Editing 2299: Coronavirus Genome 2

Jump to: navigation, search

Warning: You are not logged in. Your IP address will be publicly visible if you make any edits. If you log in or create an account, your edits will be attributed to your username, along with other benefits.

The edit can be undone. Please check the comparison below to verify that this is what you want to do, and then save the changes below to finish undoing the edit.
Latest revision Your text
Line 8: Line 8:
  
 
==Explanation==
 
==Explanation==
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|COVID-19 pandemic}}.
+
{{incomplete|Created by a A SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
 +
This comic is a continuation of the previous comic, [[2298: Coronavirus Genome]].
  
It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].
+
[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the internet (though not in a form that can actually make people sick with COVID-19.)  If his post catches on and is widely shared, it might be described as "going viral".
  
[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].)  If his post catches on and is widely shared, it might be described as "going viral". (This "virtually" spreading the {{w|COVID-19|coronavirus}}, would be a prank).
+
He first attempts to tweet it, but Twitter has a 280 character limit, and the coronavirus genome is much larger than that. He decides to use Facebook instead, which has a character limit of 63,206.
Additionally while exchanging research data generally is as good an idea as using readymade tools for science publishing the genome of a dangerous virus actually might cause the virus to spread further: There are specialized manufacturers that can mail you arbitrary DNA snippets if you send them their sequence as an ASCII file. That actually can work in the other direction, too: Some of the machines used by such firms in order to save space stored a base pair in 4 bits of memory and could (using a buffer overrun) be convinced to actually try to execute instead of manufacturing the DNA code.
 
  
In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but is able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).
+
This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically. Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).
  
This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically.  Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).  It could also be a reference to the ''{{w|The Hitchhiker's Guide to the Galaxy|Hitchhiker's Guide to the Galaxy}}'' series, in which humanity is revealed to possibly be the descendants of the "useless" occupants of the planet Golgafrincham, including telephone sanitizers; unfortunately, after sending their useless members to the planet later called Earth, the remaining Golgafrinchans were subsequently wiped out by a plague caught from an unsanitized telephone. This may also be a reference to the concept of digital data sanitization (the screening of user inputs to prevent exploitation of security flaws) as in [[327: Exploits of a Mom]].
+
The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. Sometimes people Like a social media posting for an element they appreciate, such as a well composed photograph, blind to the fact that they seem to be tacitly supporting the subject of the photo which may depict something not entirely laudible. "Liking" this message, which defines a potentially deadly disease, may seem to be even more misanthropic of the Liker.
 
 
The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to "like" your friend's posts, even if you think they're strange. Alternately, the "like" button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting).  When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might "like" the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself.  (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger). In this case, Megan "like"ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd. {{citation needed}}
 
  
 
==Transcript==
 
==Transcript==
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]
+
{{incomplete transcript|Do NOT delete this tag too soon.}}
 +
[Megan sits at a desk with a laptop. She is turning away from her desk to talk to Cueball.]
 
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?
 
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?
 
:Megan: Sure.
 
:Megan: Sure.
 
:Megan: ...Why?
 
:Megan: ...Why?
  
:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]
+
[Tight focus on Megan, who is typing on her laptop.]
 
:Cueball (off-panel): Nothing.
 
:Cueball (off-panel): Nothing.
 
:Megan: I ... see.
 
:Megan: I ... see.
Line 33: Line 32:
 
:Laptop: Click
 
:Laptop: Click
  
:[In "two" frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square "speech bubble" with a "speech line" going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]
+
[Borderless panel focusing on Cueball, typing on his phone.]
:Phone:
 
::GAAAGGTAAGATGGAGAGGCCTTGTC<span style="background-color:pink">CCTGGTTCAACGAGAA</span>
 
::<font color="red">-29,602</font> <font color="skyblue">(+)</font> <span style="background-color:skyblue; color:white">Tweet</span>
 
  
:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]
+
[Borderless panel focusing on Cueball.  His phone is showing a Twitter interface, highlighting that he is trying to tweet too many characters.]
 +
:Phone: GAAAGGTAAGATGGAGAGGCCTTGTC / CCTGGTTCAACGAGAA -29,602 (+) Tweet
 +
 
 +
[Megan back in frame.]
 
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.
 
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.
:Megan: Unsettling that your first instinct is "share it online."
+
:Megan: Unsettling that your first instinct is "share it online."
 
:Cueball: It's cool, I sanitized my phone before posting.
 
:Cueball: It's cool, I sanitized my phone before posting.
  
 
{{comic discussion}}
 
{{comic discussion}}
 
+
[[Category: Comics featuring Cueball]]
[[Category:Comics with color]]
+
[[Category: Comics featuring Megan]]
[[Category:Coronavirus Genome]]
+
[[Category: Biology]]
[[Category:Comics sharing name|Coronavirus Genome]]
 
 
[[Category:COVID-19]]
 
[[Category:COVID-19]]
[[Category:Comics featuring Cueball]]
 
[[Category:Comics featuring Megan]]
 
[[Category:Biology]]
 
 
[[Category:Social networking]]
 
[[Category:Social networking]]

Please note that all contributions to explain xkcd may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see explain xkcd:Copyrights for details). Do not submit copyrighted work without permission!

To protect the wiki against automated edit spam, we kindly ask you to solve the following CAPTCHA:

Cancel | Editing help (opens in new window)