need to complete some explanations like this one: [[2765: Escape Speed]]. All incomplete explanations are here."''? Escape speed is no longer incomplete, so that is wrong. [[User:B_for_brain|B for brain]] ([[User_talk:B_for_brain|talk]]) ([https://www.youtube.com/channel/UCg4bo-hj-mDyOOUp_Yp0pug youtube channel] [https://bforbrain.weebly.com/ wobsite (supposed to be a blag)] 20:30, 19 December 2023 (UTC)
:I'm also going to raise the question on the community portal. [[User:B_for_brain|B for brain]] ([[User_talk:B_for_brain|talk]]) ([https://www.youtube.com/channel/UCg4bo-hj-mDyOOUp_Yp0pug youtube channel] [https://bforbrain.weebly.com/ wobsite (supposed to be a blag)] 11:59, 27 December 2023 (UTC)

== Is the "incomplete explanations" listing still necessary? ==

The "Incomplete explanations" category used to be used for a lot of past comics that didn't have their explanations fully filled in, and the front page has encouraged people to help out with finishing those past comics. However, as of now, the only explanations marked incomplete are the three most recent comics; the last long-standing "incomplete" label I'm aware of was on [[1547: Solar System Questions]], and [https://www.explainxkcd.com/wiki/index.php?title=1547:_Solar_System_Questions&diff=prev&oldid=337545 its incomplete tag was removed about a week ago]. If going forward the only incomplete explanations will be the few most recent ones, it might make sense to finally remove the "incomplete explanations" banner and most of the mentions from the front page. Essentially like taking the beta labels off.

We don't "''need''" "explanations for comics, characters, themes and everything in between" anymore; we ''have'' those explanations. We have explanations for all 2910 xkcd comics; we don't need to say the latest three are incomplete. I'd assume the fact that this is a wiki would still imply contributions are encouraged (and we could keep the incomplete label on the newest comics, as well as the link to the incomplete category in the "New here?" section).

The only main thing I could see against this is when particularly detailed comics come out. For example, April 1 is a week away, and those comics are usually pretty big, so that might still warrant a banner asking for people to fill in the explanations. [[User:JBYoshi|JBYoshi]] ([[User talk:JBYoshi|talk]]) 21:11, 24 March 2024 (UTC)

Agreed, I was just about to ask the same thing. We could replace the banner with a generic call to action linking to the list of incomplete explanations, but certainly I would say it should not call out [[1547: Solar System Questions]] specifically, because it's not actually incomplete anymore. [[User:Raxod502|Raxod502]] ([[User talk:Raxod502|talk]]) 22:13, 30 May 2024 (UTC)

== What in the world is going on? ==

See title. [[User:DeemDeem52|DeemDeem52]] ([[User talk:DeemDeem52|talk]]) 15:45, 11 April 2024 (UTC)

== Main Page Deleted ==

The Main Page was deleted at 15:39 by Markhurd. I thought he had passed? Posted an Admin Request to undo this action. Perhaps the account was hacked? [[User:42.book.addict|42.book.addict]] ([[User talk:42.book.addict|talk]]) 15:47, 11 April 2024 (UTC)
: why would they delete the main page--[[Special:Contributions/172.69.43.222|172.69.43.222]] 16:20, 11 April 2024 (UTC)
:: https://en.wikipedia.org/wiki/Wikipedia:Don't_delete_the_main_page --[[Special:Contributions/172.70.211.233|172.70.211.233]] 11:59, 23 April 2024 (UTC)

== Petition to add comic #404 into equation ==

In the equation at the top of the main page, there is a -1 to discount comic #404, because it's "not really a comic". But it is a comic, even randall calls it that. So, can we add it back in? [[User:B_for_brain|B for brain]] ([[User_talk:B_for_brain|talk]]) ([https://www.youtube.com/channel/UCg4bo-hj-mDyOOUp_Yp0pug youtube channel] [https://bforbrain.weebly.com/ wobsite (supposed to be a blag)]) 10:32, 24 July 2024 (UTC)

== Create my user page ==
User:Hipdict suggested entries
Explain xkcd: It's 'cause you're dumb.
There is currently no text in this page. You can search for this page title in other pages, or search the related logs, but you do not have permission to create this page. ???? I want to have my page set up for entry suggestions for hipdict. Got banned from twitter and wikipedia for illicit nationality. Don't ban me. [[User:Hipdict suggested entries|Hipdict suggested entries]] ([[User talk:Hipdict suggested entries|talk]]) 10:13, 26 August 2024 (UTC)
:You're not banned, you've just not yet passed the (astoundingly low) level of interactions that the site asks of you before you get to do more than (the already quite 'dangerous') editing of existing pages.
:But...
:#I have no idea how what you want to do is related to xkcd (and explaining it),
:#If you get banned from ''Twitter'' (as in 'X', these days, under the notoriously "Hey, anyone can say anything, even if it's totally wrong or defaatory!" attitude of Elon Musk) then you're clearly doing something wrong. Forgive me if I consider this an issue that is improbable (or improbable to be trivial).
:Now, I can't create User Pages (I have marginally less influence than you), but ''my'' instinct is that you really haven't proven why someone should help you out here. Even before we start to actively doubt whether someone should. If you're serious, bide your time and just contribute (...sensibly!) and... ...one day you ''shall'' go to the ball, Cinderella! (Not that I have any say in this, but I felt that I should at least comment.) [[Special:Contributions/172.69.79.138|172.69.79.138]] 17:15, 26 August 2024 (UTC)
:If you check [[explain_xkcd:Editor_FAQ#Why_can.27t_I_upload_pictures_or_create_pages.3F|This part of The Editor FAQ]], you'll have a good idea on why. [[User:B for brain|B for brain]] ([[User talk:B for brain|talk]]) 08:55, 7 September 2024 (UTC)
::Total edits by [[User:Hipdict suggested entries]], to date: one. The above edit. I could probably have predicted that, before any further discussion ensued. But it's ''only'' been a couple of weeks. [[Special:Contributions/172.68.205.179|172.68.205.179]] 09:49, 7 September 2024 (UTC)

:: Hey, I'm having the same issue. What exactly is the number of edits I must make before I can edit my own page? [[User:DollarStoreBa'al|DollarStoreBa'al]] ([[User talk:DollarStoreBa'al|talk]]) 17:13, 25 February 2025 (UTC)
:::I created it for you! You can now edit it. --[[User:FaviFake|FaviFake]] ([[User talk:FaviFake|talk]]) 17:31, 25 February 2025 (UTC)
::: The actual requirements are [[explain_xkcd:Autoconfirmed_users|here]] [[User:Firestar233|guess who]] ([[User talk:Firestar233|if you desire conversing]] | [[Special:Contributions/Firestar233|what i have done]]) 19:34, 25 February 2025 (UTC)

== Subtle trolling? ==

I get the impression that over the past months, someone has been intentionally trying to make good explanations more pedantic and far more convoluted than they should be, undermining the basic goal of explaining the comics to those who don't understand them, and requiring in-depth knowlege of the subject matter to even begin to understand our explanations. Does anyone else have that impression? [[Special:Contributions/162.158.186.33|162.158.186.33]] 17:41, 26 September 2024 (UTC)
:As a long time reader (and tweaker), I'm not sure I've seen anything particularly like that. Unless it's ''me'' who you're seeing (but then I've not so recently ramped up, and certainly not intentionally more so).
:One person's pedantry is another's [[386: Duty Calls|making sure it's not wrong]], of course. Although I'm more likely to leave it it with good basic links (to avoid the need for prior in-depth prior knowledge), such as when I added a bit that linked to a thermostat's use of the bimetal coil in a recent one (which has now been edited out, courtesy of the supposedly explanatory AI version being splurged over all of it) in case someone ''didn't'' even know what this style of control normally did. Yes, mildly convoluted, but not leaving anybody wondering (if they cared to follow the link).
:What I think is a bad Explanation is one that cold opens with the very first paragraph being something like "The humour of this comic is due to the impracticality of using a Heisenfram terminal to access the upper five bilateral kelilactirals of your typical starship's FTL nanoprocessor", without leading into that sort of thing by introducing the context. (In that case, it would be ST:TNG's episode ''Rascals'', by the way.) Several times recently, I've been writing a lead-in paragraph so that the (original) first paragraph doesn't just hit the unwary reader in the face.
:That adds length, yes, but is surely for a good reason. Similarly I've moved subclauses (or parenethesised text) out of the sentence that has obviously had several points inserted within by several editors. Tried to make the flow work better. And, I would hope, reduces convolution.
:So... I'm no sure if I'm the cause of what you're suggesting, or am I the ''cure'' for it? Maybe a bit of both. But every editor has their own thresholds and ideas. I think the problem is when everyone tweaks things their way (inherent in the whole wiki-documenting process) and it comes out a bit spaghetti-ish. Satisfying nobody. Neither the simplifiers nor those who desire comprehensiveness. It's always going to be a possible problem! [[Special:Contributions/172.70.162.220|172.70.162.220]] 19:24, 26 September 2024 (UTC)

::I looked at the history of [[2989: Physics Lab Thermostat]], and I think you may be letting yourself go wild a little. I wikilinked the first use of the term "thermostat" there. People can look there if they want to learn how they ordinarily work. But these are things most people use every day. Shoving a bimetal strip in their face before they've gotten to any actual explanation of the comic is going to make them lose interest. [[Special:Contributions/172.70.207.183|172.70.207.183]] 09:06, 1 October 2024 (UTC)
:::If that was ''my'' edit, that sparked that, I remember shoving the bimetal coil in their face only ''part way down the explanation'', when it seemed to actually made narrative sense to let the reader go into the detail (if they wanted to) about bow this kind of thermostat might (normally) work. (Then someone went and wiped it all out for something else, and I noted even the basic lack of link to 'Thermostat' but... well, editing opinions were still being banded around so I let everyone get on with it...) Always improving, of course. Except when it's completely ruined by someone else who thinks they're improving things. ;) [[Special:Contributions/172.68.205.151|172.68.205.151]] 12:16, 1 October 2024 (UTC)

:{{w|Hanlon's razor}}. "So fix it." [[Special:Contributions/172.71.147.222|172.71.147.222]] 09:00, 1 October 2024 (UTC)

== Vsbattles wiki pages ==
[https://vsbattles.fandom.com/wiki/Category:Xkcd There's Vsbattles Wiki profiles about XKCD]. Are they accurate? --[[Special:Contributions/172.68.183.65|172.68.183.65]] 19:41, 10 January 2025 (UTC)
* Though sincerely, the fact what [https://vsbattles.fandom.com/wiki/Black_Hat_(xkcd) Black Hat] has [https://vsbattles.com/threads/10-a-9-c-with-weapons-tournament-round-1-match-8-black-hat-vs-aahw.133928/ managed to loose] to [https://vsbattles.fandom.com/wiki/Agency_Against_Hank_Wimbleton#Grunt Madness Combat Grunts] is strange. After all, Black Hat could just fly upwards and use ranged attacks (ranged weapons, crossbow, random words, lightning, head-cannon, etc). Besides, they forgot to add blowtorch, circular saw, crossbow, head-cannon and other things to the profile (at least as "Optimal Equipment"). --[[Special:Contributions/172.68.182.238|172.68.182.238]] 20:08, 10 January 2025 (UTC)
** About hypothetical rematch: Everything higher than 9-C was restricted - so, blowtorch and other things are for match with someone else. Black Hat and AAHW Grunts have roughly same speed ("Athletic Human"). Therefore, in the time AAHW Grunt can move 10 meters forwards, Black Hat can fly 10 meters upwards. If he moves upwards, he can bombard AAHW Grunts with variety of ranged attacks - eventually winning. AAHW Grunts can move faster in short bursts - but they can't cover 10 meters in said burst. Therefore, Black Hat should be able to defeat melee AAHW Grunts. AAHW Grunts with guns, on the other hand, would instantly shoot Black Hat down - as he has seemingly no means to deflect or block bullets. --[[Special:Contributions/172.68.182.238|172.68.182.238]] 20:19, 10 January 2025 (UTC)
* And submarine ''could'' be instead put to "Optimal Equipment". After all, who would take a submarine to Colosseum? --[[Special:Contributions/172.68.182.239|172.68.182.239]] 20:09, 10 January 2025 (UTC)
* In case of match with someone else - Black Hat had [[496: Secretary: Part 3|fokker, nuclear submarine, and death ray capable of vaporizing human]] (what is [https://vsbattles.fandom.com/wiki/References_for_Common_Feats#Vaporization_Feats "Small Building Level"]). --[[Special:Contributions/172.71.98.145|172.71.98.145]] 20:33, 10 January 2025 (UTC)

== Removing the Twitter link ==
Do y'all think it might be time to take down the twitter page and remove the link from this website? Considering recent events, it might be wise to disassociate from that platform and its nazi owner. Agree? [[User:Beret|Beret]] ([[User talk:Beret|talk]]) 07:44, 30 January 2025 (UTC)
:Caveat: I don't myself have a twitter account (nor reddit, instagram, mastadon, discord, facebook, geocities or... as you'll see... even here), and I ''used'' to lurk on tweet-threads (from those I was interested in, and/or to see what others were respinding about them), until they made the interface lurker-unfriendly. I have no doubt that twitter (or X, or xwitter/twix, whatever we should call it now) is now as much a wretched hive of scum and villainy as anywhere else I listed, perhaps still better than TruthSocial, and hopefully more than 4chan can be (depending on if you avoid /pol/, I suppose).
:The question is, does it help to not have Twitter/X/whatever? Is Randall still using it? (Genuine question... as an ex-lurker who now can't easily lurk, I don't know either way.) Are we either at risk of violating the current nebulous UA of the platform, whatever twisted version of Free Speech now applies whereby you can perhaps say anything ''except'' question the philosophical principles of its owner, or are we at risk of associating with it (which is a different think from the guy 'at the top')? Would we be enough conspicuously absent to make anyone think twice about their own presence?
:We can probably appreciate a good rocket, without having to condemn Starship on behalf of the guy who is paying for its engineers. We might even have a certain brand of electric car (I don't, as it happens but not for the above kind of reason). In the wide web of patronage, or association, I don't think that severing such a thin thread is going to do much good. But maybe whoever has the ability to actually do that may have other ideas.
:Like his 'boss', I'm not even sure he's an ''actual'' Nazi, either, just going with the pragmatic viewpoint/image that gets more vocal support. Actually being kind to people is out of fashion, "socialism is bad" as a mantra from an echo-chamber that wouldn't know actual socialism (let alone differentiate it from communism/marxism/etc) if it came up and waved a Republican-party-coloured flag in its face. Nor naziism.
:I do think you're right about the optics of their personal situations, and there's a definite slide into nazi-like policies by Elon's 'boss', but I believe the motives of both are both pure capitalism/saving their own legacies (and/or skin) in a ham-fisted and (at least in one case) neuro-atypical manner that would deserve sympathy if they hadn't grabbed so much privilege on the way there. But let's establish what alternatives there are (for those who feel the need to have such channels of communication), before throwing the baby out with the bathwater. [[Special:Contributions/172.70.91.159|172.70.91.159]] 13:05, 30 January 2025 (UTC)
::He literally did the nazi salute at the inauguration, and the whole essence of the campaign he supports has been predicated on blood libel about Haitian immigrants eating people's pets. The point is not that our single action will do something, but that the collective impact of millions of people and organizations deleting their accounts will make our grievance clear. [[User:Beret|Beret]] ([[User talk:Beret|talk]]) 21:12, 30 January 2025 (UTC)
:I think I'd be great if it's removed, but good luck finding a way to contact Jeff! He isn't even active enough to promote new admins, let alone change the site's HTML. {{unsigned|FaviFake|18:33, 30 January 2025‎ (UTC)}}
::I’ve tried to reach out to him via Twitter and email, but he hasn’t responded. Hell, I’ve even reached out to his friends about it on Bluseky and Reddit, but nobody has responded. There is nothing that we can do. Besides, can we try to keep politics out of this environment? I personally agree with your statements, but I want to try to prevent arguments breaking out, or providing trolls and vandals a target. '''[[User:42.book.addict|42.book.addict]][[User talk:42.book.addict|Talk to me!]]''' 19:03, 4 February 2025 (UTC)

== Incomplete Explanations ==

A few months ago, as I recall, there were only a few (~10-20) incomplete explanations on the site. Since that time, that number has ballooned substantially, with much of the bulk being taken up by old comics that had previously been removed from the incomplete list. Now, some of these additions are valid. However, many of them are either trivial (e.g. the precise date that a comic was uploaded) or easy enough to fix that one wonders why the person who went to the trouble of adding the incomplete tag didn't just fix the issue themself. Regardless, this creates an inaccurate impression of the amount of work that needs to be done. I propose that the incomplete tag be reserved for new comics and comics with glaring, difficult to fix issues. For trivialities (things not relevant to understanding the comic) and minor, easy to fix details, I suggest doing it yourself. Why else do you have an account here? [[User:Beret|Beret]] ([[User talk:Beret|talk]]) 04:39, 24 April 2025 (UTC)

:Hey, you're talking about me! I agree a small portion of the comics i mark as incomplete could be edited by me directly, but almost all of them require more effort, either because:
:* I don't understand something that other, more skilled people might ([https://www.explainxkcd.com/wiki/index.php?title=1393:_Timeghost&diff=prev&oldid=374706 like this edit you made.] I didn't initially understand what the 4 distinctions meant!)

:* I can't access the thing that's needed, like [[1561: Water Phase Diagram#Trivia]]. In that case you seem to have misunderstood the task: we need the original, non-edited version of the original image. For some reason, someone didn't update the OG filename and instead created a new file it seems? The image you see there is a modified version of the comic, not the oroginal.

:* I just don't have time to do things like research (e.g. [[Blue Eyes]], [[Title text]]) or repetitive tasks (like [[2288: Collector's Edition]])
:*''"many of them are either trivial (e.g. the precise date that a comic was uploaded)"''. I don't really think this is "not valid", the purpose of this wiki is to catalogue everything about xkcd, and the date a comoc is uploaded seems very important.

:* ''"Regardless, this creates an inaccurate impression of the amount of work that needs to be done."''. I'm not sure the representation is inaccurate, there are so many things left to do that one person could likely never finish them all on their own in a reasonable timeframe.

:Hope this addresses your concern! --[[User:FaviFake|FaviFake]] ([[User talk:FaviFake|talk]]) 16:24, 24 April 2025 (UTC)

== Side navigation menu ==

I'm convinced the navigation menu has changed. Didn't Latest comic used to be 2nd or 3rd down the list? I don't know if the inconsistent icons is new. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 12:19, 14 May 2025 (UTC)

Talk:Main Page

2025-05-14T12:19:19Z

Xseo: /* Side navigation menu */ new section

Talk:3076: The Roads Both Taken

2025-04-15T10:15:59Z

Xseo:

I just saw on Google's Doodle: "''...today’s Doodle shows an illustration of quantum superposition. April 14 is World Quantum Day, and this year is also the International Year of Quantum — celebrating 100 years since the discovery of quantum mechanics.''" https://blog.google/technology/research/world-quantum-day-doodle-superposition-thaumatrope/ --[[User:PRR|PRR]] ([[User talk:PRR|talk]]) 05:25, 15 April 2025 (UTC)

I think "Photon poetry" is a reference to Vogon poetry in Hitchhiker's Guide to the Galaxy (notoriously the worst poetry in the universe). [[Special:Contributions/104.23.172.2|104.23.172.2]] 07:19, 15 April 2025 (UTC)

Pretty sure the title text is a parody of a song lyric that I can't remember the original of. "When you something something something, that's something". Damn it, its on the tip of my tongue, but it isn't quite coalescing!
: When a grid's misaligned with another behind, that's a moiré! Biran4454 10:07, 15 April 2025 (UTC)]
: I think it's more likely a slightly clunky way to reach the punchline that is a twist on photon-superposition-fomo being ''phomo'' [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 10:15, 15 April 2025 (UTC)

Talk:3076: The Roads Both Taken

2025-04-15T10:15:30Z

Xseo:

I just saw on Google's Doodle: "''...today’s Doodle shows an illustration of quantum superposition. April 14 is World Quantum Day, and this year is also the International Year of Quantum — celebrating 100 years since the discovery of quantum mechanics.''" https://blog.google/technology/research/world-quantum-day-doodle-superposition-thaumatrope/ --[[User:PRR|PRR]] ([[User talk:PRR|talk]]) 05:25, 15 April 2025 (UTC)

I think "Photon poetry" is a reference to Vogon poetry in Hitchhiker's Guide to the Galaxy (notoriously the worst poetry in the universe). [[Special:Contributions/104.23.172.2|104.23.172.2]] 07:19, 15 April 2025 (UTC)

Pretty sure the title text is a parody of a song lyric that I can't remember the original of. "When you something something something, that's something". Damn it, its on the tip of my tongue, but it isn't quite coalescing!
: When a grid's misaligned with another behind, that's a moiré! Biran4454 10:07, 15 April 2025 (UTC)]
: I think it's more likely a slightly clunky way to reach the punchline that is a twist on photon-superposition-fomo being _phomo_ [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 10:15, 15 April 2025 (UTC)

Talk:2711: Optimal Bowling

2022-12-15T11:51:26Z

Xseo:

Who cares about rules? I mean, I'm pretty sure your score won't count according to rules if you bowl from establishment uphill from bowling alley. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 05:36, 15 December 2022 (UTC)

If the ball has a diameter of 8.5 inches (multiplied by 2.54 and Pi makes about 67.8cm circumference) the rpm is also limited by the speed of light of the surface (reached at about 6.4x10^9rpm).

