Editing 2299: Coronavirus Genome 2

Jump to: navigation, search

Warning: You are not logged in. Your IP address will be publicly visible if you make any edits. If you log in or create an account, your edits will be attributed to your username, along with other benefits.

The edit can be undone. Please check the comparison below to verify that this is what you want to do, and then save the changes below to finish undoing the edit.
Latest revision Your text
Line 36: Line 36:
 
:Phone:  
 
:Phone:  
 
::GAAAGGTAAGATGGAGAGGCCTTGTC<span style="background-color:pink">CCTGGTTCAACGAGAA</span>
 
::GAAAGGTAAGATGGAGAGGCCTTGTC<span style="background-color:pink">CCTGGTTCAACGAGAA</span>
βˆ’
::<font color="red">-29,602</font> <font color="skyblue">(+)</font> <span style="background-color:skyblue; color:white">Tweet</span>
+
::<font color="red">-29,602</font> <font color="lightblue">(+)</font> <span style="background-color:lightblue; color:white">Tweet</span>
  
 
:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]
 
:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]

Please note that all contributions to explain xkcd may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see explain xkcd:Copyrights for details). Do not submit copyrighted work without permission!

To protect the wiki against automated edit spam, we kindly ask you to solve the following CAPTCHA:

Cancel | Editing help (opens in new window)