Editing 2298: Coronavirus Genome
Warning: You are not logged in. Your IP address will be publicly visible if you make any edits. If you log in or create an account, your edits will be attributed to your username, along with other benefits.
The edit can be undone.
Please check the comparison below to verify that this is what you want to do, and then save the changes below to finish undoing the edit.
Latest revision | Your text | ||
Line 8: | Line 8: | ||
==Explanation== | ==Explanation== | ||
− | This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|COVID-19 | + | {{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}} |
+ | This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}. | ||
− | + | [[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abreveated as G, A, C, T, and U). | |
− | + | The nucleotide sequence displayed currently finds an 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from USA East Coast. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. | |
− | |||
− | [[Cueball]] is surprised that | + | [[Cueball]] is surprised that she and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this "{{w|epigenetics}}". In the real world, epigenetics is the study of changes that are not caused by direct changes to the genome itself, but in patterns of gene expression and activation. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or placed in bold and made large to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression. |
− | + | Is this a pun on "gene editing" as with CRISPER Cas9 ? | |
− | The | + | The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which far exceeds the {{w|longest words}} of any natural language and may exceed the capabilities of any available spell-checking program. |
− | + | The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking could identify (space-delimited) lengths of genetic code that have never been seen before, but grammar checking could be used to identify whether known sequences of bases make no sense as a larger sequence (a gene, or even a whole organism), which is potentially a very big question among geneticists. | |
==Transcript== | ==Transcript== | ||
+ | {{incomplete transcript|Do NOT delete this tag too soon.}} | ||
:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.] | :[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.] | ||
:Cueball (off-screen): So that's the coronavirus genome, huh? | :Cueball (off-screen): So that's the coronavirus genome, huh? | ||
:Megan: It is! | :Megan: It is! | ||
− | :Laptop: | + | :Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA |
:[Cueball walks up and stands behind Megan, still working on the laptop.] | :[Cueball walks up and stands behind Megan, still working on the laptop.] | ||
Line 36: | Line 37: | ||
:Megan: We geneticists do most of our work in Notepad. | :Megan: We geneticists do most of our work in Notepad. | ||
− | :[A frameless panel, Cueball still standing behind Megan | + | :[A frameless panel, Cueball still standing behind Megan.] |
:Cueball: Notepad? | :Cueball: Notepad? | ||
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic. | :Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic. | ||
Line 42: | Line 43: | ||
:Megan: That extra formatting is called "epigenetics". | :Megan: That extra formatting is called "epigenetics". | ||
− | :[A regular panel | + | :[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.] |
:Cueball: Hey, why does that one have a red underline? | :Cueball: Hey, why does that one have a red underline? | ||
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations. | :Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations. | ||
Line 48: | Line 49: | ||
{{comic discussion}} | {{comic discussion}} | ||
− | + | [[Category: Comics featuring Cueball]] | |
− | [[Category: | + | [[Category: Comics featuring Megan]] |
− | [[Category: | + | [[Category: Biology]] |
[[Category:COVID-19]] | [[Category:COVID-19]] | ||
− | |||
− | |||
− | |||
− |