Please elaborate on how widespread the aforementioned destruction would be. [[Special:Contributions/172.71.154.38|172.71.154.38]] 10:50, 15 December 2022 (UTC)
: See What-If #1 (https://what-if.xkcd.com/1/) for reference. [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 11:01, 15 December 2022 (UTC)

Randall is clearly overestimating the mass range at which "equipment damage" would occur. Even 10^3 kilos is a //car//. I'm pretty sure that throwing a bowling ball the mass of a car would do a lot of equipment damage. I believe the 10^10 to 10^20 range should be "widespread destruction" (already a category above) and between that and the Schwarzchild mass should be something like "all life on Earth destroyed" because 10^20 kilos is plenty large enough for a global killer asteroid (admittedly its velocity would be much smaller... but still, I don't see how you have 1% of the Moon's mass in bowling ball without wiping out all life on Earth). [[Special:Contributions/172.70.85.175|172.70.85.175]] 11:20, 15 December 2022 (UTC)
: That's the joke :) The humour is in the understatement [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 11:51, 15 December 2022 (UTC)

For further edification: A 10^3 kg bowling ball traveling at 10^3 m/s is approximately equivalent to a shell fired from the main battery gun of a battleship. [[Special:Contributions/162.158.159.74|162.158.159.74]] 11:40, 15 December 2022 (UTC)

2710: Hydropower Breakthrough

2022-12-13T08:00:22Z

Xseo: Corrected then to than

{{comic
| number = 2710
| date = December 12, 2022
| title = Hydropower Breakthrough
| image = hydropower_breakthrough_2x.png
| imagesize = 261x303px
| noexpand = true
| titletext = A hydroelectric dam is also known as a heavy water reactor.
}}

==Explanation==
{{incomplete|Created by a PRACTICAL WATER REACTOR - Please don't change this comment when editing this page. Do NOT delete this tag until the year 2039, or until fusion reactors have succeeded.}}

The comic parodies fusion reactors, with energy produced seemingly never positive. In the past years, constant developments in fusion reactors have slowly increased the energy output of fusion to more than the input. It is possible this is meant to directly parody the Department of Energy's anticipated announcement of Q>1 fusion. The announcement is scheduled for the day after this comics release, and the date of this announcement was announced the day this comic went up. [https://www.ft.com/content/4b6f0fab-66ef-4e33-adec-cfc345589dc7]

A {{w|hydroelectric dam}} is a power facility that generates electricity from water flowing in a river passing through a water turbine and generator. In the comic, Beret Guy, unscientific as always, presents a hydroelectric dam。 However, instead of generating energy, it generates a flow of water. This is similar to the way that a fusion reactor takes energy (and hydrogen isotopes) as an input and energy (and helium isotopes) as outputs. While one member of the audience shouts "Hooray!", another member of audience, who is presumably familiar with regular physics, says "Wait.", because {{w|conservation of mass}} usually applies to water such that a dam should produce the same amount of water as that fed into it. That said, for a regular dam in a natural valley like the one shown in this comic, it is entirely normal for the dam to "produce" more water than input in the sense that in addition to water from upstream rivers, the dam will also output any "unofficial" inflow from direct rainfall above and from uncharted sources of groundwater below.

The symbol Q is normally used to refer to {{w|fusion energy gain factor}}, the ratio of power generated by a fusion reactor to the energy used to maintain it -- an energy source isn't useful if it takes more power to run it than it produces. Q also can represent the volumetric flow rate of water through a hydroelectric dam, and in this case, a Q > 1 would have no great significance. Beret Guy has somehow mixed the two up, making the rate of flow as the output of the reaction and increasing it.

The title text further confuses the issue as it introduces nuclear ''fission'' and equates the hydroelectric dam with a heavy water reactor, which is a special type of nuclear fission reactor that uses deuterium as a moderator to absorb neutrons. This is also a pun because one could simplistically say that a hydroelectric dam runs on "heavy water", or that it is a water reactor (producing electricity) that is heavy (bulky). The electricity comes from potential energy stored in the water, which is directly related to its mass (U = mgh). Alongside that, it possibly is making a pun on water and fusion reactors. Heavy water is the primary source of deuterium, a specific isotope of hydrogen required for the most energy-efficient fusion reactions needed today. On the other hand, water is the liquid that passes through dams, and is rarely used for fusion reactions today{{citation needed}}—although [https://what-if.xkcd.com/14/ it could be used as fusion fuel because it is made of hydrogen and oxygen.]

==Transcript==

{{incomplete transcript|Do NOT delete this tag too soon.}}

[Beret Guy is standing on a podium. A lectern is in front of him, and he is pointing to a picture behind him of a dam.]

Beret Guy: We are pleased to announce that our hydroelectric dam has achieved Q > 1, producing more water than we fed into it!

Off-panel voice: Hooray!

Off-panel voice: Wait.

{{comic discussion}}
[[Category:Comics featuring Beret Guy]]
[[Category:Strange powers of Beret Guy]]

Talk:2467: Wikipedia Caltrops

2021-05-26T10:14:19Z

Xseo:

seems more like flares (which distract) than caltrops (which physically impair) to me. [[Special:Contributions/162.158.222.122|162.158.222.122]] 16:31, 24 May 2021 (UTC)

I'd say "Well, I now know what I'm doing for the next few hours!", except that I suspect that this isn't even going to be the half of it... [[Special:Contributions/141.101.98.46|141.101.98.46]] 16:37, 24 May 2021 (UTC)
::👍 [[User:OhFFS|OhFFS]] ([[User talk:OhFFS|talk]]) 21:45, 24 May 2021 (UTC)

except 'caltrops' is a funnier word than 'flares' and we get the gist anyway. [[Special:Contributions/108.162.237.4|108.162.237.4]] 17:23, 24 May 2021 (UTC)

no WAY randall is a jon bois fan
[[Special:Contributions/173.245.52.175|173.245.52.175]] 17:38, 24 May 2021 (UTC)

Flares draw fire to prevent missiles from reaching their target. Caltrops impede the actual motion of the vehicle. If the links are as distracting as Randall implies, I think his choice makes sense!
[[Special:Contributions/108.162.215.92|108.162.215.92]] 00:34, 25 May 2021 (UTC)

Flares do " draw fire" but because they are more visible to heat seakeking missiles than engine jet engine heat. This seems like a solvable problem, missile and flare wise.[[Special:Contributions/162.158.75.202|162.158.75.202]] 03:44, 25 May 2021 (UTC)

Shouldn't the links be given as QR codes rather than plain text, which would have to be read and re-typed into a device with a suitable web browser? [[Special:Contributions/108.162.219.28|108.162.219.28]] 00:54, 25 May 2021 (UTC)
:Having to type the URL would be more distracting to driver of the car behind? And it's not like it is exactly easy to aim your phone camera to and read the QR code on a flying banner from the car in front of you, in addition to using smartphone mean traffic law violation. And text in URL also spoiler the link content a bit to invite interest. [[Special:Contributions/172.70.49.196|172.70.49.196]] 02:45, 25 May 2021 (UTC)
:QR codes for urls are more a marketing ploy. The usage for typing urls into a webbrowser can be as easily done by an OCR algorithm on the camera image. Sebastian --[[Special:Contributions/172.68.110.118|172.68.110.118]] 12:02, 25 May 2021 (UTC)
:Plain text (if it contains interesting words) will catch the driver's attention. QR codes are easy to ignore.

It looks like "List of Fictional Colors" [https://web.archive.org/web/20200720071214/https://en.wikipedia.org/wiki/List_of_fictional_colors used to exist] but was deleted [https://web.archive.org/web/20200731090020/https://en.wikipedia.org/wiki/List_of_fictional_colors late July 2020] [[Special:Contributions/172.69.33.119|172.69.33.119]] 04:11, 25 May 2021 (UTC)

I have nothing useful to add but wanted to point out that "as easily distracted as me." is grammatically incorrect - it should instead be "as easily distracted as I." [[Special:Contributions/172.70.100.54|172.70.100.54]] 13:25, 25 May 2021 (UTC)

The wikipedia list should have a warning before it due to a HIGH nerd sniping potential. No doubt that was the intent. --Hman

It's a legitimate technique. I've been trying to read this explanation page for 48 hours but it keeps sending me down a Wikipedia hole that I have to dig myself out of. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 10:14, 26 May 2021 (UTC)

2348: Boat Puzzle

2020-08-20T16:04:35Z

Xseo: Corrected a typo - "diver" to "river"

{{comic
| number = 2348
| date = August 19, 2020
| title = Boat Puzzle
| image = boat_puzzle.png
| titletext = 'No, my cabbage moths have already started laying eggs in them! Send the trolley into the river!' 'No, the sailing wolf will steal the boat to rescue them!'
}}

==Explanation==
{{incomplete|Created by a GOAT THAT EATS WOLVES. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
This comic is a twist on {{w|Wolf, goat and cabbage problem|an old riddle}}. In the original riddle, a person has to cross a river in a boat that can only hold them and one other object. They have a wolf, a goat, and a cabbage that they need to bring across with them, similar to the first panel. If the wolf is left alone with the goat, however, the wolf will eat the goat; and if the goat and cabbage are alone, the goat will eat the cabbage. (The problem can be solved in seven trips.)

However, the comic quickly devolves into surrealism in the later panels as new characters show up, bringing deviations of the original "cabbage", "goat", and "wolf" that add extra layers of complexity to the riddle. White Hat brings extra wolves and cabbages. Black Hat, in his traditional classhole style, brings {{w|cabbage moth}}s which will infest unsupervised cabbages with destructive larvae, and boat-destroying {{w|termite}}s. How he intends to bring them across the river (or even if he wants to) is unknown, but it brings to mind the parable of {{w|The Scorpion and the Frog}}. Beret Guy arrives with a wolf who can operate a boat, who could perhaps serve as a second pilot to expedite the crossing, so long as he is not asked to ferry a goat, and also a goat who eats wolves (which does not alter the problem constraints but is unusual, as one would expect from Beret Guy's associate).

The last panel is a reference to the {{w|Trolley_Problem|Trolley Problem}}, a moral test that asks the participant whether they would passively let people in the way of an uncontrollable trolley die or actively divert the trolley to kill a single person standing on a branch of the tracks. The comic gives a twist here too: according to the title text, the characters must choose between stopping the trolley full of wolves with a cushion of cabbages (in which Black Hat's cabbage moths have laid eggs, which he implicitly argues are morally equivalent to "innocent children") or letting it crash into the river (at which point the wolf who can operate a boat will steal the boat to rescue the wolves from the trolley, which will delay the other characters from crossing the river).

The River Crossing puzzle was also mentioned in [[1134: Logic Boat]] and referenced in [[589: Designated Drivers]].

The Trolley Problem was also mentioned in [[1455: Trolley Problem]] and referenced in [[1938: Meltdown and Spectre]].

==Solving The Problem==

Unlike typical Logic Boat problems the presence of multiple humans makes finding a solution almost trivial, however trying to determine the solution with the least number of trips could still make the somewhat challenging. Because the set of constraints are both ambiguous and incomplete, it requires the reader to make assumptions that, in turn, will lead to different solutions.

===Reasonable Assumptions===

The following assumptions can be made based on the setup of the problem or are necessary to avoid an unsolvable puzzle.

* '''Cueball is an observer.'''. He is set up as an observer there to solve the problem, not pilot the boat or "watch" the cargo.

* '''The boat can only hold two items.''' This is standard in logic boat problems. Groups of insects count as one item.

* '''Black Hat and Beret Guy both want to cross the river with their cargo'''. Neither states that they wish to cross the river like Ponytail and White Hat, but it can be inferred from the setup of the scenario.

* '''The termites will destroy the boat after use.''' Otherwise the problem is unsolvable.

* '''The wolf eating goat also eats cabbage.''' The wolf eating constraint adds to the goat's existing constraints.

* '''The sailing wolf follows the command of an adjacent human.''' The alternatives require more assumptions for a solvable puzzle.

* '''The sailing wolf returns the trolley wolves to the near shore.''' The trolley wolves show no indication of wanting to cross the river.

* '''Stopping the trolley destroys all the cabbages.''' Otherwise the event does not affect the logic puzzle.

* '''The pack of wolves in the trolley, if rescued, will eat a human or wolf eating goat left alone.'''. Aligns with the spirit of the constraints.

* '''A wolf can protect a human from a pack of wolves'''. Origin of domesticated dogs.

===The Trolley===

The trolley problem creates two versions of the puzzle, one where the cabbages are destroyed, the other where they are not and a wolf rescue takes place. The ethical issues associated with the trolley problem are independent from the logic of how to cross the river.

===Solutions===

* General

With four humans involved, the first trip across can bring an extra human who then can guard the cargo as it is brought across in arbitrary order with care being taken not to have predator and prey along together at the end. The termites must be last cargo ferried across as they will destroy the boat.

* The Trolley is Stopped

The cabbages are destroyed. The second to last trip brings across the last human and the last trip brings across the terminates.

* The Trolley is not Stopped

A pack of wolves is now on the near bank. The last human is brought across in the third to last trip, followed by the last wolf and lastly the termites.

===Missing Information===

No information is provided about whether or not the humans all get along with each other and this is left as a possible exercise for the reader given all of the characters' varying personality traits. However the sailing wolf would likely come in handy if certain humans (ex Black Hat, Beret Guy) cannot be left alone. It is also probably that certain characters might not serve in the capacity as a cargo guard.

It is also unclear if humans can leave with their cargo once all the cargo has been brought across. This could complicate matters if a far side "guard" leaves early.

==Transcript==
:[Cueball and Ponytail are standing on the bank of a river. There is a boat in the river. A goat and wolf are also on the riverbank, and Ponytail is holding a cabbage.]
:Ponytail: I need to cross the river. I have a wolf, a goat, and a cabbage.
:Cueball: Hmm.

:[White Hat appears, accompanied by two wolves and pulling a wagon full of cabbages.]
:Cueball: OK, here's what-
:White Hat: Hi, I also need to cross. I have two wolves and 100 cabbages.

:[Black Hat arrives, surrounded by a cloud of flying creatures and carrying a jar of bugs under his arm. Beret Guy follows with another wolf and goat on leashes.]
:Black Hat: I have 50 cabbage moths and 2,000 boat-destroying termites.
:Beret Guy: I have a wolf that can operate a boat, and a goat that eats wolves.

:[The fourth panel is a zoomed-out shot, where everything but the sky appears black.]

:[A trolley speeds in, leaving a trail of dust in its wake. A person is standing on the front, and many ears are barely visible above the seats.]

:Cueball: Hang on, I need to make a spreadsheet.
:Trolley operator: Look out!
:Trolley operator: My wolf-filled trolley is out of control and can only be stopped by a cushion of cabbages!

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Black Hat]]
[[Category:Comics featuring Beret Guy]]
[[Category:Logic]]
[[Category:Animals]]
[[Category:Food]]

Talk:2341: Scientist Tech Help

2020-08-04T07:23:21Z

Xseo:

First. [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 23:19, 3 August 2020 (UTC)

But more importantly, I added a transcript and added definitions for a Polaroid and Excel. Also, how should I deal with multiple Cueballs in the transcript? [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 23:35, 3 August 2020 (UTC)
: I don't think it is 2 Cueballs. I think the one on the right is Cueball and I don't recognise the other one. He is drawn slightly differently, he's got a bit of a butt-head (crack-head?). [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 07:23, 4 August 2020 (UTC)

I know of a team whose data was in the form of images - tens of thousands of them. Somehow during a pre-processing step they lost the exif data for the image files - which held the only digital link between the image file which had names assigned by the cameras like Img237856.png and their science which needed things like date and time of the image..... Fortunately the image itself had the date and time in a banner across the bottom 100 pixels. Managed to read the banner using OCR and tesseract. Not so very far off the thrust of this comic! [[Special:Contributions/162.158.126.134|162.158.126.134]] 00:08, 4 August 2020 (UTC)

I feel old when I know that Polaroid was not a disposable camera; it was an instant camera, meaning that the picture was taken, the film was slowly ejected from the camera body and you held the picture as it developed before your eyes. There were one-time use cameras, or "disposable" cameras, that were made cheaply and the camera was sent in for processing. Yes, probably incomprehensible to one so young to not know what a rotary dial desk phone (or wall phone) was. [[User:Doubting Thomas|Doubting Thomas]] ([[User talk:Doubting Thomas|talk]]) 00:41, 4 August 2020 (UTC)

I think the resentment stems from the ugly truth that such tool is needed in the first place? Is that a possibility? [[Special:Contributions/172.69.134.229|172.69.134.229]] 01:48, 4 August 2020 (UTC)

Talk:2341: Scientist Tech Help

2020-08-04T07:23:06Z

Xseo:

First. [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 23:19, 3 August 2020 (UTC)

But more importantly, I added a transcript and added definitions for a Polaroid and Excel. Also, how should I deal with multiple Cueballs in the transcript? [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 23:35, 3 August 2020 (UTC)
: I don't think it is 2 Cueballs. I think the one on the right is Cueball and I don't recognise the other one. He is drawn slightly differently, he's got a bit of a butt-head (crack-head?).

I know of a team whose data was in the form of images - tens of thousands of them. Somehow during a pre-processing step they lost the exif data for the image files - which held the only digital link between the image file which had names assigned by the cameras like Img237856.png and their science which needed things like date and time of the image..... Fortunately the image itself had the date and time in a banner across the bottom 100 pixels. Managed to read the banner using OCR and tesseract. Not so very far off the thrust of this comic! [[Special:Contributions/162.158.126.134|162.158.126.134]] 00:08, 4 August 2020 (UTC)

I feel old when I know that Polaroid was not a disposable camera; it was an instant camera, meaning that the picture was taken, the film was slowly ejected from the camera body and you held the picture as it developed before your eyes. There were one-time use cameras, or "disposable" cameras, that were made cheaply and the camera was sent in for processing. Yes, probably incomprehensible to one so young to not know what a rotary dial desk phone (or wall phone) was. [[User:Doubting Thomas|Doubting Thomas]] ([[User talk:Doubting Thomas|talk]]) 00:41, 4 August 2020 (UTC)

I think the resentment stems from the ugly truth that such tool is needed in the first place? Is that a possibility? [[Special:Contributions/172.69.134.229|172.69.134.229]] 01:48, 4 August 2020 (UTC)

Talk:2309: X

2020-05-21T08:54:26Z

Xseo:

id certainly use that language lol ([[User talk:172.69.70.101|172.69.70.101]])

-- haXkell is a X-based dialect of haskell 
X :: Integer -> Integer 
X 0 = 1 
X X = X * X (X-1) 
[[User:Capncanuck|Capncanuck]] ([[User talk:Capncanuck|talk]]) 02:35, 21 May 2020 (UTC)

https://esolangs.org/wiki/X isn't taken. --[[User:Blacksilver|Blacksilver]] ([[User talk:Blacksilver|talk]]) 02:40, 21 May 2020 (UTC)

Some unique looking variable names would be X and x in the fonts Webdings, Wingdings, Wingdings 2, and Wingdings 3. 
They are respectively as follows: 
X
x
X
x
X
x
X
x --[[User:Dstrube|Dstrube]] ([[User talk:Dstrube|talk]]) 02:49, 21 May 2020 (UTC) 

As well as esolangs, among which I would consider the likes of Whitespace and b****fuck as potential inspirations, I think I'm also minded of TempleOS and its creator as vaguer but possibly still related influences... [[Special:Contributions/162.158.158.163|162.158.158.163]] 03:28, 21 May 2020 (UTC)

I added an explanation of what a variable is and why it's bad to have every one named X. It's pretty rudimentary though, hope someone more experienced than me will improve it. [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 04:39, 21 May 2020 (UTC)

Psh you're all chicken. Chicken chicken chicken.

[[https://media.discordapp.net/attachments/677507038607048704/706860858587873310/ShapeLikeItSelf_img1.png?width=282&height=209 Language where you can have return keyword in a if condition]],
[[https://media.discordapp.net/attachments/677507038607048704/712914169774735441/unknown.png?width=292&height=103 Language that uses unicode symbols for built_in operators]],
[[https://media.discordapp.net/attachments/677507038607048704/712915431446282240/unknown.png?width=396&height=379 Language, I have no words to describe]],
and this this '''X''' thing is winning so far...
[[Special:Contributions/162.158.89.139|162.158.89.139]] 06:35, 21 May 2020 (UTC)

:Yeah, but C++ does that shit either '''unintentionally''' or '''at user demand''' (although, to be clear, I'm not saying it's any good; C++ and Java are possibly the worst programming languages in terms of shoddy design). The X programming language is just the designer being an asshole. [[Special:Contributions/172.68.189.205|172.68.189.205]] 07:04, 21 May 2020 (UTC)
::Those links have nothing to do with C++/Java and you can Not do those things in C++ or Java (except an if in an assignment).[[Special:Contributions/162.158.92.208|162.158.92.208]] 08:02, 21 May 2020 (UTC)

Did Randall refer to this comic? https://xkcd.com/1537/
I vaguely remember another one about an esoteric language. Is there a category of programming languages on explainxkcd?

Am I the only one that tried fiddling the CSS on the page to see if the X would change? Spoiler -> It didn't. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 08:54, 21 May 2020 (UTC)

Talk:2298: Coronavirus Genome

2020-04-27T07:47:42Z

Xseo:

Epigenetics is a pun, right? I think it's a pun but I don't know what and it's maddening. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 23:03, 24 April 2020 (UTC)
:...{{w|Epigenetics}} is a real thing—the study of how changes in things other than the genome itself can be passed down between generations. An example is conditioning a mouse to be scared of the smell of oranges/cherries/almonds by having them associate the scent of acetophenone with an electric shock, then testing whether its pups also have the same fear of that smell: they do, but this obviously can't be by the genome itself changing (no component of this has a lot of ionizing radiation{{Citation needed}}). Whatever causes this is the topic of actual epigenetics. --[[User:Volleo6144|Volleo6144]] ([[User talk:Volleo6144|talk]]) 00:12, 25 April 2020 (UTC)
::I know that, I added the link to the article. But afaik that has nothing to do with how the genome is formatted in Word, and I think it's a pun. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 00:31, 25 April 2020 (UTC)

since when does notepad have spellcheck? [[Special:Contributions/172.68.226.46|172.68.226.46]] 23:05, 24 April 2020 (UTC)
: Word does, so maybe she is using Word instead? Kind of contradictory. [[Special:Contributions/172.69.34.46|172.69.34.46]] 23:14, 24 April 2020 (UTC)
:I assumed Randall meant Wordpad, which ifrc is an upgrade from notepad but has a really thinned out set of Word's features. Maybe there's a spellcheck in there? (haven't used it in ~10 years) [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 07:47, 27 April 2020 (UTC)

When Dr. Theall first scanned Finnegans Wake, he had to tell Microsoft the language was Old Icelandic.

The OCR kept trying to spellcheck Finnegans Wake.15:11, 26 April 2020 (UTC)~
True Story: In the 1980s, as part of the Work Experience initiative at my school, I was assigned to one of my local council's offices (I'd applied for their computer department, but someone else got that). I don't ''think'' the word-processor I used at home (Psion Exchange) had spellcheck, but the one the office used (Lotus? Can't actually recall, but it, like most things, was DOS-based) definitely had, and it was very easy to edit in new words. Inspired by the chemistry lessons I'd recently had, and some 'reports' I was asked to write (keeping the kid busy, more like!) that dealt with chemical degradation of concrete under the action of salt and suchlike, I of course added "NaCl" then absolutely any other chemical formulae I could think of. "H2SO4" was an early one (partial subscript formatting wasn't relevent to the spill-chucker) but I eventually got round to CH4, C2H6, C3H8, etc, and then as many of the derived alcohols, alkenes, alkynes, etc that I could be bothered to type in. Which were a lot. By the end I was 'confident' that nobody would ever type ''any'' correct chemical formula into that machine (no network-shared resources!) and have to worry about false-positive typo alerts. Yeah, well, I was still at school and thought I knew ''everything''. [[Special:Contributions/162.158.159.70|162.158.159.70]] 23:37, 24 April 2020 (UTC)

Can confirm: virus genomes are looked at in notepad. I worked at one of the national laboratories for a summer, experimenting with ways to check for the length of a gene and strength of genetic expression in various circumstances in E. coli. We used notepad because even old computers can open very large files without difficulty, and all our scripts were in Perl, which can easily output to .rtf or .txt file formats. These files are huge, by the way. If you hold down on the scroll bar so it's zooming to the bottom, you could be waiting 20 minutes to reach the end depending on the number of kilobase pairs in your microbe. And epigenetics is not a pun. It's a real word. [[Special:Contributions/172.68.143.192|172.68.143.192]] 00:15, 25 April 2020 (UTC)

Concurrent to the work in the medical community, work is underway in various open source software communities to fix bugs and other issues with software (eg genome analysis tools) that is useful to the scientists combatting COVID-19. These include the Debian "biohackathon" (https://lwn.net/Articles/816280/) as well as support from Mozilla (https://lwn.net/Articles/816386/). Parallel to these efforts, the FSF (Free Software Foundation) has focused on the shortage of medical equipment: https://lwn.net/Articles/816392/ [[Special:Contributions/108.162.242.5|108.162.242.5]] 00:34, 25 April 2020 (UTC)

I’m suddenly inspired to write a DNA-edit-mode for Emacs (if it doesn’t have it already) which would allow for the virus spell check as described in this comic. [[Special:Contributions/172.69.63.153|172.69.63.153]] 04:16, 25 April 2020 (UTC)

- the dna-mode for emacs does exist. Google for it. It is not very useful for real work, though. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)

Derek Lowe has some insights about actual coronavirus mutations [https://blogs.sciencemag.org/pipeline/archives/2020/04/21/watching-for-mutations-in-the-coronavirus here], if you are interested.

Given coronavirus has an RNA genome, shouldn't all the 'T's be replaced by 'U's?

- It is standard practice no to use U's in public sequence database. It simplifies things. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)

The sequence in the transcript does not actually appear on the [https://www.ebi.ac.uk/ena/data/view/MT344963&display=text site] mentioned in the explanation. In fact, when I google for 'TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA' I only get this particular site.
:
UNSIGNED COMMENT: PLEASE SIGN WITH "<nowiki>~~~~</nowiki>"
:To find this (or any) sequence go to [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome|Nucleotide Blast]] and paste the query into the box. You will receive a list of a number of best matches (10, 50 or 100 in standard search), this should look like [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastSearch&VIEW_SEARCH=on&UNIQ_SEARCH_NAME=A_SearchOptions_1jST3G_gRB_dgzLunnk2EC_23turP_1HUFpP|this]]
Interestingly, this is an US-specific strain of the virus (top result currently is "Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/NC_0025/2020").[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 23:21, 25 April 2020 (UTC)
:Well, ''obviously'' it's a new variant, yet unknown to other clinical studies. Of RNA that has switched to looking like DNA, so this is a hot discovery! [[Special:Contributions/162.158.159.142|162.158.159.142]] 12:05, 25 April 2020 (UTC)

: The site shows several views into the public database entry that are easier to understand by humans than the raw sequence. Click the link at 'View: TEXT'. and scroll down. The relevant lines look like this:

aatccagtaa tggaaccaat ttatgatgaa ccgacgacga ctactagcgt gcctttgtaa 26220

gcacaagctg attagtacga acttatgtac tcattcgttt cggaagagac aggtacgtta 26280

As you can see, these are not meant to be search for and compared in "a notepad". For the same reason, google does not index DNA sequence database entries. There are specialised tools for that.

The sequnces were published this month, so they are available only in the most recent sequence database updates. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)

I have had trouble opening .txt files of even a hundred KB in Notepad! Sometimes it even crashes... It's one of the reasons I started using Notepad++. Notepad++ also happens to have a very extensible spellcheck, & language-specific formatting options. Since I often need to use Windows machines, it's one of my most frequently installed apps, after 7Zip.
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 18:03, 25 April 2020 (UTC)

The Grammar Checker concept only has a {{w|Colorless_green_ideas_sleep_furiously|limited analytical sophistication}}, though I don't doubt it'd still be enough to get a Nobel given the complexity of the task of deriving trivially feasible sequences from total codswallop. I also added the "next step" (probably much more than a single step), when I revised things, but that might actually be overstepping the explanation of the comic and removable. [[Special:Contributions/162.158.155.122|162.158.155.122]] 20:32, 25 April 2020 (UTC)
:Thanks for mentioning this in the discussion area, as I wondered what that "next step" line meant when I read it a little while ago, let alone how it related to the comic. I'll go ahead and trim that last "next step" sentence off the end, as I think it is unnecessary. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 03:36, 26 April 2020 (UTC)

Is using Notepad to analyse RNA sequences more or less sane than using a spam filter to play chess? - [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 00:43, 27 April 2020 (UTC)

Talk:1884: Ringer Volume/Media Volume

2017-09-04T07:55:33Z

Xseo:

So, is this about the volume buttons controlling all aspects of volume on the phone, and it being difficult to control sometimes (a lot!)? ~Chris {{unsigned ip|108.162.245.220}}
:Yes, but it's strange because the default action of the volume control should be the ''main volume'' and NOT the ''ring tone volume''. Nevertheless a video advertisement is often much louder than the movie where it is embedded. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 14:50, 1 September 2017 (UTC)
:: "Should be" is a weird concept. On Android (at least the mutilated version on my phone), there is no "master volume". Volume keys control the volume for the channel which is currently making noise, or the ring tone volume if there isn't any current noise. --[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 16:49, 2 September 2017 (UTC)
Protip: on Android when loading a youtube video, lock your phone and then unlock it. The video will then start paused, allowing you to adjust volume and then press play.[[Special:Contributions/172.68.206.4|172.68.206.4]] 15:06, 1 September 2017 (UTC)

On my Android phone, pressing either volume key results in the ringer volume slider appearing at the top of the screen. To its right is a downward-pointing caret. Pressing that caret adds sliders for media and alarm volumes. These can be moved using the touchscreen or the user can tap to select one to adjust and use the volume keys. [[User:D5xtgr|D5xtgr]] ([[User talk:D5xtgr|talk]]) 16:23, 1 September 2017 (UTC)
: These didn't exist in Android Lollipop, and were presumably added in Marshmallow [[Special:Contributions/108.162.245.34|108.162.245.34]] 06:57, 2 September 2017 (UTC)

Don't understand this comic at all... why would you frantically turn your volume up and down like that in the seconds before a video starts? Do other people do this?? [[Special:Contributions/141.101.69.81|141.101.69.81]] 16:24, 1 September 2017 (UTC)
:People aren't intentionally doing that. The viewer is trying to turn down the media volume; however, Android defaults to those buttons adjusting the volume for incoming calls, which people usually leave maxed. The viewer is accidentally decreasing the incoming call volume, but only wants the media volume turned down. [[User:Mulan15262|Mulan15262]] ([[User talk:Mulan15262|talk]]) 00:46, 2 September 2017 (UTC)

Here's my understanding (though I don't have a smart phone and don't have first hand experience): The user has selected the video to start, it is about to begin (loading), and the user wants to turn down the volume on the video, but instead mistakenly turns down the volume on the ringer. Once noticing their mistake, they restore the volume to its original state and try again. Only to fail again. They repeat this cycle again, until the video finishes loading and catches them on the upswing. I believe once the video is loaded the volume controls on the side switch functions from ringer to media. --[[Special:Contributions/108.162.216.238|108.162.216.238]] 16:36, 1 September 2017 (UTC)

Addressing '''"Interestingly, some earlier versions of Windows allow adjusting volume on per-program basis using a single on-screen control. This feature was eventually removed as it was deemed to confusing to users."''', I use Windows 10 on my laptop, and I can right click on the sound manager, open volume mixer, and that allows me to adjust the volume of each active program. So I'm pretty sure this line is incorrect, as it is still a feature. (Alan)
: I think that line is supposed to refer to the quick volume control, rather than the full mixer.

On iPhones, there is an option to have the buttons always control media volume, even when there is no media playing. [[Special:Contributions/162.158.79.119|162.158.79.119]] 19:11, 1 September 2017 (UTC)

The title texts idea of using this phenomena to bring advertisement also in other rooms, reminds me a little of the clever PR idea of Burger King. They asked Google in their TV-spot, what a Whopper is. And since a lot of people have an active Google speaker next to their TV-set, Google started answering with the first lines of the Wikipedia article about the Whopper. Coincidentally somebody has edited the Wiki-article about the Whopper a few days before, so that it sounds much more like advertisement. Mario

My Android phone doesn't behave like that, although I wish it did. If you press the volume buttons before a video starts, and immediately after while the onscreen volume is still visible, it ''continues to adjust the ringer volume''. This fixes the behavior in the comic, kind of, but it means that I ''still'' can't easily adjust the volume even after the video starts. [[Special:Contributions/162.158.111.109|162.158.111.109]] 10:57, 2 September 2017 (UTC)
:I have that problem too. I also note that at least some apps use the wrong channel; so videos use the media volume, but the ads come off the notification volume or similar. Also annoys me that certain fitness apps use the media volume for the synthesised speech to tell you that you're passed a mile; meaning you can't adjust it independantly of your music. Would really appreciate if each app could define its own output channels, which you can then connect to the system-wide volume channels (or apply filters to?) in whatever configuration you want. --[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 16:49, 2 September 2017 (UTC)

Per-application volume mixer was new in Windows Vista; XP and previous versions only had the system-wide volume control. --[[Special:Contributions/162.158.154.121|162.158.154.121]] 11:00, 2 September 2017 (UTC)

I have a game on my phone called Papi Wall which I don't even play anymore, but which has a silent menu screen when you open it, which despite its silence is somehow occupying the media volume. So I open the game, which opens quickly, to quickly adjust the media volume at the menu screen and then switch back to the other app. It's the reason why it's still on my phone despite the fact that I don't play it. I think any Papi game, such as Papi Jump, would work for this, if you want to try. [[Special:Contributions/172.68.26.41|172.68.26.41]] 12:37, 2 September 2017 (UTC)

There's an Android application called Rocker Locker that plays a silent tone in the background, forcing the volume buttons to always control media volume. Cheers! [[Special:Contributions/108.162.219.22|108.162.219.22]] 23:37, 2 September 2017 (UTC)
: I like this idea, but surely the battery consumption is huge? I'd prefer an iOS style setting on my Android.[[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 07:55, 4 September 2017 (UTC)

The video he's trying to load is certainly https://youtu.be/iAjCxadppcQ "Welcome to the World" (or one of the many remixes) by Kevin Rudolf. It's an on topic example media for what Randall is complaining about because it's a notably soft...THEN LOUD kind of song. [[Special:Contributions/162.158.142.58|162.158.142.58]] 01:35, 3 September 2017 (UTC)
:Could be, but I think it's just a common greeting (I thought of Let's Plays, personally). --[[Special:Contributions/172.68.11.5|172.68.11.5]] 03:13, 4 September 2017 (UTC)

Talk:1884: Ringer Volume/Media Volume

2017-09-04T07:55:13Z

Xseo:

So, is this about the volume buttons controlling all aspects of volume on the phone, and it being difficult to control sometimes (a lot!)? ~Chris {{unsigned ip|108.162.245.220}}
:Yes, but it's strange because the default action of the volume control should be the ''main volume'' and NOT the ''ring tone volume''. Nevertheless a video advertisement is often much louder than the movie where it is embedded. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 14:50, 1 September 2017 (UTC)
:: "Should be" is a weird concept. On Android (at least the mutilated version on my phone), there is no "master volume". Volume keys control the volume for the channel which is currently making noise, or the ring tone volume if there isn't any current noise. --[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 16:49, 2 September 2017 (UTC)
Protip: on Android when loading a youtube video, lock your phone and then unlock it. The video will then start paused, allowing you to adjust volume and then press play.[[Special:Contributions/172.68.206.4|172.68.206.4]] 15:06, 1 September 2017 (UTC)

On my Android phone, pressing either volume key results in the ringer volume slider appearing at the top of the screen. To its right is a downward-pointing caret. Pressing that caret adds sliders for media and alarm volumes. These can be moved using the touchscreen or the user can tap to select one to adjust and use the volume keys. [[User:D5xtgr|D5xtgr]] ([[User talk:D5xtgr|talk]]) 16:23, 1 September 2017 (UTC)
: These didn't exist in Android Lollipop, and were presumably added in Marshmallow [[Special:Contributions/108.162.245.34|108.162.245.34]] 06:57, 2 September 2017 (UTC)

Don't understand this comic at all... why would you frantically turn your volume up and down like that in the seconds before a video starts? Do other people do this?? [[Special:Contributions/141.101.69.81|141.101.69.81]] 16:24, 1 September 2017 (UTC)
:People aren't intentionally doing that. The viewer is trying to turn down the media volume; however, Android defaults to those buttons adjusting the volume for incoming calls, which people usually leave maxed. The viewer is accidentally decreasing the incoming call volume, but only wants the media volume turned down. [[User:Mulan15262|Mulan15262]] ([[User talk:Mulan15262|talk]]) 00:46, 2 September 2017 (UTC)

Here's my understanding (though I don't have a smart phone and don't have first hand experience): The user has selected the video to start, it is about to begin (loading), and the user wants to turn down the volume on the video, but instead mistakenly turns down the volume on the ringer. Once noticing their mistake, they restore the volume to its original state and try again. Only to fail again. They repeat this cycle again, until the video finishes loading and catches them on the upswing. I believe once the video is loaded the volume controls on the side switch functions from ringer to media. --[[Special:Contributions/108.162.216.238|108.162.216.238]] 16:36, 1 September 2017 (UTC)

Addressing '''"Interestingly, some earlier versions of Windows allow adjusting volume on per-program basis using a single on-screen control. This feature was eventually removed as it was deemed to confusing to users."''', I use Windows 10 on my laptop, and I can right click on the sound manager, open volume mixer, and that allows me to adjust the volume of each active program. So I'm pretty sure this line is incorrect, as it is still a feature. (Alan)
: I think that line is supposed to refer to the quick volume control, rather than the full mixer.

On iPhones, there is an option to have the buttons always control media volume, even when there is no media playing. [[Special:Contributions/162.158.79.119|162.158.79.119]] 19:11, 1 September 2017 (UTC)

The title texts idea of using this phenomena to bring advertisement also in other rooms, reminds me a little of the clever PR idea of Burger King. They asked Google in their TV-spot, what a Whopper is. And since a lot of people have an active Google speaker next to their TV-set, Google started answering with the first lines of the Wikipedia article about the Whopper. Coincidentally somebody has edited the Wiki-article about the Whopper a few days before, so that it sounds much more like advertisement. Mario

My Android phone doesn't behave like that, although I wish it did. If you press the volume buttons before a video starts, and immediately after while the onscreen volume is still visible, it ''continues to adjust the ringer volume''. This fixes the behavior in the comic, kind of, but it means that I ''still'' can't easily adjust the volume even after the video starts. [[Special:Contributions/162.158.111.109|162.158.111.109]] 10:57, 2 September 2017 (UTC)
:I have that problem too. I also note that at least some apps use the wrong channel; so videos use the media volume, but the ads come off the notification volume or similar. Also annoys me that certain fitness apps use the media volume for the synthesised speech to tell you that you're passed a mile; meaning you can't adjust it independantly of your music. Would really appreciate if each app could define its own output channels, which you can then connect to the system-wide volume channels (or apply filters to?) in whatever configuration you want. --[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 16:49, 2 September 2017 (UTC)

Per-application volume mixer was new in Windows Vista; XP and previous versions only had the system-wide volume control. --[[Special:Contributions/162.158.154.121|162.158.154.121]] 11:00, 2 September 2017 (UTC)

I have a game on my phone called Papi Wall which I don't even play anymore, but which has a silent menu screen when you open it, which despite its silence is somehow occupying the media volume. So I open the game, which opens quickly, to quickly adjust the media volume at the menu screen and then switch back to the other app. It's the reason why it's still on my phone despite the fact that I don't play it. I think any Papi game, such as Papi Jump, would work for this, if you want to try. [[Special:Contributions/172.68.26.41|172.68.26.41]] 12:37, 2 September 2017 (UTC)

There's an Android application called Rocker Locker that plays a silent tone in the background, forcing the volume buttons to always control media volume. Cheers! [[Special:Contributions/108.162.219.22|108.162.219.22]] 23:37, 2 September 2017 (UTC)
: I like this idea, but surely the battery consumption is huge? I'd prefer an iOS style setting on my Android.

The video he's trying to load is certainly https://youtu.be/iAjCxadppcQ "Welcome to the World" (or one of the many remixes) by Kevin Rudolf. It's an on topic example media for what Randall is complaining about because it's a notably soft...THEN LOUD kind of song. [[Special:Contributions/162.158.142.58|162.158.142.58]] 01:35, 3 September 2017 (UTC)
:Could be, but I think it's just a common greeting (I thought of Let's Plays, personally). --[[Special:Contributions/172.68.11.5|172.68.11.5]] 03:13, 4 September 2017 (UTC)

1837: Rental Car

2017-05-15T12:44:15Z

Xseo:

{{comic
| number = 1837
| date = May 15, 2017
| title = Rental Car
| image = rental_car.png
| titletext = Technically, both cars are haunted, but the murder ghosts can't stand listening to the broken GPS for more than a few minutes.
}}

==Explanation==
{{incomplete|Work in progress}}

In this comic the couple [[Megan]] and [[Cueball]] want to rent a car. The [[:Category:Multiple Cueballs|Cueball-like guy]] from the {{w|car rental}} agency tells them they only have two vehicles available:
* One car that puts its occupants into mortal danger, so much so that it is called ''The Murder Car''. The danger, however, is abstract - it is [https://en.wiktionary.org/wiki/haunted haunted] by a {{w|ghost}}, and actual death befalls only "maybe one in six". (That is the equivalent of a round of {{w|Russian Roulette}}).
* The other car, a regular {{w|Sedan (automobile)|Sedan}}, has a defective {{w|GPS}} that incessantly gives instructions to go specifically to {{w|Seattle}}, regardless of the driver's intention to go there. And it cannot be turned off.

Megan believes she can ignore this and accepts the least lethal car. The comic suggests that driving with a GPS that tries to guide you to a different destination than that which you wish to visit - so it is always recalculating and asking you to do U-turns - is in credibly annoying. So annoying that given the choice between the persistent low-level annoyance of the GPS on one hand, and the ("low") probability of being murdered on the other, most people will choose the latter option. After all, they might survive murderous ghosts but they feel they will not survive long having to listen to the broken GPS.

According to the title text, the murderous ghosts haunt both cars, but as soon as the car starts driving and the GPS begins to drone on, even the ghost cannot stand listening to the broken GPS and returns to ''The Murder Car''.

Apart from the joke about GPS, there is also a joke on the horrible cars one might get at a car rental service...

==Transcript==
:[A Cueball-like guy standing behind a desk looking at a computer screen services Megan and Cueball on the other side of the desk.]
:Guy: We have two rental cars left.
:Guy: One is the murder car. But don't let the name scare you!
:Guy: It's definitely haunted. But most drivers don't get murdered.
:Guy: Maybe one in six.

:[The guy lifts his hand and looks at Megan and Cueball.]
:Guy: The other is a regular Sedan.
:Guy: But is has a GPS that's stuck trying to navigate to Seattle.
:Megan: ...I can ignore it, right? That's fine.

:[In a frame-less panel Megan and Cueball drives in the Sedan.]
:GPS: Turn left
:GPS: Recalculating
:GPS: Make a U-Turn
:GPS: Recalculating
:GPS: Turn right
:GPS: Make a U-Turn
:GPS: Recalculating

:[Megan and Cueball walks back into the the guy behind his desk. Megan holds out the car keys in one hand.]
:Guy: Back already?
:Megan: We'll take the murder car.
:Guy: Popular Choice.

{{comic discussion}}

[[Category:Comics featuring Megan]]
[[Category:Comics featuring Cueball]]
[[Category:Multiple Cueballs]]

1837: Rental Car

2017-05-15T12:43:54Z

Xseo:

{{comic
| number = 1837
| date = May 15, 2017
| title = Rental Car
| image = rental_car.png
| titletext = Technically, both cars are haunted, but the murder ghosts can't stand listening to the broken GPS for more than a few minutes.
}}

==Explanation==
{{incomplete|Work in progress}}

In this comic the couple [[Megan]] and [[Cueball]] want to rent a car. The [[:Category:Multiple Cueballs|Cueball-like guy]] from the {{w|car rental}} agency tells them they only have two vehicles available:
* One car that puts its occupants into mortal danger, so much so that it is called ''The Murder Car''. The danger, however, is abstract - it is [https://en.wiktionary.org/wiki/haunted haunted] by a {{w|ghost}}, and actual death befalls only "maybe one in six". (That is the equivalent of a round of {{w|Russian Roulette}}).
* The other car, a regular {{w|Sedan (automobile)|Sedan}}, has a defective {{w|GPS}} that incessantly gives instructions to go specifically to {{w|Seattle}}, regardsess of the driver's intention to go there. And it cannot be turned off.

Megan believes she can ignore this and accepts the least lethal car. The comic suggests that driving with a GPS that tries to guide you to a different destination than that which you wish to visit - so it is always recalculating and asking you to do U-turns - is in credibly annoying. So annoying that given the choice between the persistent low-level annoyance of the GPS on one hand, and the ("low") probability of being murdered on the other, most people will choose the latter option. After all, they might survive murderous ghosts but they feel they will not survive long having to listen to the broken GPS.

According to the title text, the murderous ghosts haunt both cars, but as soon as the car starts driving and the GPS begins to drone on, even the ghost cannot stand listening to the broken GPS and returns to ''The Murder Car''.

Apart from the joke about GPS, there is also a joke on the horrible cars one might get at a car rental service...

==Transcript==
:[A Cueball-like guy standing behind a desk looking at a computer screen services Megan and Cueball on the other side of the desk.]
:Guy: We have two rental cars left.
:Guy: One is the murder car. But don't let the name scare you!
:Guy: It's definitely haunted. But most drivers don't get murdered.
:Guy: Maybe one in six.

:[The guy lifts his hand and looks at Megan and Cueball.]
:Guy: The other is a regular Sedan.
:Guy: But is has a GPS that's stuck trying to navigate to Seattle.
:Megan: ...I can ignore it, right? That's fine.

:[In a frame-less panel Megan and Cueball drives in the Sedan.]
:GPS: Turn left
:GPS: Recalculating
:GPS: Make a U-Turn
:GPS: Recalculating
:GPS: Turn right
:GPS: Make a U-Turn
:GPS: Recalculating

:[Megan and Cueball walks back into the the guy behind his desk. Megan holds out the car keys in one hand.]
:Guy: Back already?
:Megan: We'll take the murder car.
:Guy: Popular Choice.

{{comic discussion}}

[[Category:Comics featuring Megan]]
[[Category:Comics featuring Cueball]]
[[Category:Multiple Cueballs]]

Talk:1830: ISS Solar Transit 2

2017-04-28T11:43:14Z

Xseo:

Gees Randal, that's actually really dark.

Attempted explaining. It is not real, ... I hope {{[[Special:Contributions/108.162.229.250|108.162.229.250]] 05:03, 28 April 2017 (UTC)}}

costs would be astronomical. I see what you did there and I approve. [[Special:Contributions/162.158.92.118|162.158.92.118]] 07:23, 28 April 2017 (UTC)

:astronomical, good joke [[Special:Contributions/141.101.105.216|141.101.105.216]] 09:35, 28 April 2017 (UTC)
: +1 [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 11:28, 28 April 2017 (UTC)

Have to disagree on the Pink Floyd joke. I don't see it. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 11:43, 28 April 2017 (UTC)

Talk:1816: Mispronunciation

2017-03-28T11:35:37Z

Xseo:

Epitome is an interesting one for me, since I read it phonetically (same as Randal's example), and didn't figure out that "e-pi-tō-mē" and "eppy-tome" were the same word until mid to late teens. I still have to stop myself from reading it wrong when I see it on the page... [[User:Andyd273|Andyd273]] ([[User talk:Andyd273|talk]]) 15:21, 27 March 2017 (UTC)

I think there's another level beyond the obvious, especially in the title text. You're pronouncing the word 'epitome' in whatever way you always have (inside your head), he's making clear that he's not saying it the way you say it.. so how do you read the comic? The sentence only makes sense if you say it aloud, but you can't because you don't know how he's pronouncing it.[[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 16:04, 27 March 2017 (UTC)
: Rereading the title text I feel like I may have suffered some kind of brain fart when writing this comment. Woops.. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 11:35, 28 March 2017 (UTC)

Related: https://en.wikipedia.org/wiki/Epitome_of_Hyperbole {{unsigned ip|172.68.54.40}}

Shouldn't there be a flap in epitome? --[[Special:Contributions/172.68.54.94|172.68.54.94]] 19:04, 27 March 2017 (UTC)

I feel like it's relevant to point out how the mispronunciation of mispronunciation is enhanced by contrasting it with mispronounce, which is the reason that most people mispronounce mispronunciation, due to the unexpected change in how the word is pronounced between the two terms. [[Special:Contributions/162.158.2.10|162.158.2.10]] 20:02, 27 March 2017 (UTC)
:I agree, someone who can write this into the explanation, someone better at English than me ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:36, 27 March 2017 (UTC)

Epi-*Tummy*? Really? Your english-speaking people's latin is so sick. ;-) --[[Special:Contributions/162.158.90.162|162.158.90.162]] 22:07, 27 March 2017 (UTC)
(I mean the close relationship to, say, "epitaph" is obvious, isn't it? Shouldn't they be pronounced similarly?)

"There is, however, an argument that misspelled should always be written mispelled since if it isn't mispelled, then it isn't mispelled." I'm sorry, but someone's going to have to explain that last part to me --[[Special:Contributions/172.68.133.126|172.68.133.126]] 23:06, 27 March 2017 (UTC)

Talk:1816: Mispronunciation

2017-03-27T16:04:08Z

Xseo:

Talk:1814: Color Pattern

2017-03-22T13:51:13Z

Xseo:

This link, note 1, may help whomever is going to be editing the comic explanation, I don't have time this morning. [https://en.wikipedia.org/wiki/Moir%C3%A9_pattern] [[User:Seebert|Seebert]] ([[User talk:Seebert|talk]]) 13:40, 22 March 2017 (UTC)

Did a quick google and copy/pasted from the Wikipedia page on Moiré patterns. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 13:51, 22 March 2017 (UTC)

1814: Color Pattern

2017-03-22T13:50:26Z

Xseo:

{{comic
| number = 1814
| date = March 22, 2017
| title = Color Pattern
| image = color_pattern.png
| titletext = â« When the spacing is tight / And the difference is slight / That's a moirÃ© â«
}}

==Explanation==
{{incomplete| Do NOT delete this tag too soon. }}
The comic references [https://en.wikipedia.org/wiki/Moir%C3%A9_pattern Moiré patterns] in a parody of the song [https://en.wikipedia.org/wiki/That%27s_Amore That's Amore].

In mathematics, physics, and art, a moiré pattern (/mwɑːrˈeɪ/; French: [mwaˈʁe]) or moiré fringes[1] are large scale interference patterns that can be produced when an opaque ruled pattern with transparent gaps is overlaid on another similar pattern. For the moiré interference pattern to appear, the two patterns must not be completely identical in that they must be displaced, rotated, etc., or have different but similar pitch.

Moiré patterns appear in many different situations. In printing, the printed pattern of dots can negatively interfere with the image. In television and digital photography, a pattern on an object being photographed can interfere with the shape of the light sensors to generate unwanted artifacts.

Photographs of a TV screen taken with a digital camera often exhibit moiré patterns. Since both the TV screen and the digital camera use a scanning technique to produce or to capture pictures with horizontal scan lines, the conflicting sets of lines cause the moiré patterns. To avoid the effect, the digital camera can be aimed at an angle of 30 degrees to the TV screen.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:Cueball: I took a picture of my computer screen—why is the photo covered in these weird rainbow patterns?
:Megan (singing): When a grid's misaligned with another behind
:Megan: That's a Moiré...

{{comic discussion}}

1743: Coffee

2016-10-10T12:05:43Z

Xseo:

{{comic
| number = 1743
| date = October 7, 2016
| title = Coffee
| image = coffee.png
| titletext = Remind me to order another pack of coffee filters from Dyson. Man, these things are EXPENSIVE.
}}

==Explanation==
{{incomplete|Very brief summary, please update}}

This strip follows the frequently used theme of people growing up but finding themselves unable or unwilling to accept traditional adult roles (see [[150: Grownups]], [[441: Babies]], [[616: Lease]], [[905: Homeownership]] and [[1674: Adult]]).
While there are cultures where coffee is served to children, it is generally in the United States considered an adult beverage—like [[1534: Beer]], which has also served as the subject of a comic.

Here, Cueball and Megan are anticipating guests. Offering coffee to houseguests is a commonly-accepted courtesy in the United States. However, they seem to be unaware of the basics of {{w|Coffee_preparation|coffee making}}. Cueball is concerned that this lack of knowledge is an indication of their mutual immaturity (thinking of himself as a "fake adult"), but Megan is confident that the necessary steps can be determined.

They attempt to make coffee by pouring the ingredients on the ground (misinterpreting the meaning of "ground coffee"), sucking it up with a Dyson vacuum cleaner (misinterpreting the meaning of "vacuum brewing"), then boiling the mixture by placing the vacuum cleaner's removable plastic canister over a hot stove, and pouring the resulting sludge through the vacuum-cleaner filter (instead of a standard coffee filter).

Megan says she is a regular "Starbuck" after pouring the batch of coffee, believing the name of the cafe chain {{w|Starbucks}} to be synonymous with the actual job title "barista", further indicating a general lack of knowledge regarding the subject of coffee. (In fiction, "Starbuck" is the name of a male character in Moby Dick, a male character is the original Battlestar Galactica television show, a female character in the reboot of Battlestar Galactica. In real life, Starbuck Island is an island in the Pacific Ocean. The Starbucks coffee chain was named for the fictional character in Moby Dick{{Citation needed}}.)

This method of making coffee would be very expensive as it would most likely destroy the vacuum-cleaner canister and filter. If the vacuum cleaner had ever been used, then it would not be very hygienic either.

The title text refers to the expense of replacing the "filter", as vacuum-cleaner filters are considerably more costly than single-use coffee filters{{Citation needed}}.

==Transcript==
:[Cueball and Megan are talking.]
:Cueball: We should make coffee for our guests.
:Megan: Crap. I know nothing about coffee.
:Cueball: We're basically fake adults.
:Megan: Don't panic. We can figure this out.

:[Megan shakes a can of coffee grounds out on the floor as Cueball watches.]
:Megan: We just pour the coffee grounds...

:[Pan to only Megan who pours a pail of water over the grounds now lying in a pile on the floor.]
:Megan: ...Add water...

:[Cueball watches as Megan vacuums up the mixture on the floor with a bag-less vacuum cleaner, the wire going off panel right behind her.]
:Vacuum cleaner: ''Vrrrr''

:[Megan is holding the dirt canister from the vacuum cleaner over two lit gas burners on a stove. The canister free vacuum cleaner is standing behind her and Cueball is behind this watching her.]
:Megan: Now we just hold it over the burners...
:Burners: ''Hissss''

:[Megan is holding the dirt canister over one shoulder while pouring the hot content into a small mug, as Cueball watches. Three wiggly lines above the liquid indicates that it is hot.]
:Megan: Annnd... serve.
:Cueball: Nice!
:Megan: I'm a regular Starbuck!

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Food]]

1735: Fashion Police and Grammar Police

2016-09-19T15:32:20Z

Xseo:

{{comic
| number = 1735
| date = September 19, 2016
| title = Fashion Police and Grammar Police
| image = fashion_police_and_grammar_police.png
| titletext = * Mad about jorts
}}

==Explanation==
{{incomplete|Needs more added to the explanation.}}
In this comic, two groups of protesters are presented, with one group representing the "fashion police", and the other representing "grammar" police. They are both groups of people who make fun of others by saying or wearing something that doesn't meet their criteria of "good". Grammar police are people who are "sticklers" to grammar rules and get mad or contradictory if someone uses grammar incorrectly in a sentence. Fashion police are people who make fun of others by wearing clothing that is mismatched or straight-up "ugly" to them. The comic explains how both groups are similar to each other.

The comic concludes with an incorrect assertion that these are literally the same people, when in actuality they merely exhibit the same traits. This is something the Grammar police would be quick to point out.

==Transcript==
{{incomplete transcript}}
[Two groups of people. One holding signs with a X through a type of shoe and labeled "Fasion Police", and one holding signs with "Their, They're, There" written on them and labeled "Grammar Police".] 
- Judgmental and Smug 
- Angry about something deeply arbitrary 
- Strong opinions backed by style guides 
- Appreciate that the way that you're interpreted is your responsibility 
- Understand that there is no way to "opt out" of sending messages by how you present yourself, and attempts to do so send messages of their own 
- To seem cool and casual, pretend to ignore them while understanding them very well 
- Vindictive about things that are often uncomfortably transparent proxies for race or social class 
- Fun to cheer on until one of them disagrees with you 
I just realized that these are literally the same people
{{comic discussion}}

Talk:1735: Fashion Police and Grammar Police

2016-09-19T15:31:46Z

Xseo:

I added a basic explanation to this comic. I also changed the incomplete to say "Needs more on the explanation". Maybe you guys can help connect the dots and extend the explanation? --[[User:JayRulesXKCD|JayRulesXKCD]] ([[User talk:JayRulesXKCD|talk]]) 14:45, 19 September 2016 (UTC)

It should be noted that he uses literally wrong, just to anger the grammar police he's mocking, it's a nice touch.[[User:Trives|Trives]] ([[User talk:Trives|talk]]) 14:59, 19 September 2016 (UTC)

In my eyes the 2 groups are not standing together in this comic. --[[User:DaB.|DaB.]] ([[User talk:DaB.|talk]]) 15:12, 19 September 2016 (UTC)
: Yeah I'd have said they were just being presented graphically, the intention isn't to display them as protesting alongside each other. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 15:31, 19 September 2016 (UTC)

Talk:1189: Voyager 1

2016-07-07T19:04:05Z

Xseo:

Uh, not all tally marks are Doctor Who references. [[User:Alpha|Alpha]] ([[User talk:Alpha|talk]]) 05:49, 22 March 2013 (UTC)

Is it just me, or is Randall getting lazy? Most of the past comics have been simplistic, easy-to-draw charts. {{unsigned|98.172.117.132}}
: Having just come from the future, we can now surmise that he was prepping for the epic, month-long-and-running sandcastle comic that started in the strip after this one. [[User:Echo Seven|Echo Seven]] ([[User talk:Echo Seven|talk]]) 03:59, 21 April 2013 (UTC)

Oh, was he talking about the glove? I though it was referring to "running the gauntlet" for some reason. --[[Special:Contributions/123.243.217.72|123.243.217.72]] 07:17, 22 March 2013 (UTC)

No, that's "running the gantlet." Two words which are often confused for each other. Plus you could run a gantlet of people whacking you with their gauntlets. [[Special:Contributions/63.241.174.129|63.241.174.129]] 13:21, 22 March 2013 (UTC)

: "Running the gantlet" and "running the gauntlet" are both acceptable uses, since both gantlet and gauntlet can be used for the punishment (however, "dropping the gantlet" would be incorrect, since gantlet ''only'' refers to the punishment, while gauntlet can refer to both the punishment and the glove). [[Special:Contributions/72.178.88.37|72.178.88.37]] 01:30, 23 March 2013 (UTC)

He almost certainly meant 'gantlet'; I think Randall just got the two words confused (it happens frequently. At this point, dictionary.com lists both spellings as synonymous.) The medieval punishment makes much more sense in context (ie: lots of things that could potentially hit Voyageur.)[[Special:Contributions/24.70.188.179|24.70.188.179]] 13:31, 22 March 2013 (UTC)

: Well, I saw a straight wordplay belt→glove there. --[[User:Mormegil|Mormegil]] ([[User talk:Mormegil|talk]]) 14:21, 22 March 2013 (UTC)
: Gauntlet and gantlet are both fitting and humorous in the context. Homophones are great. [[Special:Contributions/98.240.130.17|98.240.130.17]] 17:41, 22 March 2013 (UTC)

There were several stories two days ago saying it had left, then a correction from NASA saying it didn't.
http://science.time.com/2013/03/20/humanity-leaves-the-solar-system-35-years-later-voyager-offically-exits-the-heliosphere/
http://www.pcmag.com/article2/0,2817,2416867,00.asp
http://www.nasa.gov/mission_pages/voyager/voyager20130320.html
[[User:Bugefun|Bugefun]] ([[User talk:Bugefun|talk]]) 07:21, 22 March 2013 (UTC)

Is it just me or is it unclear why are there sixteen leaving events described in the title text but twenty-two tally marks on the comic? [[Special:Contributions/188.221.199.135|188.221.199.135]] 07:39, 22 March 2013 (UTC)

I just keep hoping that my children will be interested in space. Too late for me, NASA wouldn't want me, but surely my genes are still ok, I hope. To follow voyager down the rabbit hole of our expectations, what else can father ever ask? [[Special:Contributions/166.147.120.177|166.147.120.177]] 08:05, 22 March 2013 (UTC)

No it is not just you why there are 22 tick marks, and only 16 countable exits.[[Special:Contributions/192.231.124.16|192.231.124.16]] 12:03, 22 March 2013 (UTC)

The Crystal Sphere may refer to a David Brin story used to explain the fermi paradox of why we have had no alien contact: http://en.wikipedia.org/wiki/The_Crystal_Spheres [[User:Schmammel|Schmammel]] ([[User talk:Schmammel|talk]]) 14:37, 22 March 2013 (UTC)
:Crystal Sphere could also be a reference to the old Spelljammer D&D setting where systems/galaxies were contained in crystal spheres. [[Special:Contributions/146.146.7.2|146.146.7.2]]
::Which in turn is a reference to (well, really, direct borrowing from) the Ptolemaic astronomical concept, so it still comes back to the same thing. [[Special:Contributions/129.176.151.14|129.176.151.14]] 13:30, 28 March 2013 (UTC)

"US Census Bureau Solar System statistical boundary – a fictive boundary defined by": I'm capable of reading 'fictive' as 'conventional' in this sentence; as in "the real census bureau really invented it, like they really invented census areas". I would not have been confused by 'fictional', or by 'a boundary fictively invented', but I'm not sure that the second one is good English. I may have studied too much sociology. [[Special:Contributions/121.73.5.66|121.73.5.66]] 07:38, 23 March 2013 (UTC)

"Magnetogap" is probably wordplay on http://en.wikipedia.org/wiki/Magnetopause {{unsigned|194.176.203.76}}

Big news today (September 12, 2013), as Voyager 1 leaves the solar system. http://www.nytimes.com/2013/09/13/science/in-a-breathtaking-first-nasa-craft-exits-the-solar-system.html and http://www.bbc.co.uk/news/science-environment-24026153 [[User:Porkypine|Porkypine]] ([[User talk:Porkypine|talk]]) 19:47, 12 September 2013 (UTC)

:I have seen this statements at NASA too, but now it's just "Voyager Embarks on Journey Into Interstellar Space" and "NASA Spacecraft Embarks on Historic Journey Into Interstellar Space". So, this is just the next marker for this comic. Randall should do an update. There is simply NO defined border, it's just an other media hype. Look at [http://nasawatch.com/archives/2013/09/voyager-1-left.html nasawatch.com] for the Randall like critical statements. Correct is: Voyager is leaving out solar system. But objects surrounding our sun, like {{w|Voyager|Sedna}} are much farther outside. It's just a hype, this comic definitively needs an update by Randall.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:53, 12 September 2013 (UTC)

It appears this comic may become relevant again, if these guys are correct. It's supposed to have crossed the current sheet late last year, so we may find out soon if Voyager is still here. http://onlinelibrary.wiley.com/store/10.1002/2014GL060781/asset/grl51945.pdf?v=1&t=imnldq4k&s=3e62d6267158bfc259d6b16de42ab4c2d942b900 [[Special:Contributions/162.158.146.247|162.158.146.247]] 15:45, 5 April 2016 (UTC)

Fixed some typos/grammar and modified the logic of the bullets (a bullet for "real" boundaries, followed by "the rest" - including two real boundaries - didn't make any sense to me).[[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 19:02, 7 July 2016 (UTC)
:Realised "Fictive" is a real word, feel free to change it back, using fictional makes more sense to me as a natural English speaker though. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 19:04, 7 July 2016 (UTC)

Talk:1189: Voyager 1

2016-07-07T19:02:48Z

Xseo:

Talk:1189: Voyager 1

2016-07-07T19:02:29Z

Xseo:

1189: Voyager 1

2016-07-07T19:00:51Z

Xseo:

{{comic
| number = 1189
| date = March 22, 2013
| title = Voyager 1
| image = voyager_1.png
| titletext = So far Voyager 1 has 'left the Solar System' by passing through the termination shock three times, the heliopause twice, and once each through the heliosheath, heliosphere, heliodrome, auroral discontinuity, Heaviside layer, trans-Neptunian panic zone, magnetogap, US Census Bureau Solar System statistical boundary, Kuiper gauntlet, Oort void, and crystal sphere holding the fixed stars.
}}

==Explanation==
''{{w|Voyager 1}}'' is a U.S. space probe launched in 1977 to study the outer reaches of the {{w|Solar System}} and beyond. Popular press has on several occasions announced that it "has left the solar system" at each point when a boundary has been confirmed or a major event has taken place. This underscores the fact that there is no strictly defined and recognizable boundary of the solar system, or at least we haven't found one yet.

On the day of this comics release (2013-03-22) it was announced that [https://web.archive.org/web/20130322025117/http://www.agu.org/news/press/pr_archives/2013/2013-11.shtml Voyager 1 had entered a new region of space]. At this point Voyager 1 had passed {{w|Voyager_1#Heliopause|through the Heliopause}} and entered the {{w|Interstellar medium}}, although this latter was {{w| Voyager_1#Interstellar_medium|first confirmed}} about half a year later in September 2013.

The chart shows that Voyager 1 has left the Solar System 22 times, but in the title text only 16 are mentioned.

The title text lists several such possible boundaries, (and how many times Voyager 1 has passed them) together with fictive humorous ones:

'''Real boundaries''':
*Three times:
**The {{w|termination shock}} – the point in the heliosphere where the solar wind slows down to subsonic speed (relative to the star) because of interactions with the local interstellar medium. When exactly Voyager 1 {{w|Voyager_1#Termination_shock|passed the Termination shock}} is not clear and on Wikipedia there is given dates of 2003, 2004 and 2005. The final estimate was that it happened late in 2004. (Thus fitting with three times).
*Twice:
**The {{w|Heliopause (astronomy)|heliopause}} – the theoretical boundary where the Sun's solar wind is stopped by the interstellar medium. It was first reported in 2012 that Voyager 1 had {{w|Voyager_1#Heliopause|reached the Heliopause}}, but first on the day of this comics release was it officially announced that it had passed through to the interstellar medium. (Thus fitting with two times).
*Once only (Each):
**The {{w|heliosphere}} – a region of space dominated by Earth's Sun, a sort of bubble of charged particles in the space surrounding the Solar System - we live inside this region. At its boundary there are three named borders which are the real ones mentioned before and after this in the title text. From inside to out they are: The termination shock, the heliosheath and the heliopause. The reason the other two are mentioned first is that they have occurred more than once, and the list begins with those for that reason. As these other three borders are also part of the heliosphere, with the heliopause being the outer border of the heliosphere, then Voyager 1 will have left the heliosphere at the same time as it left the heliopause.
**The {{w|heliosheath}} – the region of the heliosphere beyond the termination shock. It was confirmed that Voyager 1 {{w|Voyager_1#Heliosheath|passed through this}} at the end of 2010, so this occurred two yreas before the Heliopause was reached. But since it only happened once, it is mentioned after the first two, and maybe after the heliosphere because it is inside this region?

'''Fictional boundaries''':
*Heliodrome – yet another composition of ''helios'' "sun," here together with ''dromos'' "course". There is no astronomical object with this name, but it has been used variously in other contexts. One that became famous is a sports hall which was used as a concentration camp in the Bosnian war, see {{w|Heliodrom camp}}.
*Auroral discontinuity - another fictitious astronomic object, for ''auroral'' see {{w|Aurora (astronomy)}}.
*{{w|Heaviside layer}} – a layer of ionized gas occurring between roughly 90–150 km (56–93 mi) above the ground in the Earth's atmosphere. Popularly recognized for its use as a reference to Heaven in the writings of {{w|T. S. Eliot}} adapted into {{w|Andrew Lloyd Webber}}'s musical ''{{w|Cats (musical)|Cats}}''.
*Trans-Neptunian panic zone – this fictional zone combines the word from two subjects: "Trans–Neptunian" is used in astronomy to describe stuff that occurs beyond the planet Neptune. In {{w|Outdoor education}} the "panic zone" is the opposite of the {{w|comfort zone}} when trying to learn new stuff.
*{{w|Ignition magneto|Magnetogap}} – part of an {{w|ignition system}}.
*US Census Bureau Solar System statistical boundary – a fictive boundary supposedly defined by the {{w|United States Census Bureau}}, similarly to how it defines {{w|Census tract|census areas}} for the purpose of processing statistical data about regions in the United States. I'm this case, the Bureau's boundary for determining the population of the solar system.
*Kuiper gauntlet – this is a play on the {{w|Kuiper belt}}, which is a region of the Solar System beyond the planets, extending from the orbit of Neptune (at 30 AU) to approximately 50 AU from the Sun, notable for being full of asteroids; replacing the word "belt" with "{{w|gauntlet (glove)}}" (often spelled 'gantlet') which is a protective glove as well as "{{w|gauntlet (punishment)}}" which is a medieval punishment where one would be forced to run through two lines of men who would hit the punishee.
*Oort void – refers to the {{w|Oort cloud}}, a gigantic "cloud" of materials (mainly composed of ice) which ends around a light-year from The Sun and is deemed the (current) "edge" of the solar system. The "void" may be pun on density of that "cloud" - the number of bodies in it may be huge, but given its size, it's mostly empty.
*Crystal sphere holding the fixed stars – this refers to historical ideas about the universe, particularly the {{w|Ptolemaic system}}, in which the stars were supposed to be fixed on a {{w|Celestial spheres|large crystal sphere}} around the Earth. It might also be referencing "{{w|The Crystal Spheres}}", a short story by David Brin, in which humanity's first interstellar ship shatters a previously undetected, protective barrier around the solar system. It may also be a reference to the Dungeons and Dragons setting "{{w|Spelljammer}}".
*Total count above reaches 16 exits from the solar system vs. 22 in the comic itself.

See also [http://arstechnica.com/science/2013/03/voyager-probes-key-transition-remains-mysterious/ Voyager over the “heliocliff,” but Solar System transition mysterious] article on Ars Technica.

==Transcript==
:[A heading at the top of a white panel, then a line and below this 22 tally marks in two rows, four times five (three of these at the top) and then two extra.]
:Number of times ''Voyager 1'' has left the Solar System

{{comic discussion}}

[[Category:Charts]]
[[Category:Space probes]]
[[Category:Astronomy]]

1189: Voyager 1

2016-07-07T18:58:49Z

Xseo:

{{comic
| number = 1189
| date = March 22, 2013
| title = Voyager 1
| image = voyager_1.png
| titletext = So far Voyager 1 has 'left the Solar System' by passing through the termination shock three times, the heliopause twice, and once each through the heliosheath, heliosphere, heliodrome, auroral discontinuity, Heaviside layer, trans-Neptunian panic zone, magnetogap, US Census Bureau Solar System statistical boundary, Kuiper gauntlet, Oort void, and crystal sphere holding the fixed stars.
}}

==Explanation==
''{{w|Voyager 1}}'' is a U.S. space probe launched in 1977 to study the outer reaches of the {{w|Solar System}} and beyond. Popular press has on several occasions announced that it "has left the solar system" at each point when a boundary has been confirmed or a major event has taken place. This underscores the fact that there is no strictly defined and recognizable boundary of the solar system, or at least we haven't found one yet.

On the day of this comics release (2013-03-22) it was announced that [https://web.archive.org/web/20130322025117/http://www.agu.org/news/press/pr_archives/2013/2013-11.shtml Voyager 1 had entered a new region of space]. At this point Voyager 1 had passed {{w|Voyager_1#Heliopause|through the Heliopause}} and entered the {{w|Interstellar medium}}, although this latter was {{w| Voyager_1#Interstellar_medium|first confirmed}} about half a year later in September 2013.

The chart shows that Voyager 1 has left the Solar System 22 times, but in the title text only 16 are mentioned.

The title text lists several such possible boundaries, (and how many times Voyager 1 has passed them) together with fictive humorous ones:

'''Real boundaries''':
*Three times:
**The {{w|termination shock}} – the point in the heliosphere where the solar wind slows down to subsonic speed (relative to the star) because of interactions with the local interstellar medium. When exactly Voyager 1 {{w|Voyager_1#Termination_shock|passed the Termination shock}} is not clear and on Wikipedia there is given dates of 2003, 2004 and 2005. The final estimate was that it happened late in 2004. (Thus fitting with three times).
*Twice:
**The {{w|Heliopause (astronomy)|heliopause}} – the theoretical boundary where the Sun's solar wind is stopped by the interstellar medium. It was first reported in 2012 that Voyager 1 had {{w|Voyager_1#Heliopause|reached the Heliopause}}, but first on the day of this comics release was it officially announced that it had passed through to the interstellar medium. (Thus fitting with two times).

'''The rest (11) once only:'''
*The {{w|heliosphere}} – a region of space dominated by Earth's Sun, a sort of bubble of charged particles in the space surrounding the Solar System - we live inside this region. At its boundary there are three named borders which are the real ones mentioned before and after this in the title text. From inside to out they are: The termination shock, the heliosheath and the heliopause. The reason the other two are mentioned first is that they have occurred more than once, and the list begins with those for that reason. As these other three borders are also part of the heliosphere, with the heliopause being the outer border of the heliosphere, then Voyager 1 will have left the heliosphere at the same time as it left the heliopause.
*The {{w|heliosheath}} – the region of the heliosphere beyond the termination shock. It was confirmed that Voyager 1 {{w|Voyager_1#Heliosheath|passed through this}} at the end of 2010, so this occurred two yreas before the Heliopause was reached. But since it only happened once, it is mentioned after the first two, and maybe after the heliosphere because it is inside this region?

'''Fictional boundaries''':
*Heliodrome – yet another composition of ''helios'' "sun," here together with ''dromos'' "course". There is no astronomical object with this name, but it has been used variously in other contexts. One that became famous is a sports hall which was used as a concentration camp in the Bosnian war, see {{w|Heliodrom camp}}.
*Auroral discontinuity - another fictitious astronomic object, for ''auroral'' see {{w|Aurora (astronomy)}}.
*{{w|Heaviside layer}} – a layer of ionized gas occurring between roughly 90–150 km (56–93 mi) above the ground in the Earth's atmosphere. Popularly recognized for its use as a reference to Heaven in the writings of {{w|T. S. Eliot}} adapted into {{w|Andrew Lloyd Webber}}'s musical ''{{w|Cats (musical)|Cats}}''.
*Trans-Neptunian panic zone – this fictional zone combines the word from two subjects: "Trans–Neptunian" is used in astronomy to describe stuff that occurs beyond the planet Neptune. In {{w|Outdoor education}} the "panic zone" is the opposite of the {{w|comfort zone}} when trying to learn new stuff.
*{{w|Ignition magneto|Magnetogap}} – part of an {{w|ignition system}}.
*US Census Bureau Solar System statistical boundary – a fictive boundary supposedly defined by the {{w|United States Census Bureau}}, similarly to how it defines {{w|Census tract|census areas}} for the purpose of processing statistical data about regions in the United States. I'm this case, the Bureau's boundary for determining the population of the solar system.
*Kuiper gauntlet – this is a play on the {{w|Kuiper belt}}, which is a region of the Solar System beyond the planets, extending from the orbit of Neptune (at 30 AU) to approximately 50 AU from the Sun, notable for being full of asteroids; replacing the word "belt" with "{{w|gauntlet (glove)}}" (often spelled 'gantlet') which is a protective glove as well as "{{w|gauntlet (punishment)}}" which is a medieval punishment where one would be forced to run through two lines of men who would hit the punishee.
*Oort void – refers to the {{w|Oort cloud}}, a gigantic "cloud" of materials (mainly composed of ice) which ends around a light-year from The Sun and is deemed the (current) "edge" of the solar system. The "void" may be pun on density of that "cloud" - the number of bodies in it may be huge, but given its size, it's mostly empty.
*Crystal sphere holding the fixed stars – this refers to historical ideas about the universe, particularly the {{w|Ptolemaic system}}, in which the stars were supposed to be fixed on a {{w|Celestial spheres|large crystal sphere}} around the Earth. It might also be referencing "{{w|The Crystal Spheres}}", a short story by David Brin, in which humanity's first interstellar ship shatters a previously undetected, protective barrier around the solar system. It may also be a reference to the Dungeons and Dragons setting "{{w|Spelljammer}}".
*Total count above reaches 16 exits from the solar system vs. 22 in the comic itself.

See also [http://arstechnica.com/science/2013/03/voyager-probes-key-transition-remains-mysterious/ Voyager over the “heliocliff,” but Solar System transition mysterious] article on Ars Technica.

==Transcript==
:[A heading at the top of a white panel, then a line and below this 22 tally marks in two rows, four times five (three of these at the top) and then two extra.]
:Number of times ''Voyager 1'' has left the Solar System

{{comic discussion}}

[[Category:Charts]]
[[Category:Space probes]]
[[Category:Astronomy]]

Talk:1703: Juno

2016-07-06T17:08:15Z

Xseo:

According to http://www.space.com/18383-how-far-away-is-jupiter.html it is about 600 million miles to Jupiter, and according to http://www.space.com/18477-how-far-away-is-saturn.html it is about 1.7 billion miles to Saturn. So they went the distance to Saturn but ended up in Jupiter. They must have gone i pretty long circles to go 1.7 billion miles to get 600 million miles away. [[User:Aquaplanet|Aquaplanet]] ([[User talk:Aquaplanet|talk]]) 14:46, 6 July 2016 (UTC)

: That's 1.7 billion ''kilometers''. They lost the {{w|Mars Climate Orbiter}} that way. [[User:.42|.42]] ([[User talk:.42|talk]]) 15:38, 6 July 2016 (UTC)

: Actually, the space.com website does say Saturn is 1.7 billion miles away ''at its furthest'', just as Jupiter is 600 million miles at its furthest. In either case, interplanetary travel isn't a matter of taking the shortest route. Yes, Juno went 1.7 billion miles to go to Jupiter (anywhere from 365 million to 600 million miles away, currently 370 million according to Google), because it was the easiest / most cost effective (in terms of fuel) way to get there. --[[User:Mr. I|Mr. I]] ([[User talk:Mr. I|talk]]) 15:47, 6 July 2016 (UTC)

:: Jupiter is actually 872 million km away right now, which just happens to be roughly the current distance to Saturn if kilometers are confused with miles. [[User:.42|.42]] ([[User talk:.42|talk]]) 16:18, 6 July 2016 (UTC)

Of course anyone who has bought a used car off Autotrader will know that how far away something is doesn't necessarily correlate particularly well to how far you have to go to get there [[Special:Contributions/141.101.98.59|141.101.98.59]] 14:57, 6 July 2016 (UTC)

Several sources have reported that Juno arrived at its Jupiter orbit 1 second off schedule http://www.usatoday.com/story/tech/nation-now/2016/07/06/how-juno-arrived-jupiter-one-second-off-schedule/86745128/. --[[Special:Contributions/108.162.221.13|108.162.221.13]] 15:33, 6 July 2016 (UTC)

: I was going to come here to ask "Did they really make it within one second? And how do they decide when it is 'in orbit'?", but in that article is a quote "We hit our burn targets within one second" which makes sense - 'in orbit' starts when the engines turn off after the last course correction.
::If Kerbal Space Program has taught me anything, it's that you're "in orbit" from the moment the projected trajectory both no longer intersects with a planet, and puts your craft on a path that remains permanently within the target object's gravity well.[[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 17:08, 6 July 2016 (UTC)

== Who says what in the title text? ==

Given that Juno was connected to both Jupiter and Saturn, the point of the title text is a little obscure. However, it seems fairly clear to me that the first question ("The name wasn't a tip-off?") is supposed to come from the NASA team (i.e., "it didn't tip you off that we were aiming for Saturn?") and that the reply is supposed to come from the press. NASA named the probe. NASA decided where to send it. It makes no sense for the press to ask that first question, or for NASA to assume it was named after Juneau or guess that gravity assist "must be more efficient or something". Kynde appears to disagree with me, however, so perhaps some other people could weigh in and give their views. [[User:Garik|Garik]] ([[User talk:Garik|talk]]) 16:51, 6 July 2016 (UTC)

Talk:1703: Juno

2016-07-06T17:08:03Z

Xseo:

According to http://www.space.com/18383-how-far-away-is-jupiter.html it is about 600 million miles to Jupiter, and according to http://www.space.com/18477-how-far-away-is-saturn.html it is about 1.7 billion miles to Saturn. So they went the distance to Saturn but ended up in Jupiter. They must have gone i pretty long circles to go 1.7 billion miles to get 600 million miles away. [[User:Aquaplanet|Aquaplanet]] ([[User talk:Aquaplanet|talk]]) 14:46, 6 July 2016 (UTC)

: That's 1.7 billion ''kilometers''. They lost the {{w|Mars Climate Orbiter}} that way. [[User:.42|.42]] ([[User talk:.42|talk]]) 15:38, 6 July 2016 (UTC)

: Actually, the space.com website does say Saturn is 1.7 billion miles away ''at its furthest'', just as Jupiter is 600 million miles at its furthest. In either case, interplanetary travel isn't a matter of taking the shortest route. Yes, Juno went 1.7 billion miles to go to Jupiter (anywhere from 365 million to 600 million miles away, currently 370 million according to Google), because it was the easiest / most cost effective (in terms of fuel) way to get there. --[[User:Mr. I|Mr. I]] ([[User talk:Mr. I|talk]]) 15:47, 6 July 2016 (UTC)

:: Jupiter is actually 872 million km away right now, which just happens to be roughly the current distance to Saturn if kilometers are confused with miles. [[User:.42|.42]] ([[User talk:.42|talk]]) 16:18, 6 July 2016 (UTC)

Of course anyone who has bought a used car off Autotrader will know that how far away something is doesn't necessarily correlate particularly well to how far you have to go to get there [[Special:Contributions/141.101.98.59|141.101.98.59]] 14:57, 6 July 2016 (UTC)

Several sources have reported that Juno arrived at its Jupiter orbit 1 second off schedule http://www.usatoday.com/story/tech/nation-now/2016/07/06/how-juno-arrived-jupiter-one-second-off-schedule/86745128/. --[[Special:Contributions/108.162.221.13|108.162.221.13]] 15:33, 6 July 2016 (UTC)

: I was going to come here to ask "Did they really make it within one second? And how do they decide when it is 'in orbit'?", but in that article is a quote "We hit our burn targets within one second" which makes sense - 'in orbit' starts when the engines turn off after the last course correction.
::If Kerbal Space Program has taught me anything, it's that you're "in orbit" from the moment the projected trajectory both no longer intersects with a planet, and puts your craft on a path that remains permanently within the target object's gravity well.

== Who says what in the title text? ==

Given that Juno was connected to both Jupiter and Saturn, the point of the title text is a little obscure. However, it seems fairly clear to me that the first question ("The name wasn't a tip-off?") is supposed to come from the NASA team (i.e., "it didn't tip you off that we were aiming for Saturn?") and that the reply is supposed to come from the press. NASA named the probe. NASA decided where to send it. It makes no sense for the press to ask that first question, or for NASA to assume it was named after Juneau or guess that gravity assist "must be more efficient or something". Kynde appears to disagree with me, however, so perhaps some other people could weigh in and give their views. [[User:Garik|Garik]] ([[User talk:Garik|talk]]) 16:51, 6 July 2016 (UTC)

Talk:1689: My Friend Catherine

2016-07-05T07:52:06Z

Xseo:

I can't get any work done because My Friend Catherine is sitting on my leopard. [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 15:07, 3 June 2016 (UTC)
:I genuinely expected to see leopard in the alt text.[[Special:Contributions/162.158.214.230|162.158.214.230]] 18:03, 3 June 2016 (UTC)
::I also came straight here to write a note on the leopard after seeing the title text, but Mikmek beat me too it ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 19:32, 3 June 2016 (UTC)

I'm not so sure that it does conflict with car->cat. This is "my cat"->to " my friend Catherine", i.e. car->cat->my friend Catherine wouldn't happen. [[Special:Contributions/108.162.237.137|108.162.237.137]] 15:15, 3 June 2016 (UTC)
:You would have to make sure that "my cat" came before "cat" in the script, else it would first replace all cats with cars and thus never see the phrase "my cat".[[Special:Contributions/162.158.214.230|162.158.214.230]] 18:03, 3 June 2016 (UTC)
::The substitution was the other way replacing car with cat, so it is the other way around that if there was some "my car" they would also become my friend Catherine in stead of my cat. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 19:32, 3 June 2016 (UTC)
:::I also don't see how the conflict exists. By that logic, Substitutions 2 would conflict with ''itself'', since it completely swaps "minutes" and "years". [[User:Schiffy|Schiffy]] ([[User_talk:Schiffy|Speak to me]]|[[Special:Contributions/Schiffy|What I've done]]) 14:20, 5 June 2016 (UTC)
::::Agree. Also, it is possible to create a substitution algorithm clever enough not to chain its own replacements, I don't think that note is relevant, removing it for now. [[User:Jaalenja|Jaalenja]] ([[User talk:Jaalenja|talk]]) 14:27, 5 June 2016 (UTC)
:This whole conversation confused me further than it needed to. I'm going to disable substitutions on this site from now on. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 07:52, 5 July 2016 (UTC)

Being a dog person, my dog-->my friend Doug would also be a fun substitution. [[User:Jake|Jake]] ([[User talk:Jake|talk]]) 15:43, 3 June 2016 (UTC)

Is the cat-on-my-keyboard in the title text possibly a reference to that old Keyboard Cat video?[https://www.youtube.com/watch?v=J---aiyznGQ] [[Special:Contributions/108.162.221.80|108.162.221.80]] 20:06, 3 June 2016 (UTC)
:Don't think so—cats seem to have a tendency to sit on computer keyboards when their owners aren't using them. [[User talk:AgentMuffin|~AgentMuffin]]
::More often when the owners ''are'' using them. [[Special:Contributions/162.158.2.138|162.158.2.138]] 10:54, 5 June 2016 (UTC)
::Especially if it is a laptop, because cats like the warmth. [[Special:Contributions/141.101.70.61|141.101.70.61]] 17:39, 5 June 2016 (UTC)
::Of course. Cats don't have time to sit on keyboards while their owners are using them. [[Special:Contributions/162.158.86.245|162.158.86.245]] 18:55, 5 June 2016 (UTC)

:::Never heard about cats sitting on keyboards, but hearing a lot about cats sitting on tablets. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 19:01, 5 June 2016 (UTC)

For an even creepier substitution, try "great aunt Catherine". [[Special:Contributions/108.162.250.158|108.162.250.158]] 03:06, 4 June 2016 (UTC)

Oh great, I have to change the chrome extension again. [[Special:Contributions/108.162.215.69|108.162.215.69]] 15:18, 4 June 2016 (UTC)--

Talk:1681: Laser Products

2016-05-16T19:58:02Z

Xseo:

Laser jet surgery might be a reference to [http://tvtropes.org/pmwiki/pmwiki.php/Main/ThisAintRocketSurgery rocket surgery]?

What is a laser eye printer and why is it eww ?
It prints eyes... that should be self explanatory.
Could also mean printing on the eye with a laser. Sounds possible but odd.
:People buy colored and patterned contact lenses today, I think a laser eye printer would be used to print those patterns directly onto the eyeball. [[User:N0lqu|-boB]] ([[User talk:N0lqu|talk]]) 15:53, 16 May 2016 (UTC)

The first laser was fired 56 years ago, on 16 May 1960 by [https://en.wikipedia.org/wiki/Theodore_Harold_Maiman Theodore Harold Maiman]. Maybe this comic is a reference? [[Special:Contributions/188.114.109.103|188.114.109.103]] 15:45, 16 May 2016 (UTC)

You don't need to describe how any of these work in detail, just provide a quick description and link them to wikipedia. [[User:Lackadaisical|Lackadaisical]] ([[User talk:Lackadaisical|talk]]) 16:50, 16 May 2016 (UTC)

Laserjet is a trademarked brand of printers from HP. Does it have any meaning beyond the trademark. I know "Inkjet" is a type of printer that sprays a jet of ink onto the paper, but normally one would just say "laser printer" if one isn't referring to an Epson model [[User:Zeimusu|Zeimusu]] ([[User talk:Zeimusu|talk]]) 19:15, 16 May 2016 (UTC)

"Laser-mounted jet aircraft"... surely you meant jet aircraft-mounted laser? I'll leave this how it is for a day or two in case I'm missing something. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 19:58, 16 May 2016 (UTC)

Talk:275: Thoughts

2016-04-29T12:49:28Z

Xseo:

Miss Lenhart? [[Special:Contributions/108.162.216.45|108.162.216.45]] 03:04, 15 December 2013 (UTC)
: Generic Female Parent, more like. -Pennpenn [[Special:Contributions/162.158.2.221|162.158.2.221]] 04:55, 16 June 2015 (UTC)
: Yeah, where's the indication that this is Miss Lenhart? [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 12:49, 29 April 2016 (UTC)

Talk:1667: Algorithms

2016-04-13T11:54:34Z

Xseo:

How can an excel spreadsheet be complicated? [[Special:Contributions/108.162.244.85|108.162.244.85]] 04:52, 13 April 2016 (UTC
:See this example http://arstechnica.com/gaming/2013/04/how-an-accountant-created-an-entire-rpg-inside-an-excel-spreadsheet/ {{unsigned ip|108.162.216.82}}
:: Oh my [[User:Nk22|The Twenty-second. The Not So Only. The Nathan/Nk22]] ([[User talk:Nk22|talk]]) 10:36, 13 April 2016 (UTC)

Leftpad is a reference to the recent incident where a developer unpublished all his libraries from the NodeJS Package Manager, causing much disruption: http://www.theregister.co.uk/2016/03/23/npm_left_pad_chaos/ [[Special:Contributions/162.158.85.231|162.158.85.231]] 05:58, 13 April 2016 (UTC)

In the off chance that this is referencing an actual spreadsheet, and if anyone has a link, please post it in my talk page. (And in the article of course, but talk page first) [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 06:45, 13 April 2016 (UTC)

The remark about quicksort's efficiency doesn't make sense. It's still the most common and practical general sorting algorithm. It's about as efficient you can typically get except in specialized cases or with some specific type of data. Should be removed imo. [[Special:Contributions/141.101.81.121|141.101.81.121]] 08:52, 13 April 2016 (UTC)

Added a [Citation Needed] for the excel based RPG. More so I can read about it/play it than anything else.. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 09:07, 13 April 2016 (UTC)
:Thank you whoever put that in [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 11:54, 13 April 2016 (UTC)

Added a bit to the church line. Just because you only see what happens on Sunday morning, for one hour, doesn't mean there's not more happening just beneath the surface. The classroom list at our church looks like a professional buildings office directory, and I know of members having to choose between two activities because both meet, or practice, at the same time. For instance, I know of a prospective AV team member who will never be a full time AV member, because she's a Soprano and already in Bells. (AV is setting up and debugging while the choir is practicing, and naturally it's hard to run a mixer or video switcher from the choir loft.)

Mind you, it's still hyperbole, but not to the degree previously given in the explanation.

Talk:1667: Algorithms

2016-04-13T11:54:10Z

Xseo:

How can an excel spreadsheet be complicated? [[Special:Contributions/108.162.244.85|108.162.244.85]] 04:52, 13 April 2016 (UTC
:See this example http://arstechnica.com/gaming/2013/04/how-an-accountant-created-an-entire-rpg-inside-an-excel-spreadsheet/ {{unsigned ip|108.162.216.82}}
:: Oh my [[User:Nk22|The Twenty-second. The Not So Only. The Nathan/Nk22]] ([[User talk:Nk22|talk]]) 10:36, 13 April 2016 (UTC)

Leftpad is a reference to the recent incident where a developer unpublished all his libraries from the NodeJS Package Manager, causing much disruption: http://www.theregister.co.uk/2016/03/23/npm_left_pad_chaos/ [[Special:Contributions/162.158.85.231|162.158.85.231]] 05:58, 13 April 2016 (UTC)

In the off chance that this is referencing an actual spreadsheet, and if anyone has a link, please post it in my talk page. (And in the article of course, but talk page first) [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 06:45, 13 April 2016 (UTC)

The remark about quicksort's efficiency doesn't make sense. It's still the most common and practical general sorting algorithm. It's about as efficient you can typically get except in specialized cases or with some specific type of data. Should be removed imo. [[Special:Contributions/141.101.81.121|141.101.81.121]] 08:52, 13 April 2016 (UTC)

Added a [Citation Needed] for the excel based RPG. More so I can read about it/play it than anything else.. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 09:07, 13 April 2016 (UTC)
Thank you whoever put that in [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 11:54, 13 April 2016 (UTC)

Added a bit to the church line. Just because you only see what happens on Sunday morning, for one hour, doesn't mean there's not more happening just beneath the surface. The classroom list at our church looks like a professional buildings office directory, and I know of members having to choose between two activities because both meet, or practice, at the same time. For instance, I know of a prospective AV team member who will never be a full time AV member, because she's a Soprano and already in Bells. (AV is setting up and debugging while the choir is practicing, and naturally it's hard to run a mixer or video switcher from the choir loft.)

Mind you, it's still hyperbole, but not to the degree previously given in the explanation.

Talk:1667: Algorithms

2016-04-13T09:07:57Z

Xseo:

1667: Algorithms

2016-04-13T09:07:04Z

Xseo:

{{comic
| number = 1667
| date = April 13, 2016
| title = Algorithms
| image = algorithms.png
| titletext = There was a schism in 2007, when a sect advocating OpenOffice created a fork of Sunday.xlsx and maintained it independently for several months. The efforts to reconcile the conflicting schedules led to the reinvention, within the cells of the spreadsheet, of modern version control.
}}

==Explanation==
{{incomplete|Still need an explanation of the title text, and perhaps some expanded definitions of the listed algorithms.}}
An algorithm is a basic set of instructions for performing a task, usually on a computer. This comic lists some algorithms in increasing order of complexity.

At the simplest end is '''left-pad''', or adding filler characters on the left end of a string to make it a particular length. In many programming languages, this is one line of code. This is a reference to a [http://www.haneycodes.net/npm-left-pad-have-we-forgotten-how-to-program/ recent incident] when a package implementing this function was unpublished from the {{w|Npm (software)|NodeJS Package Manager}}, after which a huge number of programs which used this third-party library for such a simple function instead of programming it on their own, ceased to function.

Next is '''{{w|Quicksort}}''', a classic way to sort a list of items.

'''{{w|Git (software)|Git}}''' is a version control program, i.e. software that allows multiple people to work on the same files at the same time. When someone finalizes ("commits") their changes, the version control program needs to figure out how to join the new content with the existing content. This process is called '''merging''', and the algorithm for it is anything but simple.

'''{{w|Self-driving car}}''' is what it says on the tin: an automobile with sensors and software built into it so that it can maneuver in traffic autonomously, i.e. without a human controller. Various companies have been working on such vehicles for many years now, and while they're further along now than would have been imaginable even a couple of years ago, we're still far away from the dream of hopping in a driverless taxi and sitting back as the car itself navigates to where we want to be.

The '''{{w|Google Search}} backend''' is what enables you to type "the heck is a leftpad algorithm" into your browser and have Mr. Google return a list of relevant results, including correcting "leftpad" to "left-pad", ignoring the "what the heck" part, and sometimes even summarizing the findings into a box at the top of the results. Behind all that magic is a way to remember what pages the internet contains, which is just a mind-bogglingly large quantity of data, and an even more mind-numbingly complex set of algorithms for processing that data.

The last item is the punchline: a sprawling Excel spreadsheet built up over 20 years by a church group in Nebraska to coordinate their scheduling. Spreadsheets are a general {{w|End-user development|end-user development}} programming technique, and therefore people use Excel for all sorts of purposes that have nothing to do with accounting (its original purpose), including one guy who made a role-playing game that runs in Excel{{Citation needed}}; but even that doesn't approach the complexity that develops when multiple people of varying levels of experience use a spreadsheet over many years for the purpose of coordinating the schedule of several coordinated groups.

The scheduling of tasks over a group of resources (a.k.a. the ''{{w|Nurse scheduling problem|nurse scheduling problem}}''), while respecting the constraints set by each person, is a {{w|NP-hardness highly complex}} problem requiring stochastic or heuristic methods for its resolution. Here, the algorithm would be further complicated by being solved by inexpert users over a spreadsheet model without using engineering practices. The hyperbole here is in thinking that such combination of circumstances would produce complexity far over that required to drive a car or sort the public contents of the internet.

In the title text, part of the spreadsheet's complexity is described as originating from different versions of the file for different programs. The words used like schism and sect are normally used in context of religions splitting into groups about differences in believe questions. This refers on one hand to the church group handling the spreadsheet. But in this case the group split up over the use of open source software and not believe questions. On the other hand discussions on open source software are sometimes led like religious debates.

==Transcript==
'''Algorithms''' By Complexity
{|
|colspan="6" style="text-align:left;border-bottom:1px solid;"|More complex →
|- style="vertical-align:top;"
|style="padding-right:2em;"|Leftpad
|style="padding-right:2em;"|Quicksort
|style="padding-right:2em;"|GIT Merge
|style="padding-right:2em;"|Self- driving car
|style="padding-right:8em;"|Google Search backend
|Sprawling Excel spreadsheet built up over 20 years by a church group in Nebraska to coordinate their scheduling
|}

{{comic discussion}}


[[Category:Charts]]

1567: Kitchen Tips

2016-04-12T21:40:02Z

Xseo: Removed unnecessary references to Greek plumbing.

{{comic
| number = 1567
| date = August 21, 2015
| title = Kitchen Tips
| image = kitchen_tips.png
| titletext = Household tip: Tired of buying so much toilet paper? Try unspooling the paper from the roll before using it. A single roll can last for multiple days that way, and it's much easier on your plumbing.
}}

==Explanation==
In this comic, [[Cueball]] appears to be hosting a show (or be in an ad) giving out kitchen advice. He starts with a reasonable tip to use a meat thermometer instead of guessing when meat is cooked. His later tips, though, are little more than telling how to complete normal kitchen activities performed using common sense. Moreover, in most cases he repeats "If you're anything like me," suggesting he's actually ''done'' these things in his kitchen. This is a parody of many commercials and infomercials that [http://tvtropes.org/pmwiki/pmwiki.php/Main/TooIncompetentToOperateABlanket imply their consumers have no basic motor skills or common sense] in order to make their product more appealing.

The first tip he gives is reasonable because, though the use of a meat thermometer is fairly well known, not everybody goes to the trouble of using one. To determine if meat is done cooking, one can either guess or use a meat thermometer to check that the internal temperature has reached the correct level to render meat safe for consumption. Many people don't own a meat thermometer and rely on an alternative solution that doesn't require special equipment (such as testing by feel, cutting the meat open to check its doneness, checking the color of the juices after pricking the meat with skewer, or simply guessing).

The second panel shows that Cueball throws away dishes and buys new ones every time they are used. This is perfectly normal if the plates are disposable plates made of paper or Styrofoam, but we see his trashcan is filled with chipped glasses and ceramic plates. Naturally, this would be a very expensive practice. The virtually universal chore of "washing the dishes," is one Cueball presumes the audience is heretofore unaware of.

Cooking on a stove is typically done placing the food into a pot or pan which is placed on the burner. Cueball seems to suggest that the use of a pan is a tip most people would be unaware of, suggesting that most people cook eggs directly on the burners themselves, a method that is likely to burn the food and create a great mess. Cueball's stove has T-shape raised burners (probably gas, but might be electric), making the task very impractical, though owners of glass-top electric stoves could conceivably cook directly on the glass surface.

Ice is usually made by filling an ice cube tray with water and leaving it in a freezer for several hours. Cueball, however, sprays a hose directly into his freezer compartment and quickly slams the door shut to trap some water inside. (This would work somewhat better in the type of freezer that has a door on the top, so it could be filled with water and the door would not need to be closed to trap the water inside.) While this unorthodox method ''will'' make ice, it will result in a large sheet of ice on the bottom of the freezer. More importantly, it will also make it impossible to actually use the freezer to hold anything else (unless you were to put anything in beforehand and you don't mind breaking through a block of ice to get it out). Also, ice expands as it cools (it is one of the few substances with a negative coefficient of thermal expansion), and its expansion might push the freezer door open.

The title text suggests using toilet paper a few sheets at a time, which is how most people use it. Cueball, however, seems to suggest that most people use the entire roll as a single object without unspooling it and then flushing it whole, using at least one roll each time they use the bathroom. This is economically impractical, and is prone to clogging the toilet and the plumbing if you throw the toilet paper away by putting it into the toilet and flush it.

This comic is clearly related to the [[:category:Protip|Protip category]], but as the exact word is not mentioned in this comic so it cannot itself be given this category.

==Transcript==
:[Cueball at a kitchen counter, holding a meat thermometer.]
:Cueball: If you're anything like me, you may have trouble telling when meat is fully cooked.
:Cueball: Instead of guessing, try a meat thermometer!

:[Cueball at a sink, holding a dirty dish, with a trashcan next to him full of broken ceramics and glasses.]
:Cueball: If you're anything like me, you probably throw away your plates and glasses when they get dirty. But if you clean them, they can often be used again!

:[Cueball cracking an egg over a pan on a hot stove.]
:Cueball: Making scrambled eggs? Put a pan under them!
:Cueball: It's easier, and it keeps your burners clean.

:[Cueball holding a garden hose, spraying it into the freezer compartment of a freezer.]
:Cueball: If you're anything like me, you make ice by spraying a hose into your freezer and then slamming it shut.
:Cueball: But there's a better way...

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Food]]

1651: Robotic Garage

2016-03-04T14:16:07Z

Xseo:

{{comic
| number = 1651
| date = March 4, 2016
| title = Robotic Garage
| image = robotic_garage.png
| titletext = But listen, if getting your car out from under the pile is REALLY important to you, we do have an axe you can borrow.
}}

==Explanation==
{{incomplete|Any references in the "Robots aren't magic" quote. And any reason/reference for choosing an axe to get a car out of a pile. Seems like a useless tool in the situation.}}

In some cities, {{w|automated parking system}}s (aka robotic garages) are used to reduce the amount of space needed to store cars, as opposed to traditional parking buildings. The robotic system eliminates the needs for ramps and circulation/reversing areas. Normally, they work by having the user drive their car onto an elevator and get out, after which the elevator lifts or lowers the car into a compact storage space. Here [[Cueball]] drives up to what he believes to be a garage of this type operated by [[Black Hat]]. However, instead of an elevator carefully moving it into a storage space, a robotic claw simply picks up the car and dumps it in a bin of cars.

This type of parking options will not only break the car, but also make it impossible to take out if the car is at the bottom, hence the cars are ''{{w|Stack_(abstract_data_type)|stacked}}''.

Cueball reacts quite well to this treatment of his car, (maybe he knows Black Hat well enough not to try to argue with him?) And when Black Hat tells him that later they just dump out the bin (full of cars) and he can then pick his own our from the pile. This is of course not possible with such heavy objects. Had it only been the keys then... Cueball continues to be benign about this absurd situation, which becomes even more absurd when he asks if Black Hat could at least make sure his car is not at the bottom (when it is dumped out with all the other cars). But Black Hat falls back on his excuse: ''Robots aren't magic''.

In the title text he at least gives Cueball an option, he can borrow an axe, if it is really important for him to get the car out from the pile. He thus gives Cueball "permission" to destroy any other car that lies in the way on top of his own... Still it would not help much, because if his car is at the bottom, it will be even more destroyed than from just being dumped into the bin to begin with.

This is just one of many situations where Black Hat has an evil or just mean/crazy plan in progress. It's for instance not the first time that Black Hat has treated other peoples car with great disrespect, although in [[562: Parking]], the guy with the car had it coming!

==Transcript==
:[Black Hat points left while talking to Cueball inside his small car.]
:Black Hat: Just pull onto the receiving platform.
:Cueball: Cool-I've always wanted to try one of these futuristic robotic garages.

:[Cueball has driven the car onto a platform in front of a stop to the left. He is just walking of the platform towards Black Hat.]

:[Zoom out reveals a robotic crane arm, that sits on top of the stop from the previous panel, which turns out to be a huge platform for this robot arm. The robotic arm picks up the car with it's two thongs and just lift it straight up in the air with a thong on the hood and the other below the car. Black Hat and Cueball look on.]
:Cueball: Um.

:[This panel pans over to the center of the robotic arm, to reveal a large bin with a label to the robots left. The robot arm holds the car almost straight up in the air, but over the bin.]
:Label: Cars

:[The robotic arm open up to release the car which crashes down into the bin, a sound already emanating from it when the rear end of the car (with one wheel still showing) is still visible.]
:Car: ''Crunch''
:Label: Cars

:[Zoom back to Black Hat and Cueball standing at the end of the empty platform.]
:Black Hat: We'll dump out the bin when you get back and you can pick out your car from the pile.
:Cueball: Can you at least make sure it's not on the bottom
:Black Hat: Look, robots aren't magic.

{{comic discussion}}

[[Category:Comics featuring Black Hat]]
[[Category:Comics featuring Cueball]]
[[Category:Robots]]

1649: Pipelines

2016-03-01T14:07:40Z

Xseo:

{{comic
| number = 1649
| date = February 29, 2016
| title = Pipelines
| image = pipelines.png
| titletext = In the future, every single pipeline will lead to the bowl of a giant blender, and we'll all just show up with a bucket each day to take our share of the resulting smoothie.
}}

==Explanation==
{{incomplete|The table with all the items should be filled out with explanations etc. and the diameter should be calculated from real data (with references).}}

Follows a similar idea to the [[what if?]] {{what if|147|Niagara Straw}}, (from three days before this comic's release), where the entire water flow over {{w|Niagara Falls}} is imagined to flow through a straw (i.e. 7 mm diameter with disastrous results).

In this comic [[Randall]] imagines what size pipes are necessary to carry US domestic production/consumption of various fluids if the flow rate were fixed at 4 meters per second. Randall notes that "many pipes would overlap", owing to the fact that consumption of one item as corn syrup would be due to the production of one of the others, in this case soda pop (another example, than the previous one which is actually mentioned in the comic, could be gasoline which is produced from petroleum ).

The top panel is in [http://store-xkcd-com.myshopify.com/products/actual-size-stickers actual size] (something Randall often jokes about but here he means it). This means that if you look at the image in actual size (or measure lengths in the full size image) then the measured diameter is the diameter Randall has calculated the pipe should be, based on his data for the consumption of these substances.

In the second panel the pipes are too big for his drawing. To indicate the scale he has both inserted a human (appearance like [[Megan]], but with blonde hair, i.e. not Megan) and the top panel has been shrunk down to indicate how much larger the bottom panel is (this is similar to the link between the panels in [[980: Money]]). Using the size of the top panel and the smaller insert, it can be found that the scale is 20:1. (The woman is 9 cm high in the image, which makes her 180 cm -- 5 feet 11 inches -- in "real life"). The pipe next to her for gasoline would be 2.2 m high.

Since the caption at the top mentions both fluid produced and consumed in the US it becomes very difficult to find out which number Randall uses. For instance the consumption of wine in the US and the production of wine in the US is not necessarily the same as wine is both imported and exported. Should there then be two pipes? Unlike similar comics (like Money mentioned above) there are no references for where Randall has the data for this comic.

As usual with xkcd, the absurdity -- and improbability -- of routing the entirety of each fluid through a single pipe at any point is the source of humor. In addition, despite Randall's stated assumption that all the fluids are magically flowing at the same rate as public water (4 meters per second), many could never actually do so; some "fluids" shown are too viscous (e.g. peanut butter, Silly Putty, meat), adhesive (e.g. maple syrup), or thermally impractical (e.g. glass, cheese, ice cream and yogurt). Lastly, many are just plain zany (e.g. saliva a reference to another what if? {{what if|144|Saliva Pool}}). Note that at the bottom of the last panel there is a much larger pipe for the tap water used by the public. All substances are listed below in the [[#Table|table]].

The title text refers to a possible future based on the idea of this comic in which all the pipes with the above mentioned fluids will actually lead into the same hole as shown in the top right panel. This hole will then be the bowl of a giant blender that mixes all these substances together to a toxic ''{{w|smoothie}}''. The future people will then just come up to this blender and get a bucket full of this mix each day. The resulting ''smoothie'', as it is, would be deadly to consume, as the largest part of it other than water is petroleum and gasoline.

Note: "Soup" has been left out, and it might have been expected in this comic due to the similarity to this system with [[Beret Guy|Beret Guy's]] use of a "soup outlet" as an entrepreneur in [[1293: Job Interview]]. It is probably a larger pipeline than salsa and possibly even ketchup. However, most soup is probably not bought finished, and this is a very good reason to not include it in the chart. But still the idea of having a soup outlet is very similar to this comic.

===Table===
*All the substances are listed here in the "reading" order also used in the transcript.
*The diameter is for the inner part of the tube.
{| class="wikitable sortable"
|-
|+ All substances with size as found in the picture, vs. size calculated from public information
|-
! scope="col" | Substance
! scope="col" | Size (cm)
! scope="col" | Calculated size (cm)
! scope="col" | Explanation
|-
| {{w|Toothpaste}}
| 3.5
| 3.6
| In the title text of [[1599: Water Delivery]] Randall claims that he as a child could not understand whyt there were no toothpaste pipe to his house when there was one for water... Giving this is at the top, this is a clear reference to this comment. Calculation is based on 542 g/year per capita consumption of toothpaste, which I found [https://www.google.co.il/search?q=toothpaste+consumption+by+country&num=100&espv=2&rlz=1C1VFKB_enIL627IL627&tbm=isch&imgil=2wpGcxkoKlCvAM%253A%253BvrrYrXTGlziE6M%253Bhttp%25253A%25252F%25252Fwww.sanasecurities.com%25252Ftop-story%25252Ffuture-prospect-indian-oral-care-industry&source=iu&pf=m&fir=2wpGcxkoKlCvAM%253A%252CvrrYrXTGlziE6M%252C_&usg=__g9B9_HQ-jLim5P25Ov5d6l6BiNk%3D&biw=1920&bih=955&ved=0ahUKEwjLiMn-op_LAhVD4XIKHcvPCMsQyjcIJA&ei=I27VVovrEsPCywPLn6PYDA#imgrc=2wpGcxkoKlCvAM%3A here]. (Sorry couldn't click the link on my work computer for some reason...) I'm not even sure what year the graph is from, so I guessed 2013, and used 316.5 million estimated 2013 US population to calculate the diameter above.
|-
| {{w|Nail polish}}
| 0.4
|
|
|-
| {{w|Windshield washer fluid}}
| 5.6
|
|
|-
| {{w|Silly putty}}
| 0.1
|
| Smallest diameter
|-
| {{w|Shampoo}}
| 4
|
|
|-
| {{w|Honey}}
| 5.2
|
|
|-
| {{w|Blood donation|Donated blood}}
| 0.9
|
|
|-
| {{w|Vanilla}}
| 0.4
|
| Not the ice but the spice (which is black as the substance in the vanilla pipe).
|-
| {{w|Ketchup}}
| 5.2
|
|
|-
| {{w|Salsa (sauce)|Salsa}}
| 3.6
|
|
|-
| {{w|Sunscreen}}
| 1.35
|
|
|-
| {{w|Personal lubricant}}
| 0.65
|
| Aka Lube
|-
| {{w|LCD liquid}}
| 0.26
|
| For {{w|Liquid-crystal display}}
|-
| {{w|Mayonnaise|Mayo}}
| 4.4
|
| Or mayonnaise
|-
| {{w|Printer ink}}
| 1.4
|
|
|-
| {{w|Maple syrup}}
| 1.8
|
|
|-
| {{w|Hair conditioner|Conditioner}}
| 2.5
|
| For hair
|-
| {{w|Mustard (condiment)|Mustard}}
| 3.7
|
|
|-
| {{w|Liquid soap}}
| 4.7
|
|
|-
| {{w|Olive oil}}
| 6.2
|
| Largest diameter in the upper chart
|-
| {{w|Coffee}}
| 58
|
|
|-
| {{w|Peanut butter}}
| 8.6
|
| Smallest diameter in the bottom chart
|-
| {{w|Ice cream}}
| 20
|
|
|-
| {{w|Cheese}}
| 70
|
| Made from Milk (cow) also in the chart
|-
| {{w|Carbonated water|Soda}}
| 82
|
| As in club soda
|-
| {{w|Acetone}}
| 13.6
|
|
|-
| {{w|Liquor}}
| 15
|
|
|-
| {{w|Gasoline}}
| 220
|
| Made from Petrol also in the chart
|-
| {{w|Yogurt}}
| 15
|
| Made from Milk (cow) also in the chart
|-
| {{w|Milk#Cow.27s_milk|Milk (cow)}}
| 106
|
|
|-
| {{w|Bottled water}}
| 71
|
| See also [[1599: Water Delivery]]
|-
| {{w|Sugar}}
| 42
|
| See also [[1639: To Taste]]
|-
| {{w|Saliva}}
| 85
|
| From these data it could be calculated how long it would take America to drool enough to fill that pool from the what if? {{what if|144|Saliva Pool}}.
|-
| {{w|Wine}}
| 18
| 18.5
| Americans drank just under [https://www.wineinstitute.org/resources/statistics/article86 900 million gallons of wine in 2014], or almost 3.4 million cubic metres per year meaning that Americans drink about 0.11 m3/s. With the pipe flowing at 4m/s this pipe must have an area of 268cm2. The radius of a pipe of area 268cm^2 is 9.25cm. The wine pipe should thus have a diameter of 18.5cm, very close to the one found by measuring on the chart.
|-
| {{w|HFCS}}
| 20
|
| High fructose corn syrup
|-
| {{w|Breast milk|Milk (human)}}
| 10.6
|
|
|-
| {{w|Petroleum}}
| 318
|
| Largest diameter in the bottom chart, except for the public water. Also known as Crude oil. Used to make for instance gasoline also in the chart
|-
| {{w|Meat}}
| 59
|
|
|-
| {{w|Glass}}
| 28
|
|
|-
| {{w|Beer}}
| 54
|
|
|-
| {{w|Tea}}
| 41
|
|
|-
| {{w|Cement}}
| 74
|
|
|-
| {{w|Tap water|Public water}}
| 2550
|
| Using the formula [http://math.stackexchange.com/questions/564058/calculate-the-radius-of-a-circle-given-the-chord-length-and-height-of-a-segment here] it is possible to calculate the diameter of a circle given the chord length = l and height = h of a segment. From the drawing (and scaling) l = 390 cm and h = 15 cm. The formula states that D = h + l2/(4*h) = 15 cm + (390 cm)2/(4*15 cm) = 2550 cm.
|}

==Transcript==
:[Caption above the first main panel, to the left of a smaller panel to the right.]
:<big>The size of the US’s</big>
:<big><big>'''Pipelines'''</big></big>
:<big>if each fluid produced or consumed in the US has to be carried by a single pipe</big>
:Assuming they all flowed at the same speed of about 4m/s
:Note: Many pipelines would overlap (eg. '''soda'''/corn syrup)

:[There is a small panel to the right showing three gray pipes of different sizes leading out over a large hole in the ground. Only a part of the hole can be seen at the bottom left part of the panel, but it curves around indicating it is a large circular hole. The pipes are supported by small legs beneath them and from the end of all three thick liquids are squirting out and down into the hole. The first pipe is by far the largest; the liquid from it is white, but not as white as the background. The second pipe is by far the smallest squirting dark red liquid and the final rightmost pipe is in between and squirts our light brown liquid. Each pipe is labeled. The label on the smallest cannot be read properly, but from the info gained in the next panel it can be inferred for certain what it says (and this is indicated here below):]
:[Large pipe (white)]: Mayo
:[Small pipe (dark red)]: Nail polish
:[Medium pipe (light brown)]: Maple syrup

:[Below is a large panel with a caption at the top. And below this there are twenty circles in different sizes and with different color (or even texture). Each circle is labeled, for the five smallest the label is outside, in one case with an arrow indicating where the label belongs. The rest has the label inside. The text is in black except for four of those with text inside, but with red of black color. Here the text is white. The labels are indicated by color and size, going roughly from top left in reading order based on the position and size of circles not of position of the text:]

:<big>Actual size </big> (When viewed on a typical computer screen) 
:[Medium green blue and white spiral]: Toothpaste
:[Tiny dark red]: Nail polish
:[Big light blue with white specks]: Windshield washer fluid
:[Very tiny purple]: Silly putty
:[Medium light green]: Shampoo
:[Large dark yellow]: Honey
:[Very small blood red]: Donated blood
:[Tiny black]: Vanilla
:[Big red]: Ketchup
:[Medium dark red with chunks of in different green and lighter red colors]: Salsa
:[Small white]: Sunscreen
:[Very small light green]: Personal lubricant
:[Very tiny gray]: LCD liquid
:[Medium off-white]: Mayo
:[Very small black]: Printer ink
:[Small light brown]: Maple syrup
:[Small light green]: Conditioner
:[Medium yellow]: Mustard
:[Large light green]: Liquid soap
:[Big olive green]: Olive oil

:[The panel just described is indicated to fit into a small rectangle at the top left of the next panel below. There are four lines ending at the four corners of this small rectangle, two of these are going to the two bottom corners and the other two ends on the lower part of the panel just above the small rectangle. They are indicated to go under the panel and would hit the two top corners if extrapolated). The 11 largest circles are clearly seen, but most of the other circles can also be noted. The colors are the same but any features in the original circles as well as the labels are gone. The part of the black top frame of the next panel below is faded out to gray in between the section cut off by the two lines going to the bottom corners of the panel above. This rectangle indicated the increasing size compared to the first panel above.]

:[Apart from the insert mentioned above the second panel follows the same layout, but with 22 circles with even larger range of sizes. The panel is more than twice as long as the first panel. A Megan-like girl, but with white hair, is drawn at the top of the panel just left of the middle. Her hair close to the top, just below the line going to the right corner above. There are two medium and five smaller circles to her left and one small close to her head and one huge circle to her right. Her feet are less than a third down this panel standing on top of the next row of circles. In the bottom half of the panel there is a giant circle which almost touches the left side of the panel. There are smaller circles above it and down along the right side. One last circle is to the left almost at the bottom. At the very bottom is a slightly curving line to indicate a much much larger blue circle that only graces the panel (no. 23). There is a small green fish in this water to the left of the label. Below the labels are again listed as above. One label has a foot note. But it is written directly beneath the circle in which it is referenced. So it will be written together with the label on the next line. There is also one case with an arrow used to indicate where the label belongs.]

:[Medium dark gray]: Coffee
:[Very tiny gray]: Peanut butter
:[Very small gray with black specks]: Ice cream
:[Very small yellow with white specks]: Cheese
:[Large brown with white fizzing]: Soda
:[Tiny White]: Acetone
:[Tiny gray]: Liquor
:[Huge dark yellow]: Gasoline
:[Tiny White with blue and orange specks]: Yogurt
:[Big white]: Milk (cow)
:[Large light blue]: Bottled water
:[Small white]: Sugar
:[Large light gray with white specks]: Saliva
:[Very small light yellow]: Wine
:[Very small orange]: HFCS
:[Very tiny white]: Milk (human)
:[Gigantic dark gray]: Petroleum
:[Medium dark red with black texture]: Meat (mostly solid)
:[Small white]: Glass*
::<nowiki>*</nowiki>Solid at room temperature
:[Medium light brown]: Beer
:[Small gray brown]: Tea
:[Large gray]: Cement
:[Gracing bottom of panel light blue]: Public water

==Trivia==
*In addition to the what if? article, the relevancy of pipelines, particularly regarding public water, is heightened due to the ongoing public health crisis in Flint, Michigan, caused by recent (mis-)management of their public water system.
**Studies have shown that temporary use of the Flint River as a water source caused corrosive water to leach lead from old pipes, causing lead poisoning in many residents, particularly children; other ill effects in addition to lead have been noted.
**The crisis has lead to a public outcry against the state "emergency financial management" team appointed and supervised by the state executive (Gov. Rick Snyder and staff) and an outpouring of support from nearby communities such as Metro Detroit via bottled water donations to Flint residents.
*This is the third comic posted on Leap Day (February 29); the previous ones were [[1023: Late-Night PBS]] and [[390: Nightmares]]. If the M-W-F schedule continues, the next such comic will not happen until the year 2036.

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Charts]]
[[Category:Food]]
[[Category:Animals]]

Talk:1618: Cold Medicine

2015-12-18T12:13:14Z

Xseo:

How hard would it actually be to turn street drugs back into cold medicine? [[User:Benjaminikuta|Benjaminikuta]] ([[User talk:Benjaminikuta|talk]]) 05:41, 18 December 2015 (UTC)

- I'm unsure on the actual scientific accuracy of this, given it is a fake paper, but http://heterodoxy.cc/meowdocs/pseudo/pseudosynth.pdf [[Special:Contributions/108.162.221.13|108.162.221.13]] 05:49, 18 December 2015 (UTC)

This is in reference to recent studies that have proven that Phenylephrine is no worse than a placebo.
https://en.wikipedia.org/wiki/Phenylephrine
http://www.annallergy.org/article/S1081-1206(10)60240-2/abstract
[[Special:Contributions/162.158.2.138|162.158.2.138]] 06:53, 18 December 2015 (UTC)

- I keep hearing about this Placebo. It seems like a very potent medicine that is good for everything. Where can you buy it? {{unsigned ip|162.158.90.213}}
:Just get anything that is labeled 'homeopathic'. --[[Special:Contributions/162.158.153.101|162.158.153.101]] 10:55, 18 December 2015 (UTC)
----

I don't think it's suggesting turning meth back to medicine. I think it's a reference to heroin and at least a handful(?) of other now-illegal drugs originally introduced purely as medicinal products. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 12:13, 18 December 2015 (UTC)

Talk:1612: Colds

2015-12-04T13:44:05Z

Xseo:

Just like I have it now. I'm on the day 6 I think... ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 12:42, 4 December 2015 (UTC)
:I'm feeling tired and heavy, did you do this to me!? [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 13:44, 4 December 2015 (UTC)

Talk:327: Exploits of a Mom

2015-11-29T09:49:30Z

Xseo:

What about the daughter's name?[[User:Guru-45|Guru-45]] ([[User talk:Guru-45|talk]]) 14:57, 17 November 2012 (UTC)

:I think that's embellished upon later in a series called l33t. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 15:42, 17 November 2012 (UTC)
:It's for novelty license plates with people's names on them (like "Bort" for example). [[Special:Contributions/199.27.128.67|199.27.128.67]] 18:15, 6 July 2014 (UTC)

After fixing my stupid undo I think this comic is still incomplete: What is the "driver's license factory" at the title text? --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 16:17, 11 June 2013 (UTC)

:The common tale is that someone purchases some item or other with writing on it (or somewhere where writing can appear, on closer examination) and finds that this writing reads "Help, I'm trapped in a <item> factory", or similar, as appropriate to the object concerned. This suggests that someone is trapped (or perhaps even enslaved to work) within such a place and their only hope of escape is to make 'messages in a bottle' out of the product that leaves the facility. This is often extended to various fantastical situations, like the (British only?) joke about the stick of {{w|Rock_(confectionery)|sea-side rock}}.
:(Of course, the writing in sticks of rock generally starts to become unreadable (for normal-sized sticks) for any name larger than "Bridlington", although with care I suppose they've made them with a semi-legible "Western-super-Mare" set through them. But one aspect of this version of the joke could definitely well be that the theoretical SOS message wouldn't legibly fit.)
:So, anyway, Mrs Roberts (who waited for a number of years for Little Bobby Tables to grow up to school-age, for the illustrated exploit) is patiently waiting for her daughter to get to somewhere in her mid-teens, or later, all the while intending that she will get to spoof such a message from the local DMV's license-printing facility at some point. (Turns out that could be as 'soon' as her reaching 14-16 years of age for her first Learner license, depending on state.) Momma Roberts likes playing the long-game, it appears. [[Special:Contributions/178.98.31.27|178.98.31.27]] 16:02, 19 June 2013 (UTC)

:The mouseover text might also be a reference to an easter egg in classic Mac OS, in which the text "Help! Help! We're being held prisoner in a system software factory!" was embedded in the {{w|system suitcase}}. [[Special:Contributions/173.245.50.90|173.245.50.90]] 20:02, 13 April 2014 (UTC)

::Someone should probably put something like this on the actual page instead of just the discussion... [[Special:Contributions/173.245.56.178|173.245.56.178]] 02:23, 11 March 2015 (UTC)

Wasn't there another comic that had the digits of pi with "Help I'm trapped in a universe factory!" included in it? {{unsigned ip|108.162.249.205}}
:Yes, the earlier [[10: Pi Equals]]. [[Special:Contributions/108.162.216.83|108.162.216.83]] 20:32, 29 January 2015 (UTC)

The example talks about a SELECT query (for looking up information in a database), but I think an INSERT query (for inserting new information in the database) makes more sense, because of the closing bracket. A SELECT query is usually of the following form: SELECT column1, coulm2 FROM table WHERE username='somethingsomething'.
An INSERT query is usually of the following form: INSERT INTO table (column1, columns2) VALUES (value1, value2)
In the case of the comic, I think it's reasonable to assume it's the start of the school year and someone is adding the name of a new student (Bobby) to the database, which triggers the exploit.[[Special:Contributions/108.162.228.5|108.162.228.5]] 21:23, 23 March 2015 (UTC) David

I've made an explanation for the title text, if anyone wants to change it to make it less ambiguous or anything, edits are welcome. [[User:StairwayToHenry|StairwayToHenry]] ([[User talk:StairwayToHenry|talk]]) 15:35, 8 April 2015 (UTC)

It seems to me that Bobby doesn't necessarily share her technical savvy or sense of humour, but caused the incident simply through having the name she gave him. [[Special:Contributions/141.101.98.203|141.101.98.203]] 23:47, 23 May 2015 (UTC)

Anyone want to comment on the missing outline from panel 2? [[Special:Contributions/108.162.238.165|108.162.238.165]] 23:48, 27 July 2015 (UTC)someGuy

The explanation says that Bobby Tables got his technical savvy from his mom, however we have no reason to believe that he has any technical savvy at all- this prank was entirely his parents'. He is most likely having his first day of kindergarten, and has no technical savvy at all. [[User:Bbruzzo|Bbruzzo]] ([[User talk:Bbruzzo|talk]]) 13:15, 4 September 2015 (UTC)

Is no one going to notice that his name is Robert Roberts? [[User:Abbyclem|Abbyclem]] ([[User talk:Abbyclem|talk]]) 22:04, 12 September 2015 (UTC)

:... I read all the way down here waiting to see someone mention that, only to find you did it ... about a month ago. On what is now a very old strip. Weird o_O [[Special:Contributions/162.158.39.209|162.158.39.209]] 18:56, 28 October 2015 (UTC)

; Real Life
It might be worth adding under "trivia" that situations similar to the one in the comic actually seem to [https://stackoverflow.com/questions/4456438/how-do-i-correctly-pass-the-string-null-an-employees-proper-surname-to-a-so happen in real life].--[[Special:Contributions/162.158.114.138|162.158.114.138]] 17:50, 22 November 2015 (UTC)

And possibly a warning not to try this on a live system.. a colleague just got fired after XKCD inspired stupidity. ~100% his own fault, but might be worth mentioning. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 09:49, 29 November 2015 (UTC)

Talk:1475: Technically

2015-01-19T13:45:45Z

Xseo: Created page with "Technically, it's poor form and rude to ignore someone based on *Clicks Random page* ~~~~"

Technically, it's poor form and rude to ignore someone based on *Clicks Random page* [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 13:45, 19 January 2015 (UTC)

Talk:1298: Exoplanet Neighborhood

2013-12-02T16:36:54Z

Xseo:

Why the big empty circle around Earth??{{unsigned ip|108.162.231.42}}
:Because they're all far away and he wants to make the reader feel lonely. [[Special:Contributions/108.162.216.30|108.162.216.30]] 13:42, 2 December 2013 (UTC)
So all these other planets are close to each other, but Earth is far from them? Or does the distance between circles have no meaning besides the empty space around Earth's circle?[[Special:Contributions/108.162.216.29|108.162.216.29]] 15:16, 2 December 2013 (UTC)

Why New-New-America? And why not New-New-Netherlands? [[User:Quoti|Quoti]] ([[User talk:Quoti|talk]]) 15:36, 2 December 2013 (UTC)

Changed it to New-New-World, as that makes a lot more sense than New-New-America. The Americas were commonly referred to as the 'New World', and the reference alludes to 'Sailing for the new world'. [[User:Andyd273|Andyd273]] ([[User talk:Andyd273|talk]]) 15:49, 2 December 2013 (UTC)

After staring at this graph for a while, I got a sudden urge to play Osmos... [[User:Andyd273|Andyd273]] ([[User talk:Andyd273|talk]]) 16:03, 2 December 2013 (UTC)

The title seems to have changed to "Exoplanet Neighborhood" and the mouseover text to what used to be the title... [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 16:36, 2 December 2013 (UTC)

Talk:1298: Exoplanet Neighborhood

2013-12-02T16:36:25Z

Xseo:

Why the big empty circle around Earth??{{unsigned ip|108.162.231.42}}
:Because they're all far away and he wants to make the reader feel lonely. [[Special:Contributions/108.162.216.30|108.162.216.30]] 13:42, 2 December 2013 (UTC)
So all these other planets are close to each other, but Earth is far from them? Or does the distance between circles have no meaning besides the empty space around Earth's circle?[[Special:Contributions/108.162.216.29|108.162.216.29]] 15:16, 2 December 2013 (UTC)

Why New-New-America? And why not New-New-Netherlands? [[User:Quoti|Quoti]] ([[User talk:Quoti|talk]]) 15:36, 2 December 2013 (UTC)

Changed it to New-New-World, as that makes a lot more sense than New-New-America. The Americas were commonly referred to as the 'New World', and the reference alludes to 'Sailing for the new world'. [[User:Andyd273|Andyd273]] ([[User talk:Andyd273|talk]]) 15:49, 2 December 2013 (UTC)

After staring at this graph for a while, I got a sudden urge to play Osmos... [[User:Andyd273|Andyd273]] ([[User talk:Andyd273|talk]]) 16:03, 2 December 2013 (UTC)

the title seems to have changed to "Exoplanet Neighborhood" and the mouseover text to what used to be the title... [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 16:36, 2 December 2013 (UTC)

Talk:1212: Interstellar Memes

2013-05-15T21:37:13Z

Xseo:

I'm surprised ponies didn't make the list given how massively and completely they took over the Internet in recent years. Then again, xkcd hasn't made any mention of the phenomenon, which is pretty nice, I guess. [[Special:Contributions/76.106.251.87|76.106.251.87]] 04:35, 15 May 2013 (UTC)
:Given that the closest one, "I'm on a boat," predates the first episode of MLP:FiM by more than a year (the brony phenomenon by even more), it's safe to say that ponies have not reached the nearest star yet. --[[Special:Contributions/24.145.230.202|24.145.230.202]] 04:42, 15 May 2013 (UTC)
:: Agreed. MLP:FIM premiered in October 2010. The show will hit the Alpha Centauri system early 2015. [[User:Frijole|Frijole]] ([[User talk:Frijole|talk]]) 16:28, 15 May 2013 (UTC)

It would be great to have the distances (in light years) of the stars as a fourth column. This would also provide a chronological order. --[[Special:Contributions/84.75.61.103|84.75.61.103]] 08:06, 15 May 2013 (UTC)

If I look at the page source, there is no transcript this time... [[User:Kaa-ching|Kaa-ching]] ([[User talk:Kaa-ching|talk]]) 08:41, 15 May 2013 (UTC)

anyone else notice Sirius is getting the Bellatrix one? [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 08:49, 15 May 2013 (UTC)
:Yeah, it was funny :D [[User:Zakator|Zakator]] ([[User talk:Zakator|talk]]) 10:55, 15 May 2013 (UTC)
::Should this reference be mentioned? On the one hand, it is a spoiler, but on the other hand, a) we *are* here to explain the jokes, and b) the book is almost a decade old, so I'm pretty sure there's a statute of limitations involved here. [[User:Curtmack|Curtmack]] ([[User talk:Curtmack|talk]]) 14:56, 15 May 2013 (UTC)
:::It's also funny that Sirius ''is'' a character in Harry Potter books/films. Double joke? --[[User:Dangerkeith3000|Dangerkeith3000]] ([[User talk:Dangerkeith3000|talk]]) 15:21, 15 May 2013 (UTC)

If any civilization have nothing better to do that repeating our memes, there is no need to apologize to them: they will obviously be glad they have at least something. How many people on our planet are repeating memes from other civilizations? None. (The circles in crop doesn't count, they are not send by radio.) -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 08:51, 15 May 2013 (UTC)

Given that the Rick Astley one is on the same star as Portal, which came out in 2007, it's probably meant to refer to rickrolling (and thus the date should also be 2007 for that one). [[User:Zakator|Zakator]] ([[User talk:Zakator|talk]]) 10:55, 15 May 2013 (UTC)

All your base are belong to us didn't start as a meme in the 1970. I don't have precise data right now but I'm pretty sure it was 1997-99 when it first appeared on the internet. Also, what is the Sun doing? [[Special:Contributions/195.32.50.126|195.32.50.126]] 11:14, 15 May 2013 (UTC)
:1998 according to knowyourmeme. And I think the Sun is probably sending out all those radio waves for the aliens to listen to, or something? But I couldn't find an accurate way to portray it, so I just left it at that. [[User:Zakator|Zakator]] ([[User talk:Zakator|talk]]) 11:18, 15 May 2013 (UTC)
:: The map only shows stars, or rather star systems. We live in the sol system, where all these memes originate from, hence the sun is shown as the origin of the "radio waves". In the same fashion, these supposed aliens don't actually live on the stars themselves, but rather on planets (or maybe moons?) around the stars. --[[User:Buggz|Buggz]] ([[User talk:Buggz|talk]]) 11:49, 15 May 2013 (UTC)

In "Take me to your leader! - No, Steve", what is the "No, Steve" part referencing? The link currently is just for the "take me to your leader" part. [[Special:Contributions/72.92.72.222|72.92.72.222]] 15:14, 15 May 2013 (UTC)
:I thought that the "No, Steve" made it into an explicit reference to Newsboys album/song (Steve Taylor wrote the lyrics for it). But then, that's a song fron 1996, and it would not be consistent with distance, while 1953 makes more sense... [[Special:Contributions/195.32.50.126|195.32.50.126]] 15:49, 15 May 2013 (UTC)

If you order the list by distance, further stars should get memes from earlier times, but this is not always the case. I think that some of the memes deserve more investigation, namely: "Internets!", "You're the man now, dog" and "All your base are belong to us!". Sort the list by distance and it becomes immediately apparent what I mean. [[Special:Contributions/195.32.50.126|195.32.50.126]] 15:54, 15 May 2013 (UTC)
:"Internets" was from George W Bush but in 2004. [http://knowyourmeme.com/memes/internets internets meme]--[[Special:Contributions/145.253.244.103|145.253.244.103]] 16:08, 15 May 2013 (UTC)
:"You're the man now, dog" refers to a web site launched in 2001 which fits to the approx. 12 Lj.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 18:29, 15 May 2013 (UTC)
:"All your base are belong to us!" should also belong to 2001. I found this [http://www.wired.com/culture/lifestyle/news/2001/02/42009 wired.com] which explains that the internet meme probably began in 2001. But I am not sure.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 18:37, 15 May 2013 (UTC)

Wouldn't "I'm on a boat!", as a popular and well-known meme known to the wider public, refer to the Old Spice commercial, rather than a song by the The Lonely Island? None of the few I spoke with had ever heard of the group, but all credited the quote to "the Old Spice guy". [[Special:Contributions/67.51.59.66|67.51.59.66]] 17:56, 15 May 2013 (UTC)
:I thought about this also before. But "I'm on a boat!" is the meme published by "The Lonely Island".--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 18:02, 15 May 2013 (UTC)
:>meme
:>published
:pick one [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 21:36, 15 May 2013 (UTC)

Talk:1212: Interstellar Memes

2013-05-15T21:36:42Z

Xseo:

I'm surprised ponies didn't make the list given how massively and completely they took over the Internet in recent years. Then again, xkcd hasn't made any mention of the phenomenon, which is pretty nice, I guess. [[Special:Contributions/76.106.251.87|76.106.251.87]] 04:35, 15 May 2013 (UTC)
:Given that the closest one, "I'm on a boat," predates the first episode of MLP:FiM by more than a year (the brony phenomenon by even more), it's safe to say that ponies have not reached the nearest star yet. --[[Special:Contributions/24.145.230.202|24.145.230.202]] 04:42, 15 May 2013 (UTC)
:: Agreed. MLP:FIM premiered in October 2010. The show will hit the Alpha Centauri system early 2015. [[User:Frijole|Frijole]] ([[User talk:Frijole|talk]]) 16:28, 15 May 2013 (UTC)

It would be great to have the distances (in light years) of the stars as a fourth column. This would also provide a chronological order. --[[Special:Contributions/84.75.61.103|84.75.61.103]] 08:06, 15 May 2013 (UTC)

If I look at the page source, there is no transcript this time... [[User:Kaa-ching|Kaa-ching]] ([[User talk:Kaa-ching|talk]]) 08:41, 15 May 2013 (UTC)

anyone else notice Sirius is getting the Bellatrix one? [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 08:49, 15 May 2013 (UTC)
:Yeah, it was funny :D [[User:Zakator|Zakator]] ([[User talk:Zakator|talk]]) 10:55, 15 May 2013 (UTC)
::Should this reference be mentioned? On the one hand, it is a spoiler, but on the other hand, a) we *are* here to explain the jokes, and b) the book is almost a decade old, so I'm pretty sure there's a statute of limitations involved here. [[User:Curtmack|Curtmack]] ([[User talk:Curtmack|talk]]) 14:56, 15 May 2013 (UTC)
:::It's also funny that Sirius ''is'' a character in Harry Potter books/films. Double joke? --[[User:Dangerkeith3000|Dangerkeith3000]] ([[User talk:Dangerkeith3000|talk]]) 15:21, 15 May 2013 (UTC)

If any civilization have nothing better to do that repeating our memes, there is no need to apologize to them: they will obviously be glad they have at least something. How many people on our planet are repeating memes from other civilizations? None. (The circles in crop doesn't count, they are not send by radio.) -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 08:51, 15 May 2013 (UTC)

Given that the Rick Astley one is on the same star as Portal, which came out in 2007, it's probably meant to refer to rickrolling (and thus the date should also be 2007 for that one). [[User:Zakator|Zakator]] ([[User talk:Zakator|talk]]) 10:55, 15 May 2013 (UTC)

All your base are belong to us didn't start as a meme in the 1970. I don't have precise data right now but I'm pretty sure it was 1997-99 when it first appeared on the internet. Also, what is the Sun doing? [[Special:Contributions/195.32.50.126|195.32.50.126]] 11:14, 15 May 2013 (UTC)
:1998 according to knowyourmeme. And I think the Sun is probably sending out all those radio waves for the aliens to listen to, or something? But I couldn't find an accurate way to portray it, so I just left it at that. [[User:Zakator|Zakator]] ([[User talk:Zakator|talk]]) 11:18, 15 May 2013 (UTC)
:: The map only shows stars, or rather star systems. We live in the sol system, where all these memes originate from, hence the sun is shown as the origin of the "radio waves". In the same fashion, these supposed aliens don't actually live on the stars themselves, but rather on planets (or maybe moons?) around the stars. --[[User:Buggz|Buggz]] ([[User talk:Buggz|talk]]) 11:49, 15 May 2013 (UTC)

In "Take me to your leader! - No, Steve", what is the "No, Steve" part referencing? The link currently is just for the "take me to your leader" part. [[Special:Contributions/72.92.72.222|72.92.72.222]] 15:14, 15 May 2013 (UTC)
:I thought that the "No, Steve" made it into an explicit reference to Newsboys album/song (Steve Taylor wrote the lyrics for it). But then, that's a song fron 1996, and it would not be consistent with distance, while 1953 makes more sense... [[Special:Contributions/195.32.50.126|195.32.50.126]] 15:49, 15 May 2013 (UTC)

If you order the list by distance, further stars should get memes from earlier times, but this is not always the case. I think that some of the memes deserve more investigation, namely: "Internets!", "You're the man now, dog" and "All your base are belong to us!". Sort the list by distance and it becomes immediately apparent what I mean. [[Special:Contributions/195.32.50.126|195.32.50.126]] 15:54, 15 May 2013 (UTC)
:"Internets" was from George W Bush but in 2004. [http://knowyourmeme.com/memes/internets internets meme]--[[Special:Contributions/145.253.244.103|145.253.244.103]] 16:08, 15 May 2013 (UTC)
:"You're the man now, dog" refers to a web site launched in 2001 which fits to the approx. 12 Lj.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 18:29, 15 May 2013 (UTC)
:"All your base are belong to us!" should also belong to 2001. I found this [http://www.wired.com/culture/lifestyle/news/2001/02/42009 wired.com] which explains that the internet meme probably began in 2001. But I am not sure.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 18:37, 15 May 2013 (UTC)

Wouldn't "I'm on a boat!", as a popular and well-known meme known to the wider public, refer to the Old Spice commercial, rather than a song by the The Lonely Island? None of the few I spoke with had ever heard of the group, but all credited the quote to "the Old Spice guy". [[Special:Contributions/67.51.59.66|67.51.59.66]] 17:56, 15 May 2013 (UTC)
:I thought about this also before. But "I'm on a boat!" is the meme published by "The Lonely Island".--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 18:02, 15 May 2013 (UTC)
>meme
>published
pick one [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 21:36, 15 May 2013 (UTC